miRTarBase - #MIRT023248 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AKAP11   
Synonyms AKAP-11, AKAP220, PPP1R44, PRKA11
Description A-kinase anchoring protein 11
Transcript NM_016248   
Expression
Putative miRNA Targets on AKAP11
3'UTR of AKAP11
(miRNA target sites are highlighted)
>AKAP11|NM_016248|3'UTR
   1 AGCAAACCCCAAACCAGTATATTTTAGTATTTGTTTGGGGAGGGGAACAAGCCAATAAAGATGTTTAGGATAAAATTTGA
  81 ATAGTGAATATTAACATCGTAAGTCAGTTGGGAGGCAAGTAAATATAGCTTTCTGAGCGCTTTGTGTTATCACTCGGTGT
 161 ATATAGTTCATACTTTTGTAATCTGTCAAAATACTACCTTCATTTATTCTTCTATACACATGTGTAGTGTGTCAAGACCC
 241 TAAGAACATGTATTTGAAGGAAGGTCTAACCAGGGGGTTTTCAGGGGCATTGTCTGACCACATTCTTTTTGTATCCAAAT
 321 AGTGCTGCTAGAAACTGCACTGAAGTGGCTGAGGATAGGTTCCAGTGATAGAGTTATAATTTTGCTCCTTTGCAAACAAA
 401 TGGTATCTAATTAATAACTAGTCTGACATCAGAAAATAAAATTGAGGCTGATTTTTAAAAATTTCTAGTAGATTTTTGGC
 481 CTTTCCTGTTTTTAAAAATCAGTTTCATTTTCATATTTCATAGATCAGCTATTGGTAGCTTTTTGATTTCCCCAAACTAT
 561 TTAATTTCTTAGCAGAAACATTAGTATTTTAGGTTTCTATAAACACTATAAGTGATAGTTTCCCCCATCCTTTCATTGAC
 641 ATTATTTGCCAATGCTGCCAGTCATTCTGGCATGAAAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
 721 GTAAGGGAGTACTTTAACCTTGCCAGTTTGTTCCCTCTTTTATTTTACTGTTTTCTTTTTAGAAACCCACTGTTAAAATT
 801 TAAAAAGGTGCTTTAAAATAAAACGCCTATAAAGATTGTGCAGTAAGAATTTTTATTGACAATAATTAAAATTTTTTTTG
 881 ACAATTTTGGGTTCCCAACTTATCTTACAAGTGAAAACTTAAATTGTAAAACATGTTGAAATTTTAAAAATTAATGTTAA
 961 TATGGAAATGCATTTAGAGAAGCCCAGTAGTTTTTATTGTTGGATTTTTGAAAAAACCTCTACCAAGAATGTGGTGTTTT
1041 TTTTGTTTGTTTGTTTGTTTGTTTTAGAAAAATTGGGATTTCCCCCCACCCCGCCCCACCCAGATAAACTATATCTACAC
1121 TGTCTCGTCAAGTTCTCTGACACGATCTTTCTGGGCTCTACATTTCCTACTAGTTTGTGTCCAGAAACTGCAAGTTGACA
1201 TGAATAGAGGACAAAGGTTGTGTCTTGCTTTTGTCTCTCTCTTCCCTCCCTGCAACTCTCTCTCCCCTCCTCCCACTCTC
1281 TTCCCCCTCCCCCCTCCTCCCACTGTCTCTCACCTCCCCCACCCCCCACTCTCTCTCATCTCTCGCTGTGTCCTGTGTAT
1361 GTGTGGGTGTGTGTGTATTTGGGTGTGTAAATGTTGGTTCTTCCACTACTGGATTTTGTAATCTAGGATAAATCACTTTT
1441 TTTGGGGACTTTGATTTTGCTCCATTACGTTTTCATTTTTTCTGAGCACTGACTGTTCTGAAAGCTGCACAAAACGTAGA
1521 AAGAAGACATAGCGCCTGCCAGGGAATAGGAAATGAGGGCACTTACACATTAATGTGAATTAGTAATTGTGGTATAGAAA
1601 TGTTTTATAGTGAAAGATTCAAATTTGCTTTTCAAGAAAAATGCCAAAAGCTATTTAAATAATTCGAGGTTACATCGTAG
1681 GTTTTGATTTTTCTCAATTTAAGATACAGAAATACAGCAAGCCTTAATATAAAGTTTCCTAAAGTTTCTTCAAGTATTTT
1761 TTAAGGTGGAGAAATGCAGGAATTGTATAACCAGAATTGTTCCTGCCTTTAGCTTTTCAGAACTTGAGATGTGGCAGCAC
1841 TGGACTGGGTTTTTTTAAATGTTAGGACTAGGAATGTTTGCTCTTGTTAATTATGAATTAATTGATTATTAAGTTTAGAA
1921 TGCATTTTTACAAGTATCTAACTATCAAATTGTGTTTAGTAACTTGAGTGTATGCACAAGTTTGATCAACAGCAAAATAG
2001 AGTTCTGAATTTCTTTTAAAGTGATGATATATTATTTTGTGAAACTTTGTGTTTGAAAATGTTTATTTCTGTTTATGGTG
2081 TAATCATTCTGAGGTGAGGCTTTTCTTATTTCCTTTGCATTTTGCTAGAGCTGTGCTGAGTTCAGCATTTGCTTATTTAA
2161 CCACTACATAATGACAGACCAGTTATTAGGTATTAGCATGTGTGGTAATAATAATAGTGGAACTTCACACTTACATCAAT
2241 TCAGTGCAGGGGCATAGAATAAAATATTAAATATTGGCAGATGTATGAAAAGAAGTGTGAGTTAAAAATATTGAATATTG
2321 GCAGGTGTGAAAACAAGTGTCAAAATTCCTCATATAGAGAAAATAATTTTGAGTTTAGAGTATTATCTTTTAATTAAGTG
2401 TAGTCTAAACTTAACTTTCTGTAAAGGCACTTTGTGGTTTTTCCAAAGATGTTCTAGATCTATTTGGTTGCTCTATAGTC
2481 AAACAGCTCTTTTGAAGACAACTGTCTTATTTTATTACAAATTGGCTTGACATATTTATACTGTAACATTGTAATATTGC
2561 TGTGCTGTACATTTTGGCCCTTACGAAATACGTCTTTTTCAGAACTGTTAAAGTTTTGATGTACATCGAGCTGAATTCTG
2641 TTTTTACCAGTTTCAAAACCTTCAAGTGATATGTGGAAAAAAGTGAATGAGACCTCTGATAGGGGGTTTTCAGAACCTTG
2721 TTCACACCAAAATGTGACAGTTCTTTCATGTTTTCCTAAACCAAGTTAAAATTACATGTATATTTTGGTGTTAAGGTTGA
2801 TTTTTAAGATACTTCTGATTTGTACAAAAGGAATGTTTCCTTTATAAATCACAGAAGAAAATGACAATATCTGTTGGATA
2881 TTTGATATAATTTAATGGTGTTATAAAACCTTTAAGAGGATTCATGGTGAATATATGTGATAACATCTTTATACTTTGAA
2961 AAATGTTCCACTTACCCTTCAGATATTTGTTGTAAGTTAATTCAATTCTTAATACTTTAATTTTGCTCCAACAAGGGCTT
3041 TATGTTGCTGGTAAGAGAATTTATTTACTAAATGCACTATGTATAAAGTGAAAGATAGTTTACTTATCTGACTTTGATAT
3121 TAGATGGCTGACATTAGTGCACATAATGCAGAGTTTAACCTTGATTCTTCAACAGAGTCCAGATTTAAATGTCTACTTAG
3201 TTAATTAGTTAGCTGATATTCTTCCACAATTAATATATTCAATTTCCCATCAGTATATCACTTTAAATTTTATGTTTTTC
3281 TAAGGAAACTTTCCACAGAATTTTAAACAACTGATGCATCCATACTCAGGGTGTAGGGAGAATACTTTGCATTTAAAAAC
3361 CCTGTCCACCTGTCACCAGCACAAGAGAATTAGAGCTTCAGTGAGAATTTAGAAAAATTATACTAAAGTGAGATGCATTT
3441 TTTCTCATTTTCAGCAAGACTCCTCTAAGCATTTACTCATTTACTGTATTCCTGCTCTGAAGATGTGGATACAGAATTAG
3521 TCACTCTTGTCACTTTATTTATTTATTGGTTTTTTTTTAACCATCTGTGTACATTCCTTTCATAGGGTAGAGTTCTAGTT
3601 CTAGAAGTTCTTATTTTGTTTTTGTTGTAATGTTTGAATACTATTTAATATCCGGTTTTAATATTGCTGGATTTGCTACC
3681 TTTGGTTACTTGTGCAGTGTTAAAAGTAATCCACTTTCTTGTTTAATATACCAGATACATAGCAAAAGCAGCTTGGAATA
3761 ATTATAGCTGTTTATTTGGCTGTGCTCAGTTACTATATTAAGATCTTGTACTGTGTAACAGTAACTCTTTTTTGCTTTTC
3841 AGTAATTTAATATGTTCACTTAACAAAATACGAACTTTGAGATGCACTAAAGTTTTGTTTCAGCAGTGGCTCAAAAAATT
3921 TCAGAAATTACTTTTGTAATTATTTGCAATTAATTGTTCTTTTATCTTACAATTGTTTAAGCCTGTGATCTTTCTTCTCC
4001 CAGCTAAGAGTTCTTCAATAAATTTAAGAAATACCTGGTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugUGGUA-ACA-GUGUGAGGu 5'
               ||||| ||| :|||:||| 
Target 5' ttttaACCATCTGTGTACATTCCt 3'
3555 - 3578 149.00 -16.10
2
miRNA  3' guUUGUGGUAACA-----GUGUGAGGu 5'
            |: : ||||||     ||||:||: 
Target 5' tcAGGGGCATTGTCTGACCACATTCTt 3'
281 - 307 128.00 -14.50
3
miRNA  3' guUUGUGGUAAC-----AGUGUGAGgu 5'
            ||:| :| ||     |||||||:  
Target 5' atAATAATAGTGGAACTTCACACTTac 3'
2208 - 2234 124.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30158294 46 COSMIC
COSN16998886 49 COSMIC
COSN30100894 52 COSMIC
COSN31525867 78 COSMIC
COSN16377654 365 COSMIC
COSN20110648 486 COSMIC
COSN6625126 490 COSMIC
COSN21166347 607 COSMIC
COSN31569977 612 COSMIC
COSN1158564 623 COSMIC
COSN27329189 723 COSMIC
COSN23883616 724 COSMIC
COSN8587592 725 COSMIC
COSN8587593 727 COSMIC
COSN26561400 811 COSMIC
COSN31551812 859 COSMIC
COSN31545301 872 COSMIC
COSN31537029 880 COSMIC
COSN6625127 1005 COSMIC
COSN6625128 1032 COSMIC
COSN29995015 1045 COSMIC
COSN16030424 1046 COSMIC
COSN20110653 1058 COSMIC
COSN1158565 1203 COSMIC
COSN17522842 1223 COSMIC
COSN7401912 1559 COSMIC
COSN26230326 1761 COSMIC
COSN8592368 1949 COSMIC
COSN7401913 2413 COSMIC
COSN17590848 2981 COSMIC
COSN17422293 3032 COSMIC
COSN23508173 3444 COSMIC
COSN17201630 3447 COSMIC
COSN31594629 3559 COSMIC
COSN29467828 3835 COSMIC
COSN31543819 3845 COSMIC
COSN24030439 3873 COSMIC
COSN31512744 3904 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759460870 16 dbSNP
rs1240203657 18 dbSNP
rs1308141878 20 dbSNP
rs765076840 22 dbSNP
rs752749799 30 dbSNP
rs1236302858 33 dbSNP
rs762628536 34 dbSNP
rs375743416 36 dbSNP
rs756432485 37 dbSNP
rs780410796 37 dbSNP
rs780213079 38 dbSNP
rs753873110 41 dbSNP
rs755143549 42 dbSNP
rs200810715 45 dbSNP
rs747397535 46 dbSNP
rs748728047 46 dbSNP
rs201678881 49 dbSNP
rs543556619 56 dbSNP
rs1406092484 64 dbSNP
rs1304295156 67 dbSNP
rs930821784 84 dbSNP
rs1372335397 91 dbSNP
rs1049283803 97 dbSNP
rs886695324 99 dbSNP
rs1232398176 100 dbSNP
rs1437400844 100 dbSNP
rs1243813802 104 dbSNP
rs1202452261 107 dbSNP
rs139308846 111 dbSNP
rs1343992642 115 dbSNP
rs1045458780 127 dbSNP
rs906939167 139 dbSNP
rs1344687187 140 dbSNP
rs1313561324 141 dbSNP
rs1245878416 145 dbSNP
rs1049250783 150 dbSNP
rs1314218968 151 dbSNP
rs1001310026 152 dbSNP
rs908971877 156 dbSNP
rs1363408181 160 dbSNP
rs1211336503 162 dbSNP
rs1162919853 174 dbSNP
rs1034120387 177 dbSNP
rs1432145517 178 dbSNP
rs1369169831 180 dbSNP
rs1189749189 186 dbSNP
rs1036003858 187 dbSNP
rs957192538 191 dbSNP
rs1392599713 196 dbSNP
rs573764773 209 dbSNP
rs542874913 211 dbSNP
rs1050607896 213 dbSNP
rs889322386 215 dbSNP
rs1360755146 220 dbSNP
rs762096001 228 dbSNP
rs1236278967 229 dbSNP
rs1334596156 233 dbSNP
rs1307263560 236 dbSNP
rs1001043355 237 dbSNP
rs1343466456 240 dbSNP
rs559410997 249 dbSNP
rs956831415 250 dbSNP
rs978102656 251 dbSNP
rs35955076 266 dbSNP
rs1009553682 275 dbSNP
rs565036878 278 dbSNP
rs1025009571 285 dbSNP
rs1160256210 288 dbSNP
rs966033620 288 dbSNP
rs1473682585 291 dbSNP
rs1267258347 293 dbSNP
rs35509656 294 dbSNP
rs971296509 297 dbSNP
rs1367285513 306 dbSNP
rs190072162 323 dbSNP
rs774098622 324 dbSNP
rs1203830651 335 dbSNP
rs1349409077 338 dbSNP
rs930791091 342 dbSNP
rs1260783834 355 dbSNP
rs1229898569 368 dbSNP
rs1321011865 370 dbSNP
rs573119792 378 dbSNP
rs12583300 389 dbSNP
rs144281800 392 dbSNP
rs1316219190 403 dbSNP
rs1384411354 404 dbSNP
rs1265689640 405 dbSNP
rs547726734 415 dbSNP
rs1427485006 419 dbSNP
rs1478561214 420 dbSNP
rs908930451 428 dbSNP
rs940971865 429 dbSNP
rs1045408997 437 dbSNP
rs906845906 443 dbSNP
rs1035971277 444 dbSNP
rs530620468 451 dbSNP
rs1465730803 457 dbSNP
rs1459546485 458 dbSNP
rs1188559852 465 dbSNP
rs1262128182 468 dbSNP
rs1223742800 479 dbSNP
rs3038994 481 dbSNP
rs56054463 481 dbSNP
rs933572239 483 dbSNP
rs374762791 487 dbSNP
rs368243695 489 dbSNP
rs1966817 490 dbSNP
rs1437378998 502 dbSNP
rs889381760 504 dbSNP
rs563869570 514 dbSNP
rs1055512052 516 dbSNP
rs529484185 520 dbSNP
rs1368121793 521 dbSNP
rs1456408283 522 dbSNP
rs1391343174 525 dbSNP
rs1190990031 527 dbSNP
rs1011399190 532 dbSNP
rs1161446545 533 dbSNP
rs1020563661 537 dbSNP
rs1241974587 552 dbSNP
rs1210444434 558 dbSNP
rs903081836 560 dbSNP
rs1389558863 569 dbSNP
rs1008075325 570 dbSNP
rs1435690116 577 dbSNP
rs1319867944 578 dbSNP
rs1195029935 589 dbSNP
rs1342533666 595 dbSNP
rs1299734448 600 dbSNP
rs777054396 604 dbSNP
rs549579060 606 dbSNP
rs1359549072 609 dbSNP
rs1397598625 615 dbSNP
rs1009689085 620 dbSNP
rs9533063 623 dbSNP
rs1327036686 629 dbSNP
rs1320754230 633 dbSNP
rs1231132511 636 dbSNP
rs1171104801 637 dbSNP
rs1269470072 640 dbSNP
rs1384112162 642 dbSNP
rs1181966870 646 dbSNP
rs1329289688 650 dbSNP
rs1208625280 653 dbSNP
rs906495565 657 dbSNP
rs965984514 661 dbSNP
rs1240886394 668 dbSNP
rs974718407 673 dbSNP
rs1220223548 675 dbSNP
rs1479484814 677 dbSNP
rs1178746732 678 dbSNP
rs1182820576 678 dbSNP
rs1173736490 679 dbSNP
rs1294694374 679 dbSNP
rs1316977728 679 dbSNP
rs1330117614 679 dbSNP
rs1342973085 679 dbSNP
rs1367260717 679 dbSNP
rs1403528833 679 dbSNP
rs1413734149 679 dbSNP
rs1439199796 679 dbSNP
rs1457268804 679 dbSNP
rs1480028232 679 dbSNP
rs1491470302 679 dbSNP
rs200275770 679 dbSNP
rs3038992 679 dbSNP
rs56355088 679 dbSNP
rs878885951 679 dbSNP
rs67437928 680 dbSNP
rs1034653829 681 dbSNP
rs12872337 681 dbSNP
rs1484836440 681 dbSNP
rs74490914 682 dbSNP
rs1161705339 683 dbSNP
rs984966809 684 dbSNP
rs908062104 686 dbSNP
rs1312034465 688 dbSNP
rs958669622 691 dbSNP
rs1158285410 695 dbSNP
rs1343367457 697 dbSNP
rs985010260 698 dbSNP
rs1467333883 704 dbSNP
rs1016125956 707 dbSNP
rs940889737 712 dbSNP
rs1378251655 713 dbSNP
rs1435198241 714 dbSNP
rs1412504192 717 dbSNP
rs1289885183 719 dbSNP
rs1210070621 723 dbSNP
rs1162149878 724 dbSNP
rs1350513943 724 dbSNP
rs1261919303 727 dbSNP
rs1227276146 729 dbSNP
rs1282701726 730 dbSNP
rs535025961 732 dbSNP
rs1178005859 741 dbSNP
rs1426466537 743 dbSNP
rs71788303 746 dbSNP
rs775623965 746 dbSNP
rs1189060640 758 dbSNP
rs1450241316 766 dbSNP
rs551358561 767 dbSNP
rs1202058640 769 dbSNP
rs971826937 769 dbSNP
rs1483028985 773 dbSNP
rs928873648 775 dbSNP
rs1212702587 776 dbSNP
rs932952843 779 dbSNP
rs375275589 788 dbSNP
rs1274640854 790 dbSNP
rs1229775996 792 dbSNP
rs1366802095 793 dbSNP
rs985825883 800 dbSNP
rs1255739549 802 dbSNP
rs1394908540 806 dbSNP
rs910777860 808 dbSNP
rs936986942 810 dbSNP
rs1369711393 811 dbSNP
rs1484926127 812 dbSNP
rs1169202125 819 dbSNP
rs1431521784 824 dbSNP
rs367580025 825 dbSNP
rs1055500653 826 dbSNP
rs571310990 828 dbSNP
rs765305659 830 dbSNP
rs947148676 832 dbSNP
rs537106344 834 dbSNP
rs902986078 835 dbSNP
rs1472268914 852 dbSNP
rs1479899066 855 dbSNP
rs1251518286 856 dbSNP
rs1008022926 857 dbSNP
rs945532694 863 dbSNP
rs1046485150 872 dbSNP
rs1290158996 872 dbSNP
rs557192179 872 dbSNP
rs1175567829 874 dbSNP
rs1243447316 875 dbSNP
rs1321724089 889 dbSNP
rs1314513613 891 dbSNP
rs1427422527 899 dbSNP
rs116959577 904 dbSNP
rs996126748 920 dbSNP
rs9533064 924 dbSNP
rs374203561 933 dbSNP
rs952146817 933 dbSNP
rs1411383293 935 dbSNP
rs1432653102 937 dbSNP
rs1162516982 945 dbSNP
rs1033706822 947 dbSNP
rs985258696 952 dbSNP
rs1006169016 953 dbSNP
rs1471715791 965 dbSNP
rs1015024407 978 dbSNP
rs373064678 984 dbSNP
rs1016046838 985 dbSNP
rs1183383684 997 dbSNP
rs961813513 1002 dbSNP
rs1209763291 1005 dbSNP
rs4942107 1005 dbSNP
rs1236476452 1011 dbSNP
rs954503692 1013 dbSNP
rs573047198 1022 dbSNP
rs1408904095 1024 dbSNP
rs928862328 1030 dbSNP
rs1562707 1032 dbSNP
rs182088289 1035 dbSNP
rs1301218111 1036 dbSNP
rs200524748 1037 dbSNP
rs1346123857 1038 dbSNP
rs1455666278 1039 dbSNP
rs113733041 1042 dbSNP
rs1198837660 1042 dbSNP
rs141184519 1042 dbSNP
rs869310567 1042 dbSNP
rs989711142 1042 dbSNP
rs1206304585 1043 dbSNP
rs914166913 1043 dbSNP
rs945500106 1045 dbSNP
rs9594726 1046 dbSNP
rs1482842535 1047 dbSNP
rs1202771581 1050 dbSNP
rs1248493153 1051 dbSNP
rs1478424808 1053 dbSNP
rs1191651680 1054 dbSNP
rs1046622669 1057 dbSNP
rs906600024 1058 dbSNP
rs1452266118 1062 dbSNP
rs1387989550 1066 dbSNP
rs938136378 1072 dbSNP
rs947086030 1078 dbSNP
rs1458998254 1084 dbSNP
rs1400561142 1086 dbSNP
rs976805827 1089 dbSNP
rs1055525818 1090 dbSNP
rs1326501370 1093 dbSNP
rs560796612 1094 dbSNP
rs1005968211 1097 dbSNP
rs1436614879 1099 dbSNP
rs1293390696 1103 dbSNP
rs1369450479 1104 dbSNP
rs1231326891 1107 dbSNP
rs1346781028 1112 dbSNP
rs1037545986 1113 dbSNP
rs116187451 1114 dbSNP
rs993267478 1118 dbSNP
rs1364609210 1121 dbSNP
rs1298382323 1124 dbSNP
rs1030150862 1127 dbSNP
rs1338945154 1128 dbSNP
rs902936354 1132 dbSNP
rs954605185 1135 dbSNP
rs1007350901 1144 dbSNP
rs1292318291 1156 dbSNP
rs1429643908 1158 dbSNP
rs148729821 1159 dbSNP
rs1040891777 1163 dbSNP
rs957695968 1168 dbSNP
rs899746654 1173 dbSNP
rs996745255 1179 dbSNP
rs1443982754 1186 dbSNP
rs549300683 1203 dbSNP
rs1048327181 1205 dbSNP
rs1342823416 1209 dbSNP
rs1276628880 1214 dbSNP
rs767285847 1222 dbSNP
rs61562522 1225 dbSNP
rs768220223 1231 dbSNP
rs1354253263 1236 dbSNP
rs1006231196 1245 dbSNP
rs928149413 1247 dbSNP
rs1015418977 1250 dbSNP
rs1342677958 1251 dbSNP
rs938090623 1253 dbSNP
rs528713021 1254 dbSNP
rs1165757787 1256 dbSNP
rs1170960890 1256 dbSNP
rs1371732490 1256 dbSNP
rs1403168100 1257 dbSNP
rs1163528461 1264 dbSNP
rs909964315 1267 dbSNP
rs1037011788 1270 dbSNP
rs1181213995 1270 dbSNP
rs1405387621 1276 dbSNP
rs1163562294 1279 dbSNP
rs1289204974 1281 dbSNP
rs1391730774 1284 dbSNP
rs149186541 1285 dbSNP
rs897727764 1286 dbSNP
rs1437858498 1288 dbSNP
rs1321859500 1289 dbSNP
rs993409977 1289 dbSNP
rs1300483034 1292 dbSNP
rs371485493 1294 dbSNP
rs1323677107 1295 dbSNP
rs1406548340 1295 dbSNP
rs1429099925 1296 dbSNP
rs1157869247 1298 dbSNP
rs1286104944 1299 dbSNP
rs1357336190 1303 dbSNP
rs1228033417 1304 dbSNP
rs1271319978 1305 dbSNP
rs1331373578 1306 dbSNP
rs1210461054 1307 dbSNP
rs1248605629 1309 dbSNP
rs1446148382 1311 dbSNP
rs1413876674 1313 dbSNP
rs1190777783 1314 dbSNP
rs1239049650 1316 dbSNP
rs1051543868 1317 dbSNP
rs1222424844 1322 dbSNP
rs1472917832 1322 dbSNP
rs571273591 1327 dbSNP
rs1414987212 1328 dbSNP
rs1217790511 1329 dbSNP
rs1367541978 1329 dbSNP
rs1458375990 1329 dbSNP
rs1003027769 1330 dbSNP
rs1384877835 1331 dbSNP
rs1035881684 1333 dbSNP
rs1319541495 1334 dbSNP
rs1399259753 1337 dbSNP
rs1457416605 1345 dbSNP
rs1413640819 1358 dbSNP
rs958878612 1360 dbSNP
rs992121363 1361 dbSNP
rs914836463 1362 dbSNP
rs1017327409 1364 dbSNP
rs1246243500 1364 dbSNP
rs1291690849 1364 dbSNP
rs1188208431 1366 dbSNP
rs1465537347 1367 dbSNP
rs879131506 1367 dbSNP
rs968749622 1370 dbSNP
rs977155317 1371 dbSNP
rs879005810 1378 dbSNP
rs879188125 1380 dbSNP
rs537070939 1383 dbSNP
rs550981189 1384 dbSNP
rs943819571 1386 dbSNP
rs1237122908 1391 dbSNP
rs1362454593 1392 dbSNP
rs1296271532 1401 dbSNP
rs1435131053 1406 dbSNP
rs1040838078 1407 dbSNP
rs1363654525 1417 dbSNP
rs921075477 1431 dbSNP
rs1349858866 1437 dbSNP
rs567638338 1444 dbSNP
rs1048756334 1449 dbSNP
rs888374990 1460 dbSNP
rs189471826 1463 dbSNP
rs1020663279 1470 dbSNP
rs1168057619 1489 dbSNP
rs1450096830 1492 dbSNP
rs552890936 1516 dbSNP
rs1036392134 1517 dbSNP
rs1483160521 1520 dbSNP
rs1238386761 1526 dbSNP
rs1213420085 1528 dbSNP
rs897892685 1531 dbSNP
rs779797326 1533 dbSNP
rs1002932993 1534 dbSNP
rs1308749930 1534 dbSNP
rs181857674 1535 dbSNP
rs958826149 1542 dbSNP
rs991408525 1558 dbSNP
rs1407710957 1568 dbSNP
rs909944510 1569 dbSNP
rs1469027515 1571 dbSNP
rs1013088078 1576 dbSNP
rs1308485220 1579 dbSNP
rs754498202 1580 dbSNP
rs1022293739 1589 dbSNP
rs185082480 1590 dbSNP
rs747782490 1593 dbSNP
rs1374851588 1594 dbSNP
rs771483415 1611 dbSNP
rs924303703 1612 dbSNP
rs965035752 1617 dbSNP
rs1434521259 1619 dbSNP
rs1163006049 1628 dbSNP
rs1423494943 1647 dbSNP
rs1414743211 1654 dbSNP
rs1190530227 1657 dbSNP
rs976444581 1659 dbSNP
rs116583105 1666 dbSNP
rs781618594 1669 dbSNP
rs1181922189 1672 dbSNP
rs922291082 1677 dbSNP
rs1243377502 1682 dbSNP
rs1048256803 1698 dbSNP
rs909774514 1699 dbSNP
rs1294680639 1707 dbSNP
rs933997289 1713 dbSNP
rs1349647710 1719 dbSNP
rs939974812 1724 dbSNP
rs1051597707 1726 dbSNP
rs890383618 1730 dbSNP
rs1037371765 1731 dbSNP
rs575636660 1733 dbSNP
rs1291883376 1738 dbSNP
rs1457422341 1740 dbSNP
rs1250159930 1745 dbSNP
rs1167365273 1751 dbSNP
rs897800167 1754 dbSNP
rs1411667206 1757 dbSNP
rs938671761 1773 dbSNP
rs1334096661 1783 dbSNP
rs1421432544 1786 dbSNP
rs1057198345 1795 dbSNP
rs543844065 1796 dbSNP
rs1014659 1803 dbSNP
rs1021824338 1806 dbSNP
rs574445238 1808 dbSNP
rs904755048 1814 dbSNP
rs1010691943 1823 dbSNP
rs1206424212 1827 dbSNP
rs1345400714 1832 dbSNP
rs540326161 1835 dbSNP
rs770350535 1841 dbSNP
rs1020627299 1850 dbSNP
rs1329287921 1868 dbSNP
rs1031899341 1875 dbSNP
rs775816280 1882 dbSNP
rs902139844 1883 dbSNP
rs964983845 1885 dbSNP
rs75417951 1892 dbSNP
rs1455816074 1894 dbSNP
rs1205511366 1896 dbSNP
rs1249185053 1904 dbSNP
rs769454811 1907 dbSNP
rs1455614841 1917 dbSNP
rs1035248694 1935 dbSNP
rs528674670 1936 dbSNP
rs959907595 1937 dbSNP
rs1201594936 1938 dbSNP
rs990985661 1940 dbSNP
rs1186323172 1941 dbSNP
rs1028028821 1946 dbSNP
rs368932286 1953 dbSNP
rs1454067754 1964 dbSNP
rs1284449838 1967 dbSNP
rs1172152031 1969 dbSNP
rs1392491245 1980 dbSNP
rs1206680818 1996 dbSNP
rs768697504 1999 dbSNP
rs1255401398 2007 dbSNP
rs1233858785 2016 dbSNP
rs962766773 2019 dbSNP
rs1297866275 2022 dbSNP
rs1305762281 2030 dbSNP
rs953847250 2033 dbSNP
rs771380282 2046 dbSNP
rs1319148080 2048 dbSNP
rs1384339160 2048 dbSNP
rs190868170 2061 dbSNP
rs11549104 2078 dbSNP
rs1233546624 2079 dbSNP
rs781737173 2086 dbSNP
rs1300974338 2087 dbSNP
rs943312716 2094 dbSNP
rs1448284224 2095 dbSNP
rs939859686 2095 dbSNP
rs1242408367 2109 dbSNP
rs1194861204 2112 dbSNP
rs1440538978 2113 dbSNP
rs972610979 2120 dbSNP
rs1211287019 2132 dbSNP
rs1486625814 2133 dbSNP
rs1272310241 2134 dbSNP
rs946533127 2135 dbSNP
rs1341536184 2145 dbSNP
rs927867873 2148 dbSNP
rs746164079 2163 dbSNP
rs531144181 2169 dbSNP
rs1229856639 2171 dbSNP
rs1057186697 2178 dbSNP
rs181337326 2180 dbSNP
rs567702465 2181 dbSNP
rs1043552639 2182 dbSNP
rs895385908 2188 dbSNP
rs530094034 2193 dbSNP
rs1428612519 2206 dbSNP
rs114421472 2207 dbSNP
rs1169333241 2208 dbSNP
rs1471626382 2209 dbSNP
rs1367484734 2216 dbSNP
rs146766886 2221 dbSNP
rs1468427280 2222 dbSNP
rs775481596 2222 dbSNP
rs1192355760 2225 dbSNP
rs762017075 2226 dbSNP
rs200385224 2229 dbSNP
rs140377492 2231 dbSNP
rs767567427 2232 dbSNP
rs1197588111 2233 dbSNP
rs1371558097 2233 dbSNP
rs144097896 2235 dbSNP
rs1292838734 2237 dbSNP
rs1234356226 2240 dbSNP
rs1357745684 2253 dbSNP
rs983857152 2255 dbSNP
rs1287062194 2256 dbSNP
rs1409723435 2258 dbSNP
rs1393923006 2268 dbSNP
rs1355586133 2281 dbSNP
rs1440039139 2290 dbSNP
rs1017103243 2295 dbSNP
rs1389566803 2296 dbSNP
rs1323834541 2305 dbSNP
rs904275155 2327 dbSNP
rs867505824 2347 dbSNP
rs961198161 2352 dbSNP
rs1294339213 2356 dbSNP
rs773367335 2362 dbSNP
rs9533065 2365 dbSNP
rs1273240942 2369 dbSNP
rs975024123 2388 dbSNP
rs1184093064 2401 dbSNP
rs1449935169 2404 dbSNP
rs927857749 2421 dbSNP
rs556166011 2422 dbSNP
rs760338242 2431 dbSNP
rs1270607798 2447 dbSNP
rs538186174 2452 dbSNP
rs915890156 2455 dbSNP
rs150972859 2463 dbSNP
rs1374716075 2468 dbSNP
rs1186309007 2474 dbSNP
rs41382557 2476 dbSNP
rs1369590253 2483 dbSNP
rs1056124891 2490 dbSNP
rs1462661749 2490 dbSNP
rs1385937163 2518 dbSNP
rs894764733 2526 dbSNP
rs1401015562 2527 dbSNP
rs926035392 2528 dbSNP
rs1011922669 2531 dbSNP
rs934828910 2533 dbSNP
rs1189384997 2536 dbSNP
rs1477110030 2548 dbSNP
rs1053252411 2549 dbSNP
rs539913833 2554 dbSNP
rs1252422111 2555 dbSNP
rs1188557380 2560 dbSNP
rs79073661 2574 dbSNP
rs898770643 2578 dbSNP
rs1215529610 2579 dbSNP
rs994279675 2580 dbSNP
rs1025799658 2583 dbSNP
rs1217951773 2586 dbSNP
rs1459970653 2591 dbSNP
rs1346572114 2592 dbSNP
rs1303544496 2594 dbSNP
rs1442401962 2595 dbSNP
rs774336963 2596 dbSNP
rs955451335 2602 dbSNP
rs1346722548 2610 dbSNP
rs1008769650 2626 dbSNP
rs186413357 2628 dbSNP
rs41288313 2629 dbSNP
rs889422624 2635 dbSNP
rs1359661007 2636 dbSNP
rs1397398538 2639 dbSNP
rs1455595796 2641 dbSNP
rs1388628300 2643 dbSNP
rs1293548860 2649 dbSNP
rs1005632786 2666 dbSNP
rs967979591 2668 dbSNP
rs977905871 2672 dbSNP
rs1208406073 2673 dbSNP
rs1485643186 2675 dbSNP
rs1318032328 2681 dbSNP
rs1016681193 2689 dbSNP
rs1281597196 2695 dbSNP
rs565178956 2697 dbSNP
rs1294467617 2701 dbSNP
rs923803549 2701 dbSNP
rs1214765811 2720 dbSNP
rs939201791 2721 dbSNP
rs1300889109 2722 dbSNP
rs1413880765 2726 dbSNP
rs961452607 2727 dbSNP
rs1376001685 2734 dbSNP
rs1065235 2736 dbSNP
rs544895155 2780 dbSNP
rs1352811609 2782 dbSNP
rs960548085 2783 dbSNP
rs947688402 2785 dbSNP
rs1038025423 2811 dbSNP
rs990706585 2816 dbSNP
rs752468357 2821 dbSNP
rs74052986 2827 dbSNP
rs1180490778 2834 dbSNP
rs1475046437 2836 dbSNP
rs1258909312 2840 dbSNP
rs1213619307 2842 dbSNP
rs76735263 2854 dbSNP
rs1047219390 2868 dbSNP
rs1184423132 2874 dbSNP
rs1308910559 2875 dbSNP
rs926052643 2876 dbSNP
rs891247111 2878 dbSNP
rs1232530437 2887 dbSNP
rs867935033 2890 dbSNP
rs1295102765 2906 dbSNP
rs1419572048 2909 dbSNP
rs1407883742 2911 dbSNP
rs77315027 2929 dbSNP
rs528468657 2933 dbSNP
rs1343161703 2940 dbSNP
rs1462508091 2943 dbSNP
rs1053147829 2945 dbSNP
rs878988875 2948 dbSNP
rs922742399 2949 dbSNP
rs541185297 2951 dbSNP
rs561298827 2964 dbSNP
rs1049969063 2972 dbSNP
rs1418990499 2983 dbSNP
rs890072870 2986 dbSNP
rs1471910341 2988 dbSNP
rs964177975 3007 dbSNP
rs77627578 3025 dbSNP
rs1038472000 3032 dbSNP
rs766579723 3032 dbSNP
rs1212653171 3033 dbSNP
rs1335277945 3037 dbSNP
rs1274844455 3040 dbSNP
rs1309309562 3051 dbSNP
rs1226291490 3054 dbSNP
rs1335110690 3058 dbSNP
rs75236981 3060 dbSNP
rs191103681 3068 dbSNP
rs993894750 3075 dbSNP
rs1034781174 3076 dbSNP
rs770018428 3078 dbSNP
rs1324186695 3080 dbSNP
rs1440487059 3088 dbSNP
rs1395434061 3092 dbSNP
rs1167572731 3093 dbSNP
rs1451998577 3096 dbSNP
rs960494972 3099 dbSNP
rs1223694173 3104 dbSNP
rs1012091518 3107 dbSNP
rs1420410905 3111 dbSNP
rs1305534952 3118 dbSNP
rs1314241328 3124 dbSNP
rs1023551778 3125 dbSNP
rs1254426115 3128 dbSNP
rs968404675 3134 dbSNP
rs1280142031 3138 dbSNP
rs1241070709 3144 dbSNP
rs1310327744 3150 dbSNP
rs1484813133 3150 dbSNP
rs1440191167 3154 dbSNP
rs947859625 3163 dbSNP
rs1328170615 3165 dbSNP
rs140822265 3175 dbSNP
rs925920910 3176 dbSNP
rs749779454 3178 dbSNP
rs1290006201 3183 dbSNP
rs1455830938 3190 dbSNP
rs79331403 3196 dbSNP
rs1480364062 3197 dbSNP
rs1454279665 3205 dbSNP
rs1047266422 3208 dbSNP
rs988820355 3217 dbSNP
rs1446262238 3230 dbSNP
rs1206624548 3232 dbSNP
rs1262207545 3232 dbSNP
rs891388524 3238 dbSNP
rs922690018 3243 dbSNP
rs1233750711 3255 dbSNP
rs567934903 3266 dbSNP
rs758173127 3274 dbSNP
rs986065960 3280 dbSNP
rs1305964757 3281 dbSNP
rs1455372570 3290 dbSNP
rs183166873 3293 dbSNP
rs1039894943 3295 dbSNP
rs376635417 3299 dbSNP
rs1038635894 3311 dbSNP
rs896797517 3326 dbSNP
rs1432443772 3331 dbSNP
rs1434861712 3332 dbSNP
rs1309523676 3333 dbSNP
rs1354564166 3339 dbSNP
rs903150953 3360 dbSNP
rs1165833034 3361 dbSNP
rs1474890677 3362 dbSNP
rs111918311 3370 dbSNP
rs1195068365 3373 dbSNP
rs1056189738 3377 dbSNP
rs896279177 3380 dbSNP
rs569068833 3382 dbSNP
rs960681043 3384 dbSNP
rs992390573 3390 dbSNP
rs1442371143 3412 dbSNP
rs1023504143 3413 dbSNP
rs1194097471 3414 dbSNP
rs1338993307 3416 dbSNP
rs1012074718 3422 dbSNP
rs530026162 3423 dbSNP
rs973756892 3427 dbSNP
rs1023919474 3429 dbSNP
rs1329959277 3433 dbSNP
rs1293265438 3435 dbSNP
rs1415903710 3437 dbSNP
rs1357860813 3438 dbSNP
rs576520993 3442 dbSNP
rs1326297962 3449 dbSNP
rs1408794556 3451 dbSNP
rs1396853556 3452 dbSNP
rs1169273756 3453 dbSNP
rs1346230805 3456 dbSNP
rs150125876 3458 dbSNP
rs138430778 3463 dbSNP
rs982430167 3466 dbSNP
rs1231050452 3469 dbSNP
rs1179759079 3479 dbSNP
rs1437312984 3489 dbSNP
rs1030882344 3493 dbSNP
rs545384629 3500 dbSNP
rs1274055131 3509 dbSNP
rs575806690 3514 dbSNP
rs912786954 3516 dbSNP
rs955998382 3519 dbSNP
rs1333199745 3523 dbSNP
rs1248584819 3524 dbSNP
rs1469760865 3532 dbSNP
rs1234222649 3534 dbSNP
rs544547372 3543 dbSNP
rs1194226332 3545 dbSNP
rs944330414 3548 dbSNP
rs1040268060 3549 dbSNP
rs11549103 3550 dbSNP
rs1440909449 3550 dbSNP
rs947538307 3550 dbSNP
rs1438295317 3551 dbSNP
rs1043134438 3556 dbSNP
rs1029693662 3564 dbSNP
rs1169222039 3573 dbSNP
rs903287798 3574 dbSNP
rs1157918103 3577 dbSNP
rs563968021 3583 dbSNP
rs878923334 3598 dbSNP
rs879248473 3604 dbSNP
rs985627764 3607 dbSNP
rs761822971 3608 dbSNP
rs911356738 3609 dbSNP
rs941551868 3611 dbSNP
rs1167700423 3622 dbSNP
rs575063473 3623 dbSNP
rs1396087465 3625 dbSNP
rs371005937 3632 dbSNP
rs1310838036 3644 dbSNP
rs896387381 3644 dbSNP
rs753973661 3651 dbSNP
rs540619163 3654 dbSNP
rs1369798248 3655 dbSNP
rs772359863 3659 dbSNP
rs1442906981 3666 dbSNP
rs918845722 3667 dbSNP
rs1343193754 3670 dbSNP
rs1437727135 3677 dbSNP
rs929628235 3679 dbSNP
rs1361508692 3680 dbSNP
rs1317606322 3691 dbSNP
rs1023978241 3692 dbSNP
rs773267579 3695 dbSNP
rs187491366 3715 dbSNP
rs1213098361 3719 dbSNP
rs1410010452 3721 dbSNP
rs560516244 3725 dbSNP
rs1452654123 3727 dbSNP
rs1394767005 3729 dbSNP
rs1194479392 3734 dbSNP
rs896226934 3736 dbSNP
rs973888025 3737 dbSNP
rs1335602034 3739 dbSNP
rs947822186 3740 dbSNP
rs1215451530 3749 dbSNP
rs1044832125 3754 dbSNP
rs1288700535 3758 dbSNP
rs1026666770 3787 dbSNP
rs766067692 3788 dbSNP
rs1303758178 3794 dbSNP
rs1220567896 3795 dbSNP
rs982399187 3797 dbSNP
rs912262372 3799 dbSNP
rs966011327 3800 dbSNP
rs975651673 3805 dbSNP
rs1466925773 3809 dbSNP
rs1000705423 3810 dbSNP
rs921523535 3812 dbSNP
rs947513978 3814 dbSNP
rs1195046289 3820 dbSNP
rs765583869 3825 dbSNP
rs924677855 3828 dbSNP
rs1474860370 3835 dbSNP
rs1184461389 3836 dbSNP
rs1419331365 3841 dbSNP
rs1461540668 3842 dbSNP
rs1164756677 3843 dbSNP
rs1392932259 3851 dbSNP
rs532603044 3853 dbSNP
rs776768240 3855 dbSNP
rs1030872489 3858 dbSNP
rs1057441512 3862 dbSNP
rs141162342 3871 dbSNP
rs191219695 3872 dbSNP
rs1345010710 3873 dbSNP
rs1013343092 3875 dbSNP
rs1211557891 3883 dbSNP
rs759544468 3890 dbSNP
rs1271846122 3894 dbSNP
rs1010178488 3907 dbSNP
rs1215003355 3909 dbSNP
rs1342116627 3915 dbSNP
rs1491137251 3932 dbSNP
rs577520981 3933 dbSNP
rs562636711 3937 dbSNP
rs531554928 3938 dbSNP
rs1303509418 3941 dbSNP
rs555016137 3950 dbSNP
rs548114292 3957 dbSNP
rs1026803065 3960 dbSNP
rs1353048854 3971 dbSNP
rs568329802 3973 dbSNP
rs34211775 3981 dbSNP
rs955419177 3983 dbSNP
rs1426192726 3986 dbSNP
rs1286196869 3998 dbSNP
rs1356126386 4006 dbSNP
rs375245475 4007 dbSNP
rs1258760079 4009 dbSNP
rs1183164045 4014 dbSNP
rs985920971 4015 dbSNP
rs1232767328 4019 dbSNP
rs1018368253 4022 dbSNP
rs1134954 4029 dbSNP
rs765202510 4032 dbSNP
rs1319506665 4034 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*