miRTarBase - #MIRT023269 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM102A   
Synonyms C9orf132, EEIG1, SYM-3A, bA203J24.7
Description family with sequence similarity 102 member A
Transcript NM_001035254   
Other Transcripts NM_203305   
Expression
Putative miRNA Targets on FAM102A
3'UTR of FAM102A
(miRNA target sites are highlighted)
>FAM102A|NM_001035254|3'UTR
   1 GGAGCAGGTGTCCGGGCTGGAGAAGAGTCCTGCTTTCTCTGGAGTCCAGACCTGTATCATTCCATGAGGAACTTTCCCCT
  81 TCAGATCACCTCTGCGCCACATCTCATCCATGCCTCCTCCATGCACTCCAGTCCACACTCCCCGTAGCATCATTCCATTG
 161 CCCCTCCCATCCATGCTGGGACCCTCCTGGCCCACCAAGGCCCAGGCACCACTGTGAATATTCTCCTCTGAACCACTAGA
 241 GGGCAGGCCAGGCAGGCCAGGCGGGCCCGTGCAGCTTGTGGGCAAGAAGGAGCTGGCAAGGACCGGCGCTGCTGGAGACT
 321 GACCCAGCCCTCTGGCTGAGGACATGCAGCGGCTCCTAAATGTAGAGATGCCTGTGGCTGAGGGGGCCTCTCTACCTGTG
 401 TCCCCACTCACTCCAGGAGCACTGGCTTTGGTCACGTCTTAGCAGCAGGGCCTTGCTCCGTTGTTCCCTTGCCCTGGTGG
 481 TGGGGGGGCCAGACCACCTCCGGAATCCTGCCACCTGTGACTGTCTGACTGCTTAGTGCTTCAGCTGTCCCTTCCTTGTG
 561 TCCTGGGGGACCTGCTGGCGGCCTCTTCCTGGGAGCCATGACCTCAGACCCCACCCACACTCCAGATCGAGACCCCTGCC
 641 TCCCCCCGGCAAATGTCCTCCCGCTGCCTTGCAGCCTGCACTTTGCACATGCTCACCCCCAGCACAGTCCCACTGGCCCC
 721 TCACCTCCCCTTCCCTGAGCTCCTTCCCAAGGACTCCTGGTCACTGCCTGCTGTGCAGTCAGAGGCCCAGGGTCCAGCAG
 801 CCCGGCGGGAACGGGTGCTGCCTCTTCCTCCAGTTAGCTCCAGCTCAGGTCTGAGACCCGTGCTGAGAAAGGTCTGAGCA
 881 CCGACCGTGCCCTCTGCCCAGGGCTGGGTCCTGAGCAGCTGGTTTTCCTGCAGGAAGGTTGGAGCAAGCAAAGTCCTTCT
 961 CTGCCCTCAGGGTCAGCTGCCCAGACTGGGGCGGATGCCAGAGAGGCAGGTGGGCTGTGGCTGGACTGGTCCGGAGCTGG
1041 CTTCCTTACCAGAAAAGCCTCAGCCTTCCTCTGGAAGCATCCCCCGTTCTGGGCAAGGGGGAAGGGCTCCTTTAAGGGGT
1121 GTGCTTTCCCAGTGGGGAGCAGTCTGGCCCTGCCCCCTACTAAAGCCTCTGCTCTCAGCACTTTCCCCCAAGTCCTTGTA
1201 ACTTGCTTGAAGGTGGGTTCTGGCTGCCAGCCAGTCCCTGGACAAACTCTCCTGCCCCTTTTAAATTTCACTCATTTTGT
1281 ATAAACCCAGCAGGCTGGTGTTTACTTAGCCCTGTAGCTTTTTTCATTTTTTCTTTCCGTCTTTCTTCTTGAGTTCACGG
1361 TTCAATATTGCCTCCTCGCCCTGGTGAGGGGAGGTGCTGCTTTTCTGCCCCACCTGCCGGCTGGTTCCAGCAGCGCTGGG
1441 GCCCAGCTGGGGGGCCGGGATGGGGGCTTCTCTCTCTGGGAGGGGTGCAGGTGCCCTCCCCAGGCTGGGAGGGTTCCTTC
1521 CCTAGCTCCCCATCTGCCCCCGCTGGTGAGAGTTGGGCTTCTTGGTCTTGGAACTCCCTGGCATTGGGAACAGAGCATTT
1601 CCAGCATTTGTTGTTGTTTTACTCACCTAACCCTTAGAAAATGAATGTTAGAAGGTGCCTGCCGAGGCGGGACAGAGTGT
1681 TCGCTCGCGCTGGAGAAGGCTCTGCTCAGCCCTGAGAGTCCCTTCCTGCCCCACCGATACTGGCACTTTAAAAAGGAAGC
1761 TGACCGCACAGTGTCCAGACGAATTGGCCCCCAGAAGATGGGGAGTTCTGTCCTGCCCTTCTGTGTCTGCGTGACCTCAC
1841 CCAGCCTAGGAGGGAGGTGCATTCAGGGTAGATTTGCCTCTCATTCAAAGTTCTGGGGCTTTGGGTGGAAAACAGCCAGC
1921 TTTGGCGCTGTTGGGGAGACTCCTCCAGACCAGGAACCCCAGAAGGAGACAGAGCCTGCCACATCCTCCCACGCCAGGCC
2001 CTGGGCCAGGGTGATTGGACTGAGAATTTGGCCACAACCAAATTGATGCTGGCTGGAACCAGAGGCCAGAAAGCCTGGCC
2081 TTGTCCCCATGTGGGAGCCCTGTCCTCAGCCCTCTTGTCCCCTTGAGCTCAGTGAATTCCCACCAGGTGCCCACAGCTCC
2161 TGGACTTCAAATTCTATATATTGAGAGAGTTGGAGAGTATATCAGAGATATTTTTGGAAAGGAGTTGGTCTATGCAATGT
2241 CAGTTTGGAATCTTCTTGAAAGTTTAATGTTTTTATTAGGAGATTTAAAGAAAATAAAGGTCTACAATATCTTTAGGTTT
2321 TTTTTTTTTCCTGTTTACCGCACAAACTGACCACATGGCATGTCTATCAGGATGGAGGGTGTCCATGTTCTCCTCTGTCT
2401 TTAGGGAGGTGATAAGGAGATGGGCGGAGGGGTGTTTTTTTCTTTGACTCCCCTCCTTTCTAACAGAATGTTGCCACCAC
2481 TGCTTGAGTGGGCTGTGTTTGTTCCTCTGTCCCAGCTTCTGTTGTAGAAAATAACATTGTTAGGGGAACTCAGGCTAGTG
2561 TCAGCGTCTTGGTTTGGGGAGAAAAAATTAAATGTTTCGGTTTTTGTTTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACA-GUGUGAGGu 5'
             || |||  || |||||||| 
Target 5' tgcACTCCA--GTCCACACTCCc 3'
122 - 142 159.00 -16.80
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :|| |||    |||||||| 
Target 5' caGACCCCA--CCCACACTCCa 3'
605 - 624 152.00 -20.90
3
miRNA  3' guuuGUGGU-AAC-AGUGU-GAGGu 5'
              |||||  ||  |||| |||| 
Target 5' ttccCACCAGGTGCCCACAGCTCCt 3'
2137 - 2161 126.00 -16.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26975627 19 COSMIC
COSN30149066 39 COSMIC
COSN2533668 78 COSMIC
COSN30150457 87 COSMIC
COSN20368039 244 COSMIC
COSN21003744 262 COSMIC
COSN1373716 304 COSMIC
COSN32064468 660 COSMIC
COSN19611597 801 COSMIC
COSN31580146 893 COSMIC
COSN31518123 994 COSMIC
COSN31536050 1135 COSMIC
COSN20092020 1313 COSMIC
COSN24294985 1358 COSMIC
COSN20106634 1607 COSMIC
COSN30542908 1629 COSMIC
COSN28719372 1682 COSMIC
COSN2311117 1695 COSMIC
COSN28694873 1752 COSMIC
COSN24303211 1766 COSMIC
COSN31484862 1840 COSMIC
COSN14861040 1851 COSMIC
COSN26817414 1997 COSMIC
COSN23731271 2052 COSMIC
COSN17740623 2318 COSMIC
COSN20106624 2318 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs532935303 4 dbSNP
rs754793970 5 dbSNP
rs185677323 6 dbSNP
rs758969060 8 dbSNP
rs927084572 10 dbSNP
rs376528865 13 dbSNP
rs183227175 14 dbSNP
rs754156192 15 dbSNP
rs766563592 22 dbSNP
rs191650091 27 dbSNP
rs1472009915 30 dbSNP
rs773276236 31 dbSNP
rs772174892 32 dbSNP
rs1225848402 33 dbSNP
rs753669130 34 dbSNP
rs988909680 34 dbSNP
rs1157320722 36 dbSNP
rs201869221 37 dbSNP
rs199943878 42 dbSNP
rs1443363921 46 dbSNP
rs923302090 48 dbSNP
rs963966171 53 dbSNP
rs371451560 54 dbSNP
rs1250076817 57 dbSNP
rs1018063304 68 dbSNP
rs1318581824 69 dbSNP
rs1213394796 73 dbSNP
rs1436016671 80 dbSNP
rs1485807525 86 dbSNP
rs1338997839 87 dbSNP
rs976709093 88 dbSNP
rs1285754093 89 dbSNP
rs1356913274 90 dbSNP
rs964983553 95 dbSNP
rs1265633518 96 dbSNP
rs1465847577 97 dbSNP
rs528795656 101 dbSNP
rs1208877588 107 dbSNP
rs1017851431 109 dbSNP
rs1006328547 112 dbSNP
rs952243697 116 dbSNP
rs1026662036 120 dbSNP
rs113478202 125 dbSNP
rs1157611945 128 dbSNP
rs1457832740 131 dbSNP
rs143780472 133 dbSNP
rs1400310584 141 dbSNP
rs1056807220 143 dbSNP
rs1294923848 144 dbSNP
rs1340859223 148 dbSNP
rs1227621906 150 dbSNP
rs1031515261 151 dbSNP
rs1415124144 158 dbSNP
rs999507518 160 dbSNP
rs1312549120 162 dbSNP
rs906527690 166 dbSNP
rs140195314 168 dbSNP
rs1012495578 169 dbSNP
rs1159842786 170 dbSNP
rs374998532 171 dbSNP
rs775065514 173 dbSNP
rs1257236706 176 dbSNP
rs1482926144 177 dbSNP
rs1180556067 181 dbSNP
rs1037855341 184 dbSNP
rs1410336609 185 dbSNP
rs577472869 187 dbSNP
rs1473234216 195 dbSNP
rs1044356905 200 dbSNP
rs1475763269 211 dbSNP
rs942189909 212 dbSNP
rs1467722258 223 dbSNP
rs1257240024 225 dbSNP
rs1179823690 232 dbSNP
rs1396122754 235 dbSNP
rs888174123 238 dbSNP
rs1486605099 252 dbSNP
rs557530704 253 dbSNP
rs947188573 254 dbSNP
rs113049857 262 dbSNP
rs1053575317 263 dbSNP
rs1299915106 263 dbSNP
rs370939573 264 dbSNP
rs922255650 265 dbSNP
rs1256221046 267 dbSNP
rs976485884 268 dbSNP
rs574693308 269 dbSNP
rs1333970446 276 dbSNP
rs942605506 277 dbSNP
rs1191136354 280 dbSNP
rs1291209711 284 dbSNP
rs574769217 290 dbSNP
rs911168710 293 dbSNP
rs769516529 296 dbSNP
rs1199719411 304 dbSNP
rs554933923 305 dbSNP
rs769049077 307 dbSNP
rs989242271 307 dbSNP
rs1364282820 308 dbSNP
rs957881383 308 dbSNP
rs1031044382 314 dbSNP
rs779142107 323 dbSNP
rs1430058174 324 dbSNP
rs1386507250 329 dbSNP
rs1167800774 330 dbSNP
rs1462420768 344 dbSNP
rs1225731086 345 dbSNP
rs745379088 346 dbSNP
rs1043060 351 dbSNP
rs373081704 352 dbSNP
rs114873837 355 dbSNP
rs952190078 359 dbSNP
rs1264172445 365 dbSNP
rs1025392172 367 dbSNP
rs1185537089 372 dbSNP
rs1012276460 386 dbSNP
rs1254317639 387 dbSNP
rs1391082164 388 dbSNP
rs1428891721 392 dbSNP
rs1163865823 396 dbSNP
rs895386275 400 dbSNP
rs1348029974 410 dbSNP
rs1459403712 411 dbSNP
rs1293565793 412 dbSNP
rs748653375 418 dbSNP
rs749775399 429 dbSNP
rs537642445 435 dbSNP
rs1016544259 436 dbSNP
rs1229276276 439 dbSNP
rs1311057451 442 dbSNP
rs1002522598 449 dbSNP
rs1222952586 450 dbSNP
rs1267524005 451 dbSNP
rs374595997 459 dbSNP
rs1006354996 460 dbSNP
rs1463591352 462 dbSNP
rs879302263 463 dbSNP
rs2296704 464 dbSNP
rs146143264 466 dbSNP
rs1296613976 473 dbSNP
rs1214184963 481 dbSNP
rs929714761 482 dbSNP
rs1425424525 483 dbSNP
rs570294608 484 dbSNP
rs1411234411 485 dbSNP
rs754215279 487 dbSNP
rs1322028903 488 dbSNP
rs1052952434 489 dbSNP
rs934528387 489 dbSNP
rs780266615 492 dbSNP
rs901909501 493 dbSNP
rs1394327563 495 dbSNP
rs3818510 496 dbSNP
rs911111516 498 dbSNP
rs989357985 501 dbSNP
rs936473268 502 dbSNP
rs1230282970 505 dbSNP
rs530621980 512 dbSNP
rs1169375927 515 dbSNP
rs943346128 523 dbSNP
rs910570037 528 dbSNP
rs923761284 539 dbSNP
rs1239489377 544 dbSNP
rs977989712 550 dbSNP
rs984967711 558 dbSNP
rs1250953097 563 dbSNP
rs1471581844 565 dbSNP
rs971201578 566 dbSNP
rs780597625 570 dbSNP
rs1025085813 572 dbSNP
rs930904455 572 dbSNP
rs1413493706 576 dbSNP
rs750529163 579 dbSNP
rs990796409 580 dbSNP
rs1415748422 583 dbSNP
rs1307861406 588 dbSNP
rs972254211 594 dbSNP
rs959362845 595 dbSNP
rs1016491961 596 dbSNP
rs1340229195 598 dbSNP
rs1217607746 610 dbSNP
rs1305742323 611 dbSNP
rs1235056154 615 dbSNP
rs568025002 616 dbSNP
rs951038306 620 dbSNP
rs548173436 628 dbSNP
rs1026882714 629 dbSNP
rs41308910 631 dbSNP
rs1305175053 633 dbSNP
rs1233447192 636 dbSNP
rs1022647555 641 dbSNP
rs539851592 642 dbSNP
rs1188993067 643 dbSNP
rs1011283935 645 dbSNP
rs893058836 647 dbSNP
rs1032030515 648 dbSNP
rs998686696 648 dbSNP
rs1432109339 650 dbSNP
rs1297897754 657 dbSNP
rs1330136366 660 dbSNP
rs900892798 662 dbSNP
rs1434367608 663 dbSNP
rs1040437863 664 dbSNP
rs1371947159 670 dbSNP
rs1227949799 684 dbSNP
rs560105451 688 dbSNP
rs1339787612 689 dbSNP
rs34658008 692 dbSNP
rs1376845406 693 dbSNP
rs552889075 698 dbSNP
rs1433609536 701 dbSNP
rs1273595501 706 dbSNP
rs889455779 714 dbSNP
rs943457683 720 dbSNP
rs36092398 735 dbSNP
rs767533107 743 dbSNP
rs1053418203 750 dbSNP
rs761855650 767 dbSNP
rs1419530799 772 dbSNP
rs936582487 773 dbSNP
rs1451681216 784 dbSNP
rs923903550 798 dbSNP
rs1049042885 800 dbSNP
rs930684091 803 dbSNP
rs186800570 804 dbSNP
rs1282785899 806 dbSNP
rs1037048385 807 dbSNP
rs939504699 810 dbSNP
rs949260049 812 dbSNP
rs928126356 813 dbSNP
rs981156259 813 dbSNP
rs1270575609 814 dbSNP
rs1355509405 824 dbSNP
rs969790168 827 dbSNP
rs1211838091 828 dbSNP
rs1207597731 832 dbSNP
rs1468531072 832 dbSNP
rs1245791631 839 dbSNP
rs917956669 842 dbSNP
rs1344473341 845 dbSNP
rs563868172 859 dbSNP
rs915705974 860 dbSNP
rs1165493086 868 dbSNP
rs1336812262 870 dbSNP
rs1419290939 871 dbSNP
rs989797202 881 dbSNP
rs77108339 882 dbSNP
rs1408346289 883 dbSNP
rs574884966 886 dbSNP
rs561177417 887 dbSNP
rs984815514 889 dbSNP
rs1445624720 896 dbSNP
rs1295015782 897 dbSNP
rs999198056 901 dbSNP
rs1045873609 902 dbSNP
rs1335441500 911 dbSNP
rs965866046 912 dbSNP
rs1265727083 916 dbSNP
rs1019201726 917 dbSNP
rs951021698 918 dbSNP
rs1205367979 931 dbSNP
rs1255113036 945 dbSNP
rs1441043788 955 dbSNP
rs1258803852 961 dbSNP
rs3832637 961 dbSNP
rs1026582709 972 dbSNP
rs1472564409 977 dbSNP
rs998072419 987 dbSNP
rs966237572 991 dbSNP
rs1156814911 992 dbSNP
rs144208550 993 dbSNP
rs1257949686 1005 dbSNP
rs1189001657 1006 dbSNP
rs377263107 1011 dbSNP
rs1254186954 1015 dbSNP
rs1006585584 1017 dbSNP
rs1314513014 1026 dbSNP
rs1049155883 1031 dbSNP
rs889571022 1033 dbSNP
rs1409134566 1035 dbSNP
rs1285843876 1036 dbSNP
rs572313614 1044 dbSNP
rs1053365536 1046 dbSNP
rs897831884 1047 dbSNP
rs1352076709 1051 dbSNP
rs1255019760 1054 dbSNP
rs1036591531 1059 dbSNP
rs1213407301 1061 dbSNP
rs557410806 1062 dbSNP
rs1227074640 1065 dbSNP
rs928273028 1068 dbSNP
rs1337483072 1075 dbSNP
rs1045257326 1085 dbSNP
rs1000566049 1086 dbSNP
rs552880126 1099 dbSNP
rs1319748720 1102 dbSNP
rs539348124 1107 dbSNP
rs576669290 1109 dbSNP
rs1375850118 1128 dbSNP
rs1428937027 1132 dbSNP
rs1382334281 1140 dbSNP
rs570731239 1149 dbSNP
rs949208402 1154 dbSNP
rs556749626 1156 dbSNP
rs1387247668 1157 dbSNP
rs1300020433 1168 dbSNP
rs1328956806 1172 dbSNP
rs917750057 1180 dbSNP
rs1236048795 1181 dbSNP
rs1304558492 1187 dbSNP
rs536800432 1190 dbSNP
rs1055005275 1195 dbSNP
rs938060494 1198 dbSNP
rs1203538289 1199 dbSNP
rs1318523944 1203 dbSNP
rs909327122 1203 dbSNP
rs568171432 1206 dbSNP
rs989911904 1232 dbSNP
rs957038367 1233 dbSNP
rs547944178 1240 dbSNP
rs1455698709 1252 dbSNP
rs41306455 1255 dbSNP
rs919461236 1265 dbSNP
rs1389852206 1271 dbSNP
rs976366610 1274 dbSNP
rs762671888 1281 dbSNP
rs966727889 1287 dbSNP
rs1462461768 1296 dbSNP
rs1017723367 1298 dbSNP
rs1292371075 1313 dbSNP
rs1387968026 1314 dbSNP
rs986285754 1318 dbSNP
rs112916419 1320 dbSNP
rs1032065575 1324 dbSNP
rs1326166552 1327 dbSNP
rs1366897083 1333 dbSNP
rs1364064486 1338 dbSNP
rs1195554041 1341 dbSNP
rs1298223875 1343 dbSNP
rs1308524294 1353 dbSNP
rs1447708658 1356 dbSNP
rs1000914763 1358 dbSNP
rs552327151 1359 dbSNP
rs1018856029 1366 dbSNP
rs1214441851 1369 dbSNP
rs1247616787 1372 dbSNP
rs902184708 1374 dbSNP
rs1021074255 1377 dbSNP
rs1421399210 1378 dbSNP
rs1470171430 1391 dbSNP
rs1013502169 1398 dbSNP
rs1415675010 1402 dbSNP
rs953240238 1402 dbSNP
rs1027664183 1405 dbSNP
rs896429302 1413 dbSNP
rs1054954459 1414 dbSNP
rs994898232 1417 dbSNP
rs937842620 1418 dbSNP
rs527730711 1419 dbSNP
rs1003588225 1422 dbSNP
rs1049149759 1423 dbSNP
rs929262134 1426 dbSNP
rs919254543 1434 dbSNP
rs1227687618 1435 dbSNP
rs906763175 1447 dbSNP
rs1363911599 1449 dbSNP
rs1045371124 1450 dbSNP
rs1242973386 1454 dbSNP
rs893997582 1455 dbSNP
rs948174733 1455 dbSNP
rs148496452 1456 dbSNP
rs944940492 1457 dbSNP
rs924417514 1459 dbSNP
rs1322688100 1472 dbSNP
rs1187962058 1478 dbSNP
rs977488765 1480 dbSNP
rs1398506168 1482 dbSNP
rs910833062 1485 dbSNP
rs1345458871 1487 dbSNP
rs769605088 1489 dbSNP
rs372417839 1492 dbSNP
rs1415941256 1498 dbSNP
rs957552902 1500 dbSNP
rs552950586 1501 dbSNP
rs1225607549 1502 dbSNP
rs1285181754 1505 dbSNP
rs1169930772 1507 dbSNP
rs1027445355 1509 dbSNP
rs973296258 1513 dbSNP
rs1486576042 1516 dbSNP
rs1475863587 1520 dbSNP
rs1389639462 1525 dbSNP
rs1251071428 1529 dbSNP
rs1186695120 1531 dbSNP
rs1455989240 1536 dbSNP
rs1178480457 1537 dbSNP
rs1032018281 1539 dbSNP
rs979197893 1541 dbSNP
rs144678881 1542 dbSNP
rs1450302699 1544 dbSNP
rs1377665830 1545 dbSNP
rs1275546463 1548 dbSNP
rs1435795411 1550 dbSNP
rs1196019630 1551 dbSNP
rs1307958868 1567 dbSNP
rs1353313049 1570 dbSNP
rs1020601789 1576 dbSNP
rs1013699376 1577 dbSNP
rs1367128436 1578 dbSNP
rs1217700485 1596 dbSNP
rs563929555 1597 dbSNP
rs386416270 1610 dbSNP
rs66962591 1618 dbSNP
rs10646906 1619 dbSNP
rs10676299 1619 dbSNP
rs113777919 1619 dbSNP
rs1033616385 1624 dbSNP
rs1235803061 1626 dbSNP
rs1320310620 1631 dbSNP
rs550351438 1632 dbSNP
rs1371053940 1633 dbSNP
rs1436030810 1636 dbSNP
rs1205958152 1646 dbSNP
rs1002001702 1650 dbSNP
rs1487921318 1651 dbSNP
rs887615462 1663 dbSNP
rs182242798 1668 dbSNP
rs929403276 1669 dbSNP
rs1417937343 1670 dbSNP
rs1412165198 1672 dbSNP
rs1329554165 1676 dbSNP
rs1329222677 1677 dbSNP
rs897926174 1679 dbSNP
rs1328131344 1680 dbSNP
rs6478803 1682 dbSNP
rs944721414 1683 dbSNP
rs1012508513 1686 dbSNP
rs541148309 1688 dbSNP
rs1320588234 1689 dbSNP
rs1211323826 1691 dbSNP
rs1254470322 1695 dbSNP
rs910779438 1698 dbSNP
rs770606569 1702 dbSNP
rs936291792 1704 dbSNP
rs1476624043 1710 dbSNP
rs1425937954 1711 dbSNP
rs926140900 1721 dbSNP
rs1167217316 1722 dbSNP
rs1395441642 1732 dbSNP
rs35101384 1735 dbSNP
rs1477287774 1736 dbSNP
rs781095364 1750 dbSNP
rs41305605 1752 dbSNP
rs913656406 1755 dbSNP
rs1432718251 1765 dbSNP
rs756750223 1766 dbSNP
rs1334132229 1770 dbSNP
rs779344442 1780 dbSNP
rs1335005922 1781 dbSNP
rs769145617 1782 dbSNP
rs944340520 1784 dbSNP
rs372880832 1792 dbSNP
rs911574970 1793 dbSNP
rs1212551108 1794 dbSNP
rs1033565338 1797 dbSNP
rs1237361457 1805 dbSNP
rs985970165 1811 dbSNP
rs931906836 1818 dbSNP
rs749615568 1821 dbSNP
rs1418680765 1823 dbSNP
rs1456832862 1838 dbSNP
rs564930283 1846 dbSNP
rs544963517 1857 dbSNP
rs1387467604 1858 dbSNP
rs951979493 1863 dbSNP
rs780352296 1868 dbSNP
rs1027469141 1881 dbSNP
rs993766150 1882 dbSNP
rs1318755378 1883 dbSNP
rs897880500 1905 dbSNP
rs7859 1906 dbSNP
rs556810995 1907 dbSNP
rs149388063 1917 dbSNP
rs1023650140 1918 dbSNP
rs1206046523 1921 dbSNP
rs750692250 1926 dbSNP
rs1050426794 1927 dbSNP
rs1280069342 1931 dbSNP
rs546150816 1933 dbSNP
rs1213629948 1936 dbSNP
rs1409028369 1943 dbSNP
rs190968880 1944 dbSNP
rs1041862513 1945 dbSNP
rs1000088271 1947 dbSNP
rs1365708643 1953 dbSNP
rs554677300 1957 dbSNP
rs913614369 1961 dbSNP
rs1374644650 1962 dbSNP
rs1432697071 1972 dbSNP
rs1314608744 1975 dbSNP
rs1359819020 1976 dbSNP
rs1376043788 1978 dbSNP
rs751601414 1984 dbSNP
rs960476430 1992 dbSNP
rs1304267544 1995 dbSNP
rs532148634 1999 dbSNP
rs369247475 2001 dbSNP
rs552209752 2006 dbSNP
rs1027997117 2011 dbSNP
rs1281642017 2014 dbSNP
rs1480606021 2015 dbSNP
rs993320418 2024 dbSNP
rs1472497108 2026 dbSNP
rs1438556111 2032 dbSNP
rs962188795 2041 dbSNP
rs1393542856 2049 dbSNP
rs752562567 2053 dbSNP
rs1189715083 2056 dbSNP
rs1485759099 2084 dbSNP
rs1018995088 2085 dbSNP
rs1008934374 2095 dbSNP
rs538589985 2099 dbSNP
rs1397993386 2101 dbSNP
rs1391532042 2103 dbSNP
rs1324769207 2105 dbSNP
rs1368397159 2108 dbSNP
rs1050374140 2112 dbSNP
rs1000167045 2126 dbSNP
rs1037639279 2144 dbSNP
rs904751106 2149 dbSNP
rs907704020 2155 dbSNP
rs560147620 2157 dbSNP
rs982572940 2159 dbSNP
rs1042366318 2160 dbSNP
rs1469999565 2168 dbSNP
rs1294827114 2173 dbSNP
rs946204351 2177 dbSNP
rs1235383993 2178 dbSNP
rs1380095288 2181 dbSNP
rs1427756560 2186 dbSNP
rs540335715 2188 dbSNP
rs1374789516 2190 dbSNP
rs1465677080 2190 dbSNP
rs970795122 2199 dbSNP
rs1391741146 2204 dbSNP
rs1326936144 2209 dbSNP
rs917400158 2211 dbSNP
rs1445965648 2222 dbSNP
rs1347018957 2231 dbSNP
rs765176280 2232 dbSNP
rs1457172900 2234 dbSNP
rs1298362560 2242 dbSNP
rs1327547479 2243 dbSNP
rs3211256 2252 dbSNP
rs939063099 2253 dbSNP
rs3211257 2255 dbSNP
rs1193953620 2275 dbSNP
rs926387217 2277 dbSNP
rs980403417 2279 dbSNP
rs1167482955 2280 dbSNP
rs1337163097 2283 dbSNP
rs958051213 2283 dbSNP
rs574632423 2289 dbSNP
rs554696455 2295 dbSNP
rs1184622013 2304 dbSNP
rs570383576 2309 dbSNP
rs200385840 2318 dbSNP
rs961412782 2319 dbSNP
rs200575527 2329 dbSNP
rs10714668 2330 dbSNP
rs1164992404 2330 dbSNP
rs1344302452 2330 dbSNP
rs1415048907 2330 dbSNP
rs398012321 2330 dbSNP
rs1208035193 2331 dbSNP
rs1291007632 2332 dbSNP
rs1463443793 2333 dbSNP
rs1274835985 2334 dbSNP
rs1214046039 2337 dbSNP
rs111686473 2339 dbSNP
rs1357414061 2340 dbSNP
rs1414739033 2340 dbSNP
rs1234050191 2354 dbSNP
rs138790733 2355 dbSNP
rs1213305210 2356 dbSNP
rs764376800 2366 dbSNP
rs1488546893 2368 dbSNP
rs544429653 2375 dbSNP
rs1255365018 2378 dbSNP
rs575326342 2385 dbSNP
rs1475897614 2386 dbSNP
rs541539052 2395 dbSNP
rs1416976112 2396 dbSNP
rs995769913 2396 dbSNP
rs1361548097 2400 dbSNP
rs898852003 2402 dbSNP
rs1311588147 2404 dbSNP
rs1377857810 2417 dbSNP
rs1448774152 2417 dbSNP
rs766114246 2419 dbSNP
rs565802077 2422 dbSNP
rs904532575 2424 dbSNP
rs1020320591 2425 dbSNP
rs564993227 2426 dbSNP
rs1010900293 2430 dbSNP
rs11558949 2442 dbSNP
rs1387028480 2442 dbSNP
rs907819043 2447 dbSNP
rs1328385013 2448 dbSNP
rs1046224982 2453 dbSNP
rs1458777938 2456 dbSNP
rs949221581 2467 dbSNP
rs916652084 2468 dbSNP
rs990914086 2469 dbSNP
rs1349647100 2487 dbSNP
rs112952084 2489 dbSNP
rs1057306564 2491 dbSNP
rs75682010 2493 dbSNP
rs1380600255 2495 dbSNP
rs1390267898 2504 dbSNP
rs1454097056 2505 dbSNP
rs1172179404 2508 dbSNP
rs563634946 2522 dbSNP
rs538524192 2525 dbSNP
rs760113652 2537 dbSNP
rs1346651235 2543 dbSNP
rs1169765194 2545 dbSNP
rs1254857359 2548 dbSNP
rs180773282 2554 dbSNP
rs574622442 2555 dbSNP
rs554457477 2560 dbSNP
rs1439811793 2563 dbSNP
rs1008339081 2565 dbSNP
rs1028676676 2566 dbSNP
rs1228943048 2567 dbSNP
rs1344520617 2571 dbSNP
rs995887586 2581 dbSNP
rs920246563 2588 dbSNP
rs898794385 2589 dbSNP
rs1015924325 2594 dbSNP
rs1227712700 2598 dbSNP
rs971779980 2599 dbSNP
rs886337973 2600 dbSNP
rs940591198 2603 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.779 3.7e-6 0.766 6.4e-6 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.516 5.9e-3 -0.237 1.4e-1 23 Click to see details
GSE38226 Liver fibrosis -0.359 5.5e-2 -0.241 1.5e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.262 1.0e-1 -0.210 1.6e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.14 1.3e-1 0.171 8.8e-2 64 Click to see details
GSE28260 Renal cortex and medulla 0.328 1.4e-1 0.225 2.3e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.175 2.0e-1 -0.122 2.8e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.222 2.0e-1 0.159 2.8e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.17 2.1e-1 -0.124 2.8e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.385 2.3e-1 0.200 3.5e-1 6 Click to see details
GSE32688 Pancreatic cancer -0.129 2.4e-1 0.039 4.2e-1 32 Click to see details
GSE14794 Lymphoblastoid cells 0.071 2.5e-1 0.082 2.2e-1 90 Click to see details
GSE17306 Multiple myeloma 0.088 2.7e-1 0.116 2.1e-1 49 Click to see details
GSE21849 B cell lymphoma -0.094 3.1e-1 -0.049 4.0e-1 29 Click to see details
GSE19350 CNS germ cell tumors -0.068 4.2e-1 0.143 3.3e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.05 4.2e-1 0.162 2.5e-1 20 Click to see details
GSE17498 Multiple myeloma 0.026 4.4e-1 0.018 4.6e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.462 0 -0.241 0.05 49 Click to see details
STAD 0.887 0 0.881 0 8 Click to see details
CHOL -0.789 0.01 -0.817 0 9 Click to see details
HNSC -0.939 0.11 -0.500 0.33 3 Click to see details
THCA -0.479 0.21 -0.600 0.14 5 Click to see details
KICH 0.275 0.25 0.381 0.18 8 Click to see details
KIRC -0.084 0.33 0.004 0.49 29 Click to see details
KIRP -0.153 0.35 -0.167 0.33 9 Click to see details
ESCA 0.193 0.38 0.300 0.31 5 Click to see details
ESCA 0.193 0.38 0.300 0.31 5 Click to see details
ESCA 0.193 0.38 0.300 0.31 5 Click to see details
ESCA 0.193 0.38 0.300 0.31 5 Click to see details
ESCA 0.193 0.38 0.300 0.31 5 Click to see details
ESCA 0.193 0.38 0.300 0.31 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*