miRTarBase - #MIRT023267 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UBE2L3   
Synonyms E2-F1, L-UBC, UBCH7, UbcM4
Description ubiquitin conjugating enzyme E2 L3
Transcript NM_003347   
Expression
Putative miRNA Targets on UBE2L3
3'UTR of UBE2L3
(miRNA target sites are highlighted)
>UBE2L3|NM_003347|3'UTR
   1 AATCTGCCACGATTGGTTCCAGCAAGTGTGAGCAGAGACCCCGTGCAGTGCATTCAGACACCCCGCAAAGCAGGACTCTG
  81 TGGAAATTGACACGTGCCACCGCCTGGCGTTCGCTTGTGGCAGTTACTAACTTTCTACAGTTTTCTTAATCAAAAGTGGT
 161 CTAGGTAACCTGTAAAGAAAGGATTAAAAATTTAAGATGTTCTAGTTCTGCTCTCTTTGTTTTAAAAATCACTGCTTCAA
 241 TCTACTTCAAAAGAATGGTGTTTCTTTTCTTGTCCAATTTTATCCAAAATCTTCAAGTTACATTTAACCCATAAGGTTTA
 321 AAAAAAAGGAAAAAAAACGGTTGTGGTTCCCTTTCTTCCCTACCCTTGCCACTCCCACTTTCTGGCACCGAGTTTATTTT
 401 TCACTTACTTACTTCCCCAGACCCCGGGCTCGCCTCCACAAAGGAGAAGAGACTGCCCTGGCGGTCCTGGTGGCTTTTCT
 481 TAGCATGTGTGGCACTGTTGCCCAGTGTGGGAGTTGGTTTAAATTCTCCTGACTCCAGTTTATAACATCCTTTTAAAAAA
 561 TTTAAAAACAAACAGCCACACCCCTCCTCCAGTCCTTCTCCTCAGTTCTTGTGTGAAACTCCAGCTGATGTTACCACAGT
 641 AACATCAGTTAATTGGGCAAGCCCTGATGTCAGTGTGTGTAACTGACCTCTGGCCTGGCCTGCACAGAGAAGCCCTATAA
 721 TCACAGGTCTGTGGTGGCCCCGAAATGGGGGGCCTGCTAGTCAGGAGGATGCTGTGCACACTGTGTGTGATGAATCTCGC
 801 CAGAAAGGCTCCTGAGGTCCCAGGTTGGCACTTCTCCCTGCAGCCATTGTAGAAGATCTGCTGGTCCTTGCAGGCAAAGC
 881 TACAGCCAGAATGTCCGTTTGAAACTCCTAGCTCATCTGTCACCGAGCTTCATCCGAATGTGCCACGGAGCTTGCTCTCC
 961 ACTTCCTCCGTGCAGTGGCCCTGCCACAGCCCTCCCTCGGCACACTTTGACCCTTTGTAGGATTGGAATTAGCAGGACTC
1041 GGCTATTTAAAGCACCAGTCTGGGGTCGCCTGGGCCCCTGCTGACCCCCTCCTCCAGAGCAGCCAGCCCAGCCCGGGAAC
1121 AAGACGGACTTCCTCTCCCTTCGGACTCACAGCCTTTGCAGAGTCAAGCTCCACTTGAAGCTCACTCAGTAATATCCTTT
1201 CAATGTGTTTTATATTGTTTTGACTGCCTTTTTTTGTAGAAATAAAAATTGACCTTAGAATTTATCGTCAGATAAACTTG
1281 TAAAGATTTGAATATTAATGTCTTTTCAAGGCAAATGGGATTGTCCCCGCACTAGTAGAGAATCCATGTCGCTCTGACAC
1361 CCCAAGGAAGCCGACGATCCAAATGCCGTGTGTCACCAACCCCGCTTCTGCCACTGGCGGCTTCCCTTCTTGGCTCTTGG
1441 GGGGGACTAGATCCTGTGGAGAAGATGACTTAAACTTTGCTTTTTGTTTTAATTTTAATTCTATAACTTGAGATCTTTCC
1521 GGGGCCTACAGGCGTGTAAGACAGCTTGGTCTGGTCTGTGCAGAAGTGGGGAGTGATGGGCAGGTTCGGCAGCCTAACAT
1601 TGTTCAGGCGCATGGCCCCTGCGGTGTGTACACGAACTCGGCTTCTTTTGTCCTAGGTACGCCAAGGGCAGGTTTCTGGA
1681 GACTCCCTTGTGCCCGGGATGGCAAGGGCACCGGGCTGGCGTTTCCACATCTGTCTTCATTAGCAGAAAAGTGATGATGG
1761 ATTTTATTTCACTCACACTCCAGTTTGTAATAAAATGCCAAATTCTGTCAGCTATCCAAACAAGCCACCATTTGTTCTTG
1841 TTGCTTCTCTGGATCCAGAAATGTTGCCATTCTTGGAAACTGTCCCATTGCTTCGTATTTCTGCCAACGTAGCTCTGCCT
1921 GCCTGTCAACCCCTCACTGCACTCTGCTCATCACGGGAGGATACCTGTGTGCCGGCAGCCCCTCAGGGACTCTCAGCCCT
2001 GGCACTGGCACCCCAGGGTTGGCCCCGTCAGCAGAGGCTTGGCTTTCGAGCCAGTGGGTGTCTCTCCTTTGGGCCTGGGC
2081 GGCTTGCTCCTGCCAGCCATGCCTTCAGGGTAGGCTCTGAGCAAGCTGGCGAACAGCCCTGGCTGCTCCAAAACCAAAAA
2161 GCTGGGTCCTCTGGAGGAGGGGCGAGCTGTGGAGCAGCCACCCACTGCTGCCCCAAGCTCACTCAGGAATTCACACCCGC
2241 CTGGTTTCTTGAAGTGTGCTGGGTCCTTCCCTCTGCTCCCTACTCCCCACCACGGCAGAGAATAGGCTTTCTAAGATGCT
2321 GCGATCCCGTTCTGCTGCCCGTAATAAAAATGCTCTCAGACACTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAA---CAGUGUGAGGu 5'
            :|: ::|||    ||||||||| 
Target 5' tgGATTTTATTTCACTCACACTCCa 3'
1758 - 1782 156.00 -16.50
2
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              :||| |||   |||||| 
Target 5' tcccTACCCTTGC--CACTCCc 3'
357 - 376 129.00 -13.40
3
miRNA  3' guUUGU-GGUAACAGUGUGAGGu 5'
            ||:: ||:|| | | ||||| 
Target 5' agAATGTCCGTT-TGAAACTCCt 3'
888 - 909 127.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13904264 11 COSMIC
COSN31502406 56 COSMIC
COSN31549879 63 COSMIC
COSN24297150 140 COSMIC
COSN31579045 235 COSMIC
COSN20117188 328 COSMIC
COSN28812055 329 COSMIC
COSN10028292 376 COSMIC
COSN31944817 445 COSMIC
COSN31591649 758 COSMIC
COSN22642293 801 COSMIC
COSN31571540 857 COSMIC
COSN16527116 1000 COSMIC
COSN17854538 1034 COSMIC
COSN31483492 1143 COSMIC
COSN8014222 1610 COSMIC
COSN28416081 1714 COSMIC
COSN5989149 1767 COSMIC
COSN31588118 1881 COSMIC
COSN29513000 1909 COSMIC
COSN31518408 2028 COSMIC
COSN31541370 2112 COSMIC
COSN31593873 2165 COSMIC
rs7444 977 GWAS
rs7445 1090 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758631007 3 dbSNP
rs913225051 6 dbSNP
rs1202246843 7 dbSNP
rs371074232 11 dbSNP
rs747040036 12 dbSNP
rs375850573 13 dbSNP
rs779996955 20 dbSNP
rs749117705 23 dbSNP
rs768482302 26 dbSNP
rs774114259 28 dbSNP
rs1355527587 29 dbSNP
rs761512416 33 dbSNP
rs771752790 38 dbSNP
rs772601568 40 dbSNP
rs1345282162 42 dbSNP
rs760175697 43 dbSNP
rs936520964 44 dbSNP
rs1239068244 62 dbSNP
rs1054940471 65 dbSNP
rs535998511 66 dbSNP
rs1383742453 81 dbSNP
rs1399738362 81 dbSNP
rs1301345252 89 dbSNP
rs144274238 94 dbSNP
rs1178760363 95 dbSNP
rs146584762 102 dbSNP
rs866341369 104 dbSNP
rs867098803 105 dbSNP
rs932554663 108 dbSNP
rs534963661 109 dbSNP
rs994451348 110 dbSNP
rs372550828 113 dbSNP
rs1199527816 128 dbSNP
rs1036701734 133 dbSNP
rs1264599002 135 dbSNP
rs578139106 139 dbSNP
rs1216306134 141 dbSNP
rs896921588 154 dbSNP
rs888679440 170 dbSNP
rs373692601 193 dbSNP
rs1229460600 195 dbSNP
rs1406869105 200 dbSNP
rs1398395647 205 dbSNP
rs1007067190 207 dbSNP
rs1377758434 211 dbSNP
rs970167180 211 dbSNP
rs1407191727 212 dbSNP
rs1002448374 214 dbSNP
rs746563948 216 dbSNP
rs958152304 218 dbSNP
rs1169011334 224 dbSNP
rs192567822 235 dbSNP
rs1476636778 236 dbSNP
rs1444894049 241 dbSNP
rs989663649 249 dbSNP
rs1018409838 250 dbSNP
rs577183595 253 dbSNP
rs536756312 265 dbSNP
rs1456945311 274 dbSNP
rs376595125 276 dbSNP
rs1020727415 286 dbSNP
rs977267914 292 dbSNP
rs1197491140 300 dbSNP
rs1354247965 311 dbSNP
rs201283731 317 dbSNP
rs138201900 320 dbSNP
rs1444761359 328 dbSNP
rs202109034 329 dbSNP
rs1335250964 330 dbSNP
rs932691242 330 dbSNP
rs200480773 331 dbSNP
rs1049599619 338 dbSNP
rs967337699 339 dbSNP
rs556967182 362 dbSNP
rs1483906491 366 dbSNP
rs1176413420 372 dbSNP
rs573648517 373 dbSNP
rs1182276088 380 dbSNP
rs1183434126 388 dbSNP
rs941175217 390 dbSNP
rs978704552 391 dbSNP
rs925220725 393 dbSNP
rs1192381958 395 dbSNP
rs1361358212 396 dbSNP
rs1036879438 403 dbSNP
rs897003667 409 dbSNP
rs1372944834 416 dbSNP
rs1280336856 417 dbSNP
rs1444503201 423 dbSNP
rs957907693 424 dbSNP
rs542846456 426 dbSNP
rs1406022215 427 dbSNP
rs769132541 432 dbSNP
rs916407159 433 dbSNP
rs753843131 435 dbSNP
rs1033905894 438 dbSNP
rs570243290 440 dbSNP
rs1408329475 442 dbSNP
rs364962 450 dbSNP
rs981873883 451 dbSNP
rs918313507 456 dbSNP
rs1476774907 457 dbSNP
rs1245576489 458 dbSNP
rs894074259 459 dbSNP
rs929648248 463 dbSNP
rs1260918769 464 dbSNP
rs139298399 469 dbSNP
rs1301086726 472 dbSNP
rs1317256048 481 dbSNP
rs184821713 483 dbSNP
rs1225631248 484 dbSNP
rs1342976559 501 dbSNP
rs1196120026 512 dbSNP
rs976857183 514 dbSNP
rs1224202176 518 dbSNP
rs1348001263 533 dbSNP
rs1296866956 534 dbSNP
rs1030169657 537 dbSNP
rs543057902 548 dbSNP
rs564490841 555 dbSNP
rs1435917594 557 dbSNP
rs1428158976 558 dbSNP
rs1176597870 565 dbSNP
rs376107800 573 dbSNP
rs1481119434 583 dbSNP
rs376700494 585 dbSNP
rs543555727 591 dbSNP
rs1185815613 595 dbSNP
rs1253317298 598 dbSNP
rs1453250020 604 dbSNP
rs563853332 609 dbSNP
rs1243570599 610 dbSNP
rs1218214925 621 dbSNP
rs1440978401 622 dbSNP
rs1020380846 630 dbSNP
rs941268668 645 dbSNP
rs973100184 649 dbSNP
rs1325719169 659 dbSNP
rs1214448117 664 dbSNP
rs1276895732 664 dbSNP
rs918419254 668 dbSNP
rs1168803256 677 dbSNP
rs747248631 680 dbSNP
rs1446258901 681 dbSNP
rs1404963684 682 dbSNP
rs949931123 688 dbSNP
rs1396195084 691 dbSNP
rs1470685675 696 dbSNP
rs1045444909 700 dbSNP
rs1408612545 708 dbSNP
rs1169671144 718 dbSNP
rs903253047 724 dbSNP
rs1395509619 725 dbSNP
rs1440177809 726 dbSNP
rs905627640 727 dbSNP
rs1000152353 737 dbSNP
rs1032938914 740 dbSNP
rs957980344 742 dbSNP
rs1204505613 743 dbSNP
rs990748476 745 dbSNP
rs1462729783 747 dbSNP
rs1301382371 749 dbSNP
rs1204448330 750 dbSNP
rs1308660681 751 dbSNP
rs1328080915 760 dbSNP
rs1227005230 782 dbSNP
rs1054108208 783 dbSNP
rs1228040838 789 dbSNP
rs1269568819 792 dbSNP
rs1315334724 799 dbSNP
rs1454192119 800 dbSNP
rs1297165986 808 dbSNP
rs1462041173 812 dbSNP
rs1356260729 814 dbSNP
rs1337202099 815 dbSNP
rs892828857 816 dbSNP
rs1011157343 817 dbSNP
rs1021662316 826 dbSNP
rs1023919429 828 dbSNP
rs970601705 832 dbSNP
rs1234975312 839 dbSNP
rs1256226604 847 dbSNP
rs142622866 848 dbSNP
rs1467753621 851 dbSNP
rs1248669048 852 dbSNP
rs757706988 858 dbSNP
rs1176737278 859 dbSNP
rs982331372 864 dbSNP
rs998764688 866 dbSNP
rs1220836939 868 dbSNP
rs1359186336 882 dbSNP
rs1029725276 885 dbSNP
rs1248615097 886 dbSNP
rs918344593 888 dbSNP
rs1351132083 891 dbSNP
rs549581051 897 dbSNP
rs983823201 898 dbSNP
rs1016888435 913 dbSNP
rs867259803 915 dbSNP
rs909546582 916 dbSNP
rs962717823 917 dbSNP
rs1165310884 925 dbSNP
rs1474623731 925 dbSNP
rs3840089 925 dbSNP
rs189245026 926 dbSNP
rs528776384 936 dbSNP
rs1158605190 937 dbSNP
rs773634362 944 dbSNP
rs1039941887 947 dbSNP
rs901392905 970 dbSNP
rs116531068 971 dbSNP
rs11537777 975 dbSNP
rs1485081161 976 dbSNP
rs7444 977 dbSNP
rs13824 978 dbSNP
rs1318211465 979 dbSNP
rs1280735518 981 dbSNP
rs1000226425 982 dbSNP
rs1346124942 986 dbSNP
rs370895960 999 dbSNP
rs894456513 1000 dbSNP
rs1324626983 1003 dbSNP
rs1013305443 1004 dbSNP
rs556671815 1007 dbSNP
rs1333639079 1013 dbSNP
rs1023572880 1014 dbSNP
rs1367488259 1017 dbSNP
rs1262166709 1036 dbSNP
rs1203723506 1039 dbSNP
rs1174439575 1040 dbSNP
rs1480139621 1041 dbSNP
rs567387301 1042 dbSNP
rs981975473 1043 dbSNP
rs878864794 1045 dbSNP
rs535946093 1046 dbSNP
rs889976017 1055 dbSNP
rs1205360488 1056 dbSNP
rs553228263 1057 dbSNP
rs1486681660 1062 dbSNP
rs951150714 1068 dbSNP
rs1006920562 1069 dbSNP
rs746378007 1073 dbSNP
rs573043446 1079 dbSNP
rs7445 1090 dbSNP
rs1325641033 1099 dbSNP
rs1258626929 1109 dbSNP
rs1383689679 1115 dbSNP
rs530860432 1115 dbSNP
rs375672721 1116 dbSNP
rs1163044133 1121 dbSNP
rs181712621 1126 dbSNP
rs909576087 1127 dbSNP
rs1406863017 1128 dbSNP
rs1179231561 1132 dbSNP
rs1454319859 1136 dbSNP
rs1158077923 1139 dbSNP
rs575608057 1140 dbSNP
rs543840947 1143 dbSNP
rs563518967 1144 dbSNP
rs1240920659 1146 dbSNP
rs577308147 1148 dbSNP
rs529409285 1151 dbSNP
rs1313462423 1160 dbSNP
rs1264383517 1181 dbSNP
rs1193562887 1185 dbSNP
rs1338728565 1190 dbSNP
rs975459929 1196 dbSNP
rs971706595 1197 dbSNP
rs922881407 1206 dbSNP
rs1229393478 1213 dbSNP
rs1380258332 1214 dbSNP
rs150998267 1227 dbSNP
rs927106298 1229 dbSNP
rs1383622603 1231 dbSNP
rs761275898 1243 dbSNP
rs1041899874 1245 dbSNP
rs1408265427 1249 dbSNP
rs1412778679 1251 dbSNP
rs370259281 1255 dbSNP
rs1168956235 1262 dbSNP
rs1308677979 1265 dbSNP
rs1383707614 1268 dbSNP
rs771576946 1270 dbSNP
rs3178298 1272 dbSNP
rs924778186 1289 dbSNP
rs1444929461 1291 dbSNP
rs1335995874 1294 dbSNP
rs936109195 1295 dbSNP
rs1054484038 1297 dbSNP
rs185115611 1303 dbSNP
rs1197438343 1309 dbSNP
rs1357031893 1311 dbSNP
rs1349480311 1313 dbSNP
rs772799839 1313 dbSNP
rs1213602811 1316 dbSNP
rs1281745839 1323 dbSNP
rs1360511586 1325 dbSNP
rs189577814 1327 dbSNP
rs1485540001 1329 dbSNP
rs1046113302 1330 dbSNP
rs1412148711 1333 dbSNP
rs760319244 1343 dbSNP
rs1364242585 1345 dbSNP
rs1163404703 1347 dbSNP
rs866719996 1351 dbSNP
rs868550948 1352 dbSNP
rs766284953 1353 dbSNP
rs922992690 1365 dbSNP
rs181175406 1373 dbSNP
rs934217981 1374 dbSNP
rs1003460098 1376 dbSNP
rs754983730 1377 dbSNP
rs1174183711 1383 dbSNP
rs1222217608 1388 dbSNP
rs951181974 1388 dbSNP
rs1432570471 1389 dbSNP
rs571645036 1391 dbSNP
rs1230288226 1393 dbSNP
rs1299698403 1401 dbSNP
rs1396708060 1403 dbSNP
rs1390438902 1404 dbSNP
rs865845191 1405 dbSNP
rs1005359390 1406 dbSNP
rs1303041954 1408 dbSNP
rs1405965812 1409 dbSNP
rs1007013835 1414 dbSNP
rs1016711033 1419 dbSNP
rs752651301 1420 dbSNP
rs898585497 1421 dbSNP
rs1479159357 1429 dbSNP
rs1428566570 1430 dbSNP
rs1200012898 1431 dbSNP
rs1481301510 1437 dbSNP
rs1372530331 1439 dbSNP
rs140896068 1441 dbSNP
rs975114432 1442 dbSNP
rs922250971 1445 dbSNP
rs971459325 1446 dbSNP
rs1321450773 1450 dbSNP
rs150079120 1453 dbSNP
rs977623966 1458 dbSNP
rs1034277769 1460 dbSNP
rs1224600981 1462 dbSNP
rs1370188624 1464 dbSNP
rs1208416161 1466 dbSNP
rs1253475570 1473 dbSNP
rs768038784 1476 dbSNP
rs1481194151 1481 dbSNP
rs924809290 1486 dbSNP
rs1345473321 1499 dbSNP
rs958490245 1504 dbSNP
rs936193557 1513 dbSNP
rs1054516143 1515 dbSNP
rs914296351 1521 dbSNP
rs916007991 1522 dbSNP
rs1417275638 1524 dbSNP
rs374637289 1527 dbSNP
rs1185763855 1530 dbSNP
rs967520542 1532 dbSNP
rs948807718 1534 dbSNP
rs777893346 1535 dbSNP
rs1394333456 1536 dbSNP
rs1190700146 1541 dbSNP
rs1460048813 1546 dbSNP
rs977222449 1554 dbSNP
rs1204381886 1567 dbSNP
rs1314525557 1570 dbSNP
rs9815 1582 dbSNP
rs907180429 1585 dbSNP
rs1214394539 1586 dbSNP
rs1003491438 1588 dbSNP
rs986974523 1589 dbSNP
rs1449926960 1592 dbSNP
rs1172506087 1610 dbSNP
rs757403665 1611 dbSNP
rs567124282 1613 dbSNP
rs186015207 1623 dbSNP
rs1352729570 1624 dbSNP
rs553066772 1625 dbSNP
rs1410344081 1629 dbSNP
rs1296078231 1630 dbSNP
rs569868041 1632 dbSNP
rs898685257 1633 dbSNP
rs1017145373 1634 dbSNP
rs963860064 1635 dbSNP
rs1396234241 1640 dbSNP
rs189974069 1641 dbSNP
rs1231706833 1645 dbSNP
rs1204384848 1656 dbSNP
rs1324675161 1661 dbSNP
rs1029352296 1662 dbSNP
rs1370848502 1679 dbSNP
rs955026676 1684 dbSNP
rs1217958300 1685 dbSNP
rs907165898 1688 dbSNP
rs1358342206 1691 dbSNP
rs1315273819 1692 dbSNP
rs1298428809 1693 dbSNP
rs1308444804 1696 dbSNP
rs977033755 1697 dbSNP
rs1372326527 1698 dbSNP
rs1256332990 1700 dbSNP
rs1002880534 1708 dbSNP
rs1031889270 1712 dbSNP
rs1165708626 1713 dbSNP
rs894411596 1713 dbSNP
rs16984988 1714 dbSNP
rs372147780 1715 dbSNP
rs13392 1721 dbSNP
rs146956539 1722 dbSNP
rs770118438 1724 dbSNP
rs544149215 1725 dbSNP
rs948855792 1730 dbSNP
rs1427640436 1739 dbSNP
rs1030083511 1740 dbSNP
rs981921750 1744 dbSNP
rs369013145 1747 dbSNP
rs1265685548 1760 dbSNP
rs985772551 1769 dbSNP
rs1314620187 1774 dbSNP
rs1168274784 1786 dbSNP
rs1419514117 1787 dbSNP
rs557339341 1803 dbSNP
rs780463448 1808 dbSNP
rs910245030 1811 dbSNP
rs9609885 1812 dbSNP
rs942936291 1817 dbSNP
rs1461665293 1818 dbSNP
rs974332689 1832 dbSNP
rs928709685 1838 dbSNP
rs1459698345 1843 dbSNP
rs1343638810 1856 dbSNP
rs929309068 1867 dbSNP
rs1158533271 1870 dbSNP
rs1391616903 1880 dbSNP
rs74888988 1885 dbSNP
rs887031567 1890 dbSNP
rs941250906 1891 dbSNP
rs1038244379 1894 dbSNP
rs899644811 1895 dbSNP
rs749795474 1896 dbSNP
rs941116569 1900 dbSNP
rs1029838683 1904 dbSNP
rs1047553687 1909 dbSNP
rs890838677 1910 dbSNP
rs1484723543 1913 dbSNP
rs907305116 1924 dbSNP
rs149603920 1934 dbSNP
rs1031290624 1941 dbSNP
rs1281326148 1950 dbSNP
rs530828187 1951 dbSNP
rs373373826 1955 dbSNP
rs990791920 1956 dbSNP
rs1303209348 1974 dbSNP
rs559465504 1975 dbSNP
rs541898064 1982 dbSNP
rs1288468580 1988 dbSNP
rs1457856086 1990 dbSNP
rs1390851838 1992 dbSNP
rs55711733 1995 dbSNP
rs1174912091 1997 dbSNP
rs565113644 2003 dbSNP
rs757233333 2007 dbSNP
rs1378707877 2008 dbSNP
rs1218053467 2013 dbSNP
rs902976188 2018 dbSNP
rs376516254 2027 dbSNP
rs1260649558 2038 dbSNP
rs1188751580 2039 dbSNP
rs1465874884 2043 dbSNP
rs928705344 2048 dbSNP
rs1202466704 2049 dbSNP
rs929339936 2051 dbSNP
rs1225004147 2057 dbSNP
rs983483730 2058 dbSNP
rs550960923 2059 dbSNP
rs1297158419 2061 dbSNP
rs1436000705 2061 dbSNP
rs1367613899 2075 dbSNP
rs1334865715 2076 dbSNP
rs909209569 2081 dbSNP
rs368287885 2082 dbSNP
rs954447762 2089 dbSNP
rs764929111 2090 dbSNP
rs560951287 2092 dbSNP
rs1372813252 2093 dbSNP
rs1168845763 2095 dbSNP
rs1259333747 2098 dbSNP
rs529614245 2100 dbSNP
rs372734017 2110 dbSNP
rs1182486411 2111 dbSNP
rs1186781646 2119 dbSNP
rs1017220238 2131 dbSNP
rs566612876 2132 dbSNP
rs932480937 2134 dbSNP
rs1258205162 2135 dbSNP
rs1050914983 2140 dbSNP
rs1411257144 2149 dbSNP
rs575113277 2165 dbSNP
rs148369228 2170 dbSNP
rs1275170900 2184 dbSNP
rs998558951 2185 dbSNP
rs1313151152 2187 dbSNP
rs1244198295 2188 dbSNP
rs1031325022 2190 dbSNP
rs1419603313 2191 dbSNP
rs1296930880 2196 dbSNP
rs1336738031 2211 dbSNP
rs1357753734 2217 dbSNP
rs892793436 2221 dbSNP
rs1309068332 2222 dbSNP
rs1365446811 2228 dbSNP
rs974694790 2233 dbSNP
rs1383031804 2239 dbSNP
rs1011214454 2240 dbSNP
rs1292837374 2272 dbSNP
rs1179037060 2281 dbSNP
rs377302320 2282 dbSNP
rs1023659026 2283 dbSNP
rs1252423532 2284 dbSNP
rs1207085448 2287 dbSNP
rs141583045 2294 dbSNP
rs928827466 2295 dbSNP
rs1209409997 2304 dbSNP
rs1285066999 2305 dbSNP
rs1316467393 2307 dbSNP
rs1054210 2312 dbSNP
rs1236961479 2322 dbSNP
rs938731444 2323 dbSNP
rs1003458385 2324 dbSNP
rs1412087014 2328 dbSNP
rs76342132 2329 dbSNP
rs915907115 2330 dbSNP
rs1405660944 2331 dbSNP
rs1392413657 2333 dbSNP
rs1156353496 2336 dbSNP
rs947377928 2338 dbSNP
rs550483894 2341 dbSNP
rs5754407 2342 dbSNP
rs1479343452 2347 dbSNP
rs1235321250 2355 dbSNP
rs903113110 2356 dbSNP
rs1177228415 2357 dbSNP
rs1406569545 2363 dbSNP
rs1328511426 2364 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.628 5.1e-4 -0.658 2.4e-4 24 Click to see details
GSE28260 Renal cortex and medulla 0.797 5.5e-4 0.725 2.5e-3 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.611 9.8e-4 -0.602 1.2e-3 23 Click to see details
GSE32688 Pancreatic cancer -0.42 8.4e-3 -0.360 2.1e-2 32 Click to see details
GSE17498 Multiple myeloma 0.256 5.5e-2 0.287 3.6e-2 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.341 7.1e-2 0.214 1.8e-1 20 Click to see details
GSE19350 CNS germ cell tumors -0.354 1.3e-1 -0.287 1.8e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.216 1.6e-1 0.345 4.9e-2 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.458 1.8e-1 0.543 1.3e-1 6 Click to see details
GSE27834 Pluripotent stem cells -0.222 2.0e-1 -0.274 1.5e-1 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.15 2.4e-1 -0.080 3.5e-1 25 Click to see details
GSE17306 Multiple myeloma -0.095 2.6e-1 0.018 4.5e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.066 2.7e-1 -0.077 2.4e-1 90 Click to see details
GSE38226 Liver fibrosis 0.136 2.8e-1 0.317 8.1e-2 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.095 3.3e-1 0.089 3.4e-1 25 Click to see details
GSE21849 B cell lymphoma -0.052 3.9e-1 0.159 2.1e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.023 4.3e-1 0.017 4.5e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP 0.388 0.15 0.100 0.4 9 Click to see details
KIRC -0.182 0.17 -0.179 0.18 29 Click to see details
LIHC -0.128 0.19 -0.096 0.26 49 Click to see details
KICH 0.299 0.24 0.167 0.35 8 Click to see details
THCA -0.288 0.32 -0.500 0.2 5 Click to see details
STAD -0.16 0.35 -0.095 0.41 8 Click to see details
ESCA -0.212 0.37 0.300 0.31 5 Click to see details
CHOL -0.083 0.42 -0.067 0.43 9 Click to see details
HNSC 0.096 0.47 -0.500 0.33 3 Click to see details
HNSC 0.096 0.47 -0.500 0.33 3 Click to see details
HNSC 0.096 0.47 -0.500 0.33 3 Click to see details
HNSC 0.096 0.47 -0.500 0.33 3 Click to see details
HNSC 0.096 0.47 -0.500 0.33 3 Click to see details
HNSC 0.096 0.47 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*