miRTarBase - #MIRT023278 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ANKRD9   
Synonyms -
Description ankyrin repeat domain 9
Transcript NM_152326   
Expression
Putative miRNA Targets on ANKRD9
3'UTR of ANKRD9
(miRNA target sites are highlighted)
>ANKRD9|NM_152326|3'UTR
   1 GCCCGGAGCACCCTAGGCGCTGGATTTTGGGACAAAACTATTTTTCAGAGCGTTGTACCGGCACTTTATATATATTGATC
  81 TCTGTACGGCACAATCTCTGCCTCATCTGTCGCATGCACTGGGGGCTGGGCTTGGATGGTCAGGTGAGTTCCAAGTGGCA
 161 GGTTTTCTGGGTGCAGCTGGGCTCGGGCCTTCAGCTCGCTGTCCAGCCCCTGAAGGGAGTGAGGACTAACCTCCCACCTT
 241 GATCTAGAGCCTCGGACAGGTGTGCGTCCCAGATGGGTGACAGCTGAGTGCCGCAGGAGCTCGGTAGGTGCAGGGGTGGG
 321 GACTGGCATGTCCAAGCAGCAGGACAGCGTATAAAAAGGCCTGGAAGCCAAGAGAACGAGCTCTGCAGCGTAGGGTTCTC
 401 ACGGGAGGTCCTGTGCGGTCAGCCTTTTGCACCCTGTGGACTCCGGGCCAGGGAGGGCACACAGGGCTGGCAGGCCCGCG
 481 GTGGCTGGTGTTGAGGCATGAACAAATTGTACCGGGTATCCCCCACCCCACTCTGACCACCAGTTCCTCCTTGGATATCA
 561 CTCCCCCTGACAGGCAGCCCACCCAGGCCTGGATTTGTCCCTGTCTCCCCCTTTTGCTTTTCCCCCATGACTAATGGGCA
 641 CCAGGTCTTGCTGCTCCTGCTTCTCACCTCTGCAGTGGCAGCAGGCCCCTGGCCCCAGGTGCATGCCGGTCAGTGGGGTT
 721 GGATGTGCCTTCCTCCAGGCCTGCCCTCTGTCCAAGCCCGGAGTGGGCTTGGTGGGCTCCCTGGTGGCCCCCAGTGGGTG
 801 CCAGGTGGTGCCCGGGGTTATTGAGGGGTGGTTGTATCACTGTAGGGACAGGCTTCTTGCCCCAGCCTGGAGAGCTGTTT
 881 TCTTCAGGAAGGTTCTGGAGATGGAGACTTGTTTGCGAATTCACCACAACTCCAGGCTGGGAGGCTGGGTCTCCGCTCTC
 961 AGAGCCGAGACACCAGGGAGGATAGCCAGGCTGCCCTGCCTGGGAATTCTGCTGGGCCGTCAAATTCAACCCGCACCAAC
1041 GTGGGCAGGAGGGCCACAGTGTCCTGCCAGGAGCAGAGGGCTGAAGGTCTGCAGGAGGAAGAACCACTATCCTGGTGGGG
1121 GGCACCTGCTGCCCACCCTGCCCCCAGCGTGCCTGGGGGGAGCACACCTGGGCATGGAGGAGTCCAGGGTGCTGGGCCAC
1201 ACAAGAGAGGTGGGGGAGAGGCCTGGACAGTAGGAAGATCTTGCCCAGGGTCCTGGATCCGCCACTCTGGGGGTGACCTT
1281 GGACAAACCTCTGCCTTGGCCCTCAGTCTCCCCATCAAGGTTTTTCCATTCAGGAGGTTTTGGGCCATCTTCAGCCACCC
1361 TACCAGCCCTGAAAAGGATGTGACTCCTGTTTCTGGGAAGTGTGTGGTGTGTTAGGTGGGCCTACAGCCCTGGTTGTGGG
1441 GAGGGAAGGATGGAGAGACAGCACAGTGACAGAGCCCAGACTGCAGGCTGGAGTGAGGGTTCCACTTCCCCGCTGCTGTG
1521 TGTCCTGGACCAGTGCCTCTGAACCTTGGCACTTGGGGCAGTGGATATTAACATCTTTCCAAGCCCAATTCTTGGGGCAT
1601 CAGGGCCTCCGGTCCTCTGGGAGGTGGCAGGTCCTCAGATTGGAGATGCCATGGGGGGGGGAGGTGCCTCTCCTTTGGAG
1681 GGTATGGAAGTGGAGACAGGAGTGGCCTGGCGCAGCTGCCGTGGTTCTTAGGGGCTGGGCCCGGGGAGCCCATGGGGCTT
1761 GTGCCTAGAAAGCCTGGGCTCCTCACTGGGGTCTAGATGTGCAGACTTCATGTCTCCCCAGCTCCAGCTCTGTTCTCTAT
1841 AGGTCAGCCTCCACAATGCCAGAGGCCCAGGGCTAGCCCCCTCCACGTCCCTCCTAGATCTACAGCTGCCCCTTTGATGA
1921 CAGCGCCATTGAGTCCCCTGGGCTGGGGGGGTCATGCAGGGGTGAGGCAGCTGCCTGCCGCCGGTACTCATTGCCTGGCC
2001 AGGCAGGACACAGGCTGGCGGGCACTGAGAGTGGGCCCCACGAAATCCATTGTCAGGTTACCAGGATGAAGAACCCAGGC
2081 TGGTCGTGGAGTGCAGGGCGGGGCCTGCCGGAAGAATTATGGGCACTGCAGCAGGAGGGCAGCCTGGGCCATTAGCTCCT
2161 GATGTCATCGATTTGGGTGAGGGGACAGGGAAGTCAGAGGAAGCTGGCCAGTGGCTCTCACGAAGACTTACAGCAGCGGA
2241 GTGGTGCCTGATTCCTAGTACAGCTGCTCCCACTGAGTCTCCAGGGATCTGTGGTTCAGGACCCCCTGCAACCCCCTCCC
2321 AGACCCCTGTACTGGTGGGAGGAGAGGACCTAGAGGAAAGGTGCTGGGCAGATAAGCAGCCGAGGGAGGCCCTGGGTTTA
2401 GCTTATCAGTCTTCTGGGCCCTCCTGCCCCAGGAAGGGCAGCGAGGACCATGGTGTTGCCCCTGTCATCGTTATCGTCCT
2481 GGCCATGAGCTTGCAGGACTGGGAGGGCCGGAGTCAGCCAGGCAGACGGCAGCACAGCATTTGCCTGTTGGCAGGTGGCC
2561 TTGGTGGCTTCCCAAAGGCAATCGCTCCACGCAGAACAAAACTCACTTTTTTGGGGGGTGAAGCACCTTGGTTCATTTGT
2641 TTAGTTCGTTAATTCCAGCAGTCTGTTTCTAAGGGAAACATGGCTGCAGCCGGTCCTGCCCCTCCACCCACCCACCAGGT
2721 GCCCAGTGTTCCCAAGGGCCCCGAATCCCAACCTTATTCAGGCGTCAGCATCTCTGCACCCCAAATGCCTGTTAGGGAGG
2801 ATAGTGAAGGCTGAGCCCTCCTGGGCTCATCAAAAGCCAGCAGTGAGAGAACACCCCCATCTCTCTGAGGTGACCTTGTA
2881 GGGCAGTCCGTGCTGTCTGGCTGGCCTGGGTGAGGTGGGCAGGGACCAAGGCCTGGCGCCTGGGCCTCGCTGGCCTTGCT
2961 CTGCGTGCTGACTTCATCCTGATAGTACCTTGATTTTCCTACTGTGACTTCCCCTTCTGTCGACTTCCTCACCAACTTTA
3041 AAATTCCGTATTGAGAGCAGTTTCCTAAGTTACCTCAAATCCTATTCAGAAGAAGGTTCTTCCTGGAAGTTGGGAGGGCG
3121 GAAAACAAGTTTAGTCACAGAAGACTACTCCATGTTTGAGCTTCTGTTTCAAGGGAAGTGAGTAACTGCCGGAGGAGCCC
3201 TGCCCCTCTGCAGTGTGTGGTGTTGCCCTGATACTTTTCAGATTGAGGTGTTACTTACATGTAATAAAATGCACAGACTT
3281 AAGTGTAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAGU-GUGAGGu 5'
              | || | | :| |||||| 
Target 5' gttcCTCCTTGGATATCACTCCc 3'
543 - 565 122.00 -11.40
2
miRNA  3' guUUGUGGUAA-CAG-------UG-UGAGGu 5'
            ||||   || |||       || ||||| 
Target 5' aaAACAAGTTTAGTCACAGAAGACTACTCCa 3'
3122 - 3152 116.00 -14.60
3
miRNA  3' guuuguggUAA-CAGUG-UGAGGu 5'
                  |||   ||| ||||| 
Target 5' gtttgcgaATTCACCACAACTCCa 3'
911 - 934 114.00 -14.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26966184 3 COSMIC
COSN30473182 5 COSMIC
COSN506935 9 COSMIC
COSN30137704 13 COSMIC
COSN15668219 19 COSMIC
COSN30536740 49 COSMIC
COSN30186469 59 COSMIC
COSN28873365 197 COSMIC
COSN7429200 390 COSMIC
COSN23344397 1291 COSMIC
COSN16016851 1501 COSMIC
COSN21094101 1636 COSMIC
COSN27526363 1652 COSMIC
COSN29476878 1662 COSMIC
COSN32147818 2663 COSMIC
COSN30029400 2760 COSMIC
COSN4754099 2835 COSMIC
COSN1164463 2837 COSMIC
COSN8822044 3021 COSMIC
COSN6241361 3596 COSMIC
COSN27873984 3628 COSMIC
COSN18766038 3634 COSMIC
COSN4754098 4116 COSMIC
COSN17911808 4316 COSMIC
COSN26678553 4577 COSMIC
COSN28793010 4620 COSMIC
COSN31576905 4642 COSMIC
COSN29866174 4686 COSMIC
COSN28702812 4691 COSMIC
COSN20774292 5022 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1447215059 2 dbSNP
rs1237485164 5 dbSNP
rs374563215 11 dbSNP
rs971674525 13 dbSNP
rs768095486 15 dbSNP
rs1287689160 18 dbSNP
rs1462229585 19 dbSNP
rs368853607 20 dbSNP
rs959269217 22 dbSNP
rs749783363 23 dbSNP
rs1354853372 25 dbSNP
rs1310369426 27 dbSNP
rs1284201977 28 dbSNP
rs758165886 33 dbSNP
rs201786042 34 dbSNP
rs1160071252 35 dbSNP
rs756676469 38 dbSNP
rs746170044 40 dbSNP
rs781702105 41 dbSNP
rs760974850 42 dbSNP
rs1300274004 45 dbSNP
rs555232519 50 dbSNP
rs538465172 52 dbSNP
rs991702977 59 dbSNP
rs750351129 63 dbSNP
rs1203080175 68 dbSNP
rs569320256 70 dbSNP
rs1453386538 72 dbSNP
rs1336669623 76 dbSNP
rs966531226 76 dbSNP
rs1449555085 84 dbSNP
rs1351588898 87 dbSNP
rs1280473026 88 dbSNP
rs1351006188 97 dbSNP
rs1222874801 100 dbSNP
rs559020730 102 dbSNP
rs1021156140 104 dbSNP
rs1325077616 106 dbSNP
rs1203680558 112 dbSNP
rs1242518320 113 dbSNP
rs1459919647 114 dbSNP
rs1183769907 118 dbSNP
rs1279330108 120 dbSNP
rs752820359 123 dbSNP
rs1233217223 125 dbSNP
rs1469390561 138 dbSNP
rs1157055851 143 dbSNP
rs993618307 160 dbSNP
rs1311645569 161 dbSNP
rs897355921 163 dbSNP
rs901532891 167 dbSNP
rs1404137334 174 dbSNP
rs1017265707 182 dbSNP
rs1330088186 185 dbSNP
rs1335581117 188 dbSNP
rs1440384620 190 dbSNP
rs1007201340 195 dbSNP
rs888042973 196 dbSNP
rs45488892 198 dbSNP
rs929474244 204 dbSNP
rs1400957590 207 dbSNP
rs1261929104 209 dbSNP
rs1321385502 211 dbSNP
rs1197504180 215 dbSNP
rs566904490 223 dbSNP
rs897987001 231 dbSNP
rs1046276393 244 dbSNP
rs558046211 249 dbSNP
rs1008675700 257 dbSNP
rs1480869188 260 dbSNP
rs1415751014 269 dbSNP
rs534945545 277 dbSNP
rs572308636 279 dbSNP
rs1433965674 280 dbSNP
rs1427318756 282 dbSNP
rs1463557009 284 dbSNP
rs1169001310 285 dbSNP
rs1396331092 293 dbSNP
rs1408628382 306 dbSNP
rs1305333323 308 dbSNP
rs889070226 311 dbSNP
rs1187162075 317 dbSNP
rs1405150491 332 dbSNP
rs1282188293 336 dbSNP
rs950121682 340 dbSNP
rs183437621 346 dbSNP
rs112132762 349 dbSNP
rs1193901561 355 dbSNP
rs574383729 356 dbSNP
rs925195494 368 dbSNP
rs1490438380 377 dbSNP
rs775654920 378 dbSNP
rs966984281 383 dbSNP
rs1020767311 394 dbSNP
rs1259348672 395 dbSNP
rs975858081 396 dbSNP
rs1373077761 402 dbSNP
rs965796751 403 dbSNP
rs1165914334 404 dbSNP
rs1017339750 408 dbSNP
rs767729884 416 dbSNP
rs887415466 417 dbSNP
rs11626770 419 dbSNP
rs1332099599 429 dbSNP
rs1028358498 430 dbSNP
rs893486554 431 dbSNP
rs567990976 433 dbSNP
rs935124983 438 dbSNP
rs1244834014 443 dbSNP
rs993763660 444 dbSNP
rs927696990 445 dbSNP
rs1317026650 448 dbSNP
rs981674410 451 dbSNP
rs548051953 464 dbSNP
rs1486969496 471 dbSNP
rs1205835997 475 dbSNP
rs1261097125 479 dbSNP
rs1185997854 480 dbSNP
rs1445777922 488 dbSNP
rs916049554 496 dbSNP
rs1444473914 498 dbSNP
rs1370039080 503 dbSNP
rs991755578 505 dbSNP
rs1333349660 527 dbSNP
rs1455005665 540 dbSNP
rs531548136 547 dbSNP
rs1383658717 555 dbSNP
rs1432182380 559 dbSNP
rs1338638624 566 dbSNP
rs190682530 567 dbSNP
rs1451729225 583 dbSNP
rs545883995 588 dbSNP
rs1027676744 592 dbSNP
rs759794552 597 dbSNP
rs962184548 598 dbSNP
rs375929136 603 dbSNP
rs1327165421 605 dbSNP
rs979780505 609 dbSNP
rs1244369941 611 dbSNP
rs1019442531 614 dbSNP
rs1008896701 629 dbSNP
rs1458428232 636 dbSNP
rs888956159 639 dbSNP
rs1420008263 642 dbSNP
rs1370424794 646 dbSNP
rs1182089346 647 dbSNP
rs1179928340 648 dbSNP
rs945299779 655 dbSNP
rs1455239612 657 dbSNP
rs532103209 674 dbSNP
rs1028753789 676 dbSNP
rs1010796848 679 dbSNP
rs1469207815 688 dbSNP
rs965827926 690 dbSNP
rs1026144011 696 dbSNP
rs985871320 696 dbSNP
rs893701475 703 dbSNP
rs1052141231 707 dbSNP
rs1348858917 708 dbSNP
rs1225476477 711 dbSNP
rs1267215223 711 dbSNP
rs1263812695 712 dbSNP
rs951842874 714 dbSNP
rs1208681637 717 dbSNP
rs1253528942 718 dbSNP
rs1027306173 728 dbSNP
rs368883923 733 dbSNP
rs994186170 735 dbSNP
rs934989922 742 dbSNP
rs774480112 750 dbSNP
rs1046188661 760 dbSNP
rs1024488614 765 dbSNP
rs1238956495 772 dbSNP
rs1014379108 779 dbSNP
rs1173869363 791 dbSNP
rs894614781 792 dbSNP
rs947758931 796 dbSNP
rs1000266126 798 dbSNP
rs1438387860 808 dbSNP
rs1284117028 813 dbSNP
rs904550567 817 dbSNP
rs916102059 825 dbSNP
rs1041732762 827 dbSNP
rs1308594056 828 dbSNP
rs946012507 829 dbSNP
rs1055956756 834 dbSNP
rs913820969 836 dbSNP
rs930908841 840 dbSNP
rs1040279010 852 dbSNP
rs150145447 865 dbSNP
rs1157136929 866 dbSNP
rs1269065825 867 dbSNP
rs1487879539 877 dbSNP
rs1188935334 882 dbSNP
rs972128256 883 dbSNP
rs112039677 892 dbSNP
rs187327365 903 dbSNP
rs1381110345 906 dbSNP
rs199889957 907 dbSNP
rs1365176328 911 dbSNP
rs1434489287 914 dbSNP
rs1477211643 915 dbSNP
rs987529222 915 dbSNP
rs755439306 916 dbSNP
rs116080304 923 dbSNP
rs574460837 926 dbSNP
rs749676467 930 dbSNP
rs1214522248 932 dbSNP
rs1010687338 933 dbSNP
rs1259027490 938 dbSNP
rs1215489713 940 dbSNP
rs1488429522 949 dbSNP
rs11160688 954 dbSNP
rs544881248 955 dbSNP
rs1344033108 960 dbSNP
rs999417563 966 dbSNP
rs114351185 967 dbSNP
rs1187862568 978 dbSNP
rs770129088 984 dbSNP
rs1034466546 986 dbSNP
rs1332951333 994 dbSNP
rs558882727 996 dbSNP
rs1012029495 1001 dbSNP
rs535615302 1011 dbSNP
rs894880763 1012 dbSNP
rs748664985 1016 dbSNP
rs150422357 1018 dbSNP
rs1361425630 1019 dbSNP
rs1010244974 1023 dbSNP
rs1453916643 1027 dbSNP
rs920733350 1029 dbSNP
rs780629977 1031 dbSNP
rs1037027904 1032 dbSNP
rs940922712 1033 dbSNP
rs911898442 1034 dbSNP
rs573241743 1036 dbSNP
rs1173724694 1040 dbSNP
rs1285840512 1050 dbSNP
rs1479271959 1051 dbSNP
rs987414787 1052 dbSNP
rs1207542401 1057 dbSNP
rs944589311 1079 dbSNP
rs888983476 1080 dbSNP
rs768183850 1085 dbSNP
rs1471664788 1086 dbSNP
rs1192323936 1088 dbSNP
rs1477827683 1094 dbSNP
rs942023 1103 dbSNP
rs1408908381 1114 dbSNP
rs1456829038 1120 dbSNP
rs920360212 1122 dbSNP
rs972190944 1123 dbSNP
rs989485207 1123 dbSNP
rs779621019 1125 dbSNP
rs1444748414 1129 dbSNP
rs1030806536 1130 dbSNP
rs999870372 1138 dbSNP
rs1280988342 1145 dbSNP
rs993068814 1148 dbSNP
rs970654119 1149 dbSNP
rs1285882727 1155 dbSNP
rs1204257931 1156 dbSNP
rs536268766 1158 dbSNP
rs1201926908 1161 dbSNP
rs549932244 1161 dbSNP
rs1024678622 1167 dbSNP
rs1011908768 1175 dbSNP
rs1440493369 1180 dbSNP
rs1206336956 1183 dbSNP
rs894934554 1189 dbSNP
rs1277421259 1191 dbSNP
rs1180230184 1193 dbSNP
rs958960282 1196 dbSNP
rs1431582614 1205 dbSNP
rs1480767119 1205 dbSNP
rs1048173819 1213 dbSNP
rs995231942 1216 dbSNP
rs899341871 1220 dbSNP
rs1412064273 1225 dbSNP
rs985194153 1227 dbSNP
rs1329930866 1245 dbSNP
rs932321845 1247 dbSNP
rs1036508206 1249 dbSNP
rs1341207766 1260 dbSNP
rs1286024675 1261 dbSNP
rs1408861212 1261 dbSNP
rs1346850423 1266 dbSNP
rs779045442 1267 dbSNP
rs1342779614 1275 dbSNP
rs940963756 1277 dbSNP
rs1280396025 1288 dbSNP
rs890700438 1289 dbSNP
rs1273417197 1293 dbSNP
rs1482584064 1294 dbSNP
rs1203289521 1323 dbSNP
rs141457489 1329 dbSNP
rs1271246086 1331 dbSNP
rs1051754189 1335 dbSNP
rs1198247376 1341 dbSNP
rs1376478958 1346 dbSNP
rs1335310044 1351 dbSNP
rs1020400456 1359 dbSNP
rs1389977849 1367 dbSNP
rs931987234 1395 dbSNP
rs1010732088 1411 dbSNP
rs1416467681 1422 dbSNP
rs1398751294 1430 dbSNP
rs1386913713 1434 dbSNP
rs1322271083 1436 dbSNP
rs1170502401 1451 dbSNP
rs1329319904 1457 dbSNP
rs1465745293 1459 dbSNP
rs901199297 1466 dbSNP
rs1298164267 1472 dbSNP
rs1341214940 1473 dbSNP
rs1225885124 1480 dbSNP
rs1019615385 1483 dbSNP
rs1006869137 1486 dbSNP
rs1425126713 1490 dbSNP
rs1209371960 1498 dbSNP
rs1265390319 1498 dbSNP
rs1448767220 1499 dbSNP
rs921903421 1501 dbSNP
rs548087364 1506 dbSNP
rs1050731165 1507 dbSNP
rs1237646846 1510 dbSNP
rs930501729 1511 dbSNP
rs989985750 1512 dbSNP
rs1386748945 1513 dbSNP
rs936747553 1514 dbSNP
rs1257421148 1524 dbSNP
rs923796124 1525 dbSNP
rs1321207171 1530 dbSNP
rs1036153826 1531 dbSNP
rs1199177690 1533 dbSNP
rs537700448 1539 dbSNP
rs1340797992 1546 dbSNP
rs1244372051 1549 dbSNP
rs1260040324 1550 dbSNP
rs117850184 1555 dbSNP
rs1205773036 1561 dbSNP
rs1268122408 1570 dbSNP
rs552074949 1571 dbSNP
rs1185861915 1575 dbSNP
rs1284938104 1575 dbSNP
rs1450637632 1579 dbSNP
rs1423536923 1580 dbSNP
rs1375137786 1590 dbSNP
rs936968785 1596 dbSNP
rs1448130776 1606 dbSNP
rs1403040307 1610 dbSNP
rs532264345 1611 dbSNP
rs1387884392 1614 dbSNP
rs560313163 1624 dbSNP
rs1024892355 1626 dbSNP
rs1395176902 1628 dbSNP
rs1310916056 1635 dbSNP
rs990694811 1635 dbSNP
rs546686971 1640 dbSNP
rs968952357 1642 dbSNP
rs1237316730 1644 dbSNP
rs1487146765 1650 dbSNP
rs1020855026 1651 dbSNP
rs1211481899 1652 dbSNP
rs1026621479 1653 dbSNP
rs529725849 1654 dbSNP
rs988941686 1654 dbSNP
rs371892398 1655 dbSNP
rs539839491 1655 dbSNP
rs544936628 1656 dbSNP
rs899025417 1656 dbSNP
rs1036617511 1657 dbSNP
rs1231598428 1657 dbSNP
rs895571505 1658 dbSNP
rs1432503464 1659 dbSNP
rs1244858940 1660 dbSNP
rs774984433 1660 dbSNP
rs35377209 1661 dbSNP
rs1374613797 1662 dbSNP
rs557018802 1662 dbSNP
rs66460675 1662 dbSNP
rs868495859 1662 dbSNP
rs1298289748 1664 dbSNP
rs1273549137 1665 dbSNP
rs1343339112 1665 dbSNP
rs1223192591 1667 dbSNP
rs1246807213 1667 dbSNP
rs1219476449 1681 dbSNP
rs1005049511 1698 dbSNP
rs534945702 1700 dbSNP
rs1249803116 1704 dbSNP
rs937040586 1707 dbSNP
rs890583690 1711 dbSNP
rs866810422 1712 dbSNP
rs1388604727 1713 dbSNP
rs376296693 1715 dbSNP
rs565508932 1716 dbSNP
rs932206278 1718 dbSNP
rs900527919 1720 dbSNP
rs1053771942 1721 dbSNP
rs936777442 1724 dbSNP
rs1366550300 1731 dbSNP
rs1434872241 1732 dbSNP
rs924039389 1734 dbSNP
rs1385375629 1735 dbSNP
rs1447922533 1741 dbSNP
rs545249767 1742 dbSNP
rs978371786 1743 dbSNP
rs750118588 1748 dbSNP
rs912659706 1752 dbSNP
rs1187799071 1754 dbSNP
rs573072687 1756 dbSNP
rs1473620833 1757 dbSNP
rs373973250 1763 dbSNP
rs553065818 1777 dbSNP
rs1182678698 1779 dbSNP
rs570822769 1781 dbSNP
rs917724195 1782 dbSNP
rs1161419589 1784 dbSNP
rs1390077680 1789 dbSNP
rs182648459 1789 dbSNP
rs1417445532 1791 dbSNP
rs995490813 1792 dbSNP
rs963642864 1795 dbSNP
rs1379262743 1797 dbSNP
rs1408761003 1798 dbSNP
rs1449134479 1817 dbSNP
rs1284495288 1822 dbSNP
rs1377951252 1832 dbSNP
rs368778751 1833 dbSNP
rs1159048983 1840 dbSNP
rs1441251024 1845 dbSNP
rs1422973476 1854 dbSNP
rs1226167407 1859 dbSNP
rs1014803933 1860 dbSNP
rs1329195383 1861 dbSNP
rs959254030 1862 dbSNP
rs1027090711 1864 dbSNP
rs1004680736 1865 dbSNP
rs536305468 1870 dbSNP
rs895643349 1878 dbSNP
rs973752448 1878 dbSNP
rs1237157027 1879 dbSNP
rs1224767731 1881 dbSNP
rs1184549099 1882 dbSNP
rs961459119 1886 dbSNP
rs905557667 1887 dbSNP
rs1157604386 1891 dbSNP
rs1015345172 1892 dbSNP
rs1043130754 1893 dbSNP
rs1333900988 1905 dbSNP
rs543318030 1910 dbSNP
rs913479840 1924 dbSNP
rs1241333308 1925 dbSNP
rs1319102024 1935 dbSNP
rs1350590311 1939 dbSNP
rs749966467 1943 dbSNP
rs1053330225 1946 dbSNP
rs1286455626 1948 dbSNP
rs944222576 1951 dbSNP
rs1219636380 1952 dbSNP
rs922250384 1958 dbSNP
rs1219135358 1961 dbSNP
rs1350014865 1972 dbSNP
rs976663765 1973 dbSNP
rs912733792 1974 dbSNP
rs1367742417 1975 dbSNP
rs890636263 1979 dbSNP
rs1180069012 1980 dbSNP
rs556931604 1980 dbSNP
rs117332555 1982 dbSNP
rs961365558 1983 dbSNP
rs1014827787 1988 dbSNP
rs1298354479 1991 dbSNP
rs1370786947 1997 dbSNP
rs1326249455 2004 dbSNP
rs1332269336 2006 dbSNP
rs1437140956 2013 dbSNP
rs900747808 2019 dbSNP
rs1054229250 2020 dbSNP
rs1230319797 2032 dbSNP
rs1175327268 2037 dbSNP
rs569038483 2041 dbSNP
rs551707141 2042 dbSNP
rs552421725 2043 dbSNP
rs1001296172 2051 dbSNP
rs1292159192 2053 dbSNP
rs1452185107 2061 dbSNP
rs1198796912 2064 dbSNP
rs1245474026 2075 dbSNP
rs1451800476 2077 dbSNP
rs1201706771 2079 dbSNP
rs1021336319 2085 dbSNP
rs372363427 2086 dbSNP
rs1217608935 2097 dbSNP
rs1042486993 2099 dbSNP
rs566631168 2100 dbSNP
rs528394958 2107 dbSNP
rs917776251 2109 dbSNP
rs78049369 2110 dbSNP
rs1313319627 2114 dbSNP
rs1298091437 2122 dbSNP
rs1364146994 2124 dbSNP
rs1053407577 2129 dbSNP
rs1285679437 2132 dbSNP
rs529811558 2141 dbSNP
rs1267399043 2147 dbSNP
rs560907724 2150 dbSNP
rs1209318517 2156 dbSNP
rs142330682 2161 dbSNP
rs190001463 2161 dbSNP
rs769640221 2161 dbSNP
rs1209848627 2165 dbSNP
rs1339265206 2168 dbSNP
rs932794876 2169 dbSNP
rs1447968849 2170 dbSNP
rs866714870 2170 dbSNP
rs961079348 2175 dbSNP
rs908174296 2183 dbSNP
rs986531164 2186 dbSNP
rs1369824122 2187 dbSNP
rs1472879250 2188 dbSNP
rs1162094771 2190 dbSNP
rs531264664 2191 dbSNP
rs1458782454 2193 dbSNP
rs940054428 2209 dbSNP
rs1376470649 2214 dbSNP
rs908532040 2218 dbSNP
rs983360699 2221 dbSNP
rs565460827 2222 dbSNP
rs3742444 2223 dbSNP
rs1291536416 2227 dbSNP
rs1229551097 2231 dbSNP
rs1360837676 2234 dbSNP
rs3742443 2237 dbSNP
rs969883791 2238 dbSNP
rs1422983884 2242 dbSNP
rs1194707230 2249 dbSNP
rs1415030529 2251 dbSNP
rs1046651 2257 dbSNP
rs1411144412 2267 dbSNP
rs1254278639 2269 dbSNP
rs542757962 2271 dbSNP
rs996290938 2276 dbSNP
rs964967789 2281 dbSNP
rs1304350400 2284 dbSNP
rs1032600317 2294 dbSNP
rs1402579098 2301 dbSNP
rs35182045 2307 dbSNP
rs1395698200 2314 dbSNP
rs1011325594 2315 dbSNP
rs1001492688 2324 dbSNP
rs763237641 2328 dbSNP
rs373543190 2332 dbSNP
rs557356030 2336 dbSNP
rs1315622992 2343 dbSNP
rs543476197 2349 dbSNP
rs896560335 2356 dbSNP
rs371923808 2369 dbSNP
rs7158458 2381 dbSNP
rs558587537 2382 dbSNP
rs937824807 2389 dbSNP
rs1258181909 2390 dbSNP
rs538880829 2410 dbSNP
rs577229450 2415 dbSNP
rs994622201 2419 dbSNP
rs1182233891 2430 dbSNP
rs1228913643 2441 dbSNP
rs919720651 2442 dbSNP
rs898660742 2454 dbSNP
rs1178089608 2459 dbSNP
rs770163387 2460 dbSNP
rs940105151 2461 dbSNP
rs1172068586 2463 dbSNP
rs1372637687 2467 dbSNP
rs566720130 2468 dbSNP
rs536770025 2469 dbSNP
rs1371223678 2470 dbSNP
rs553195939 2474 dbSNP
rs939908458 2475 dbSNP
rs1302517532 2476 dbSNP
rs1330946602 2485 dbSNP
rs939317142 2488 dbSNP
rs1384710276 2489 dbSNP
rs1277801813 2490 dbSNP
rs908224226 2509 dbSNP
rs772059045 2510 dbSNP
rs1250296679 2511 dbSNP
rs980035344 2517 dbSNP
rs955156617 2527 dbSNP
rs921008150 2528 dbSNP
rs1432448349 2540 dbSNP
rs1191481092 2550 dbSNP
rs1392309632 2552 dbSNP
rs1430669268 2554 dbSNP
rs1168124734 2555 dbSNP
rs975095675 2566 dbSNP
rs1021442774 2567 dbSNP
rs745723003 2568 dbSNP
rs990337124 2568 dbSNP
rs1164334927 2573 dbSNP
rs1439228588 2575 dbSNP
rs1424814889 2577 dbSNP
rs1032896887 2581 dbSNP
rs1228682924 2583 dbSNP
rs186021689 2584 dbSNP
rs1305312977 2585 dbSNP
rs1001144514 2590 dbSNP
rs967347304 2591 dbSNP
rs1020996868 2594 dbSNP
rs148359834 2599 dbSNP
rs896611222 2602 dbSNP
rs1211688163 2606 dbSNP
rs550621540 2613 dbSNP
rs1186209025 2616 dbSNP
rs1029029354 2618 dbSNP
rs997090147 2619 dbSNP
rs79999101 2621 dbSNP
rs1197043992 2622 dbSNP
rs1038547264 2624 dbSNP
rs762265038 2647 dbSNP
rs563691223 2648 dbSNP
rs1361380642 2653 dbSNP
rs1389854773 2657 dbSNP
rs939981228 2660 dbSNP
rs887015947 2661 dbSNP
rs1050755006 2666 dbSNP
rs887197001 2669 dbSNP
rs1056440739 2671 dbSNP
rs933658620 2684 dbSNP
rs571181403 2687 dbSNP
rs3742441 2692 dbSNP
rs777936477 2693 dbSNP
rs1239097258 2695 dbSNP
rs1484374481 2696 dbSNP
rs935727596 2714 dbSNP
rs925500196 2722 dbSNP
rs1417261616 2726 dbSNP
rs939389190 2728 dbSNP
rs1162066439 2731 dbSNP
rs1413334390 2736 dbSNP
rs1377570075 2739 dbSNP
rs1400529620 2739 dbSNP
rs746558157 2741 dbSNP
rs1361211547 2742 dbSNP
rs1044731034 2743 dbSNP
rs967022275 2763 dbSNP
rs3742440 2764 dbSNP
rs1354337101 2774 dbSNP
rs1293206242 2777 dbSNP
rs992372921 2779 dbSNP
rs960709687 2781 dbSNP
rs914446464 2793 dbSNP
rs1033655493 2800 dbSNP
rs1439403560 2801 dbSNP
rs748212563 2805 dbSNP
rs771566344 2814 dbSNP
rs1211099240 2815 dbSNP
rs1257055107 2818 dbSNP
rs1002314824 2820 dbSNP
rs898560647 2830 dbSNP
rs1253227492 2844 dbSNP
rs1470093183 2854 dbSNP
rs1427702790 2857 dbSNP
rs1173952217 2859 dbSNP
rs1016800598 2860 dbSNP
rs867465495 2862 dbSNP
rs1374445889 2863 dbSNP
rs955821311 2869 dbSNP
rs1184585318 2875 dbSNP
rs1375691929 2876 dbSNP
rs924389003 2887 dbSNP
rs986542176 2890 dbSNP
rs1369531188 2893 dbSNP
rs1266019317 2894 dbSNP
rs572606129 2915 dbSNP
rs1279928185 2916 dbSNP
rs886904390 2924 dbSNP
rs955048500 2926 dbSNP
rs1027975374 2930 dbSNP
rs867156006 2931 dbSNP
rs1209875062 2934 dbSNP
rs1490744317 2937 dbSNP
rs745557826 2938 dbSNP
rs555717005 2939 dbSNP
rs899528780 2944 dbSNP
rs554368386 2950 dbSNP
rs1478583479 2951 dbSNP
rs542794800 2964 dbSNP
rs935795522 2965 dbSNP
rs963010485 2972 dbSNP
rs1354143084 2976 dbSNP
rs1281266779 2984 dbSNP
rs1326853699 2993 dbSNP
rs1230942218 2994 dbSNP
rs1351518821 3002 dbSNP
rs11963 3003 dbSNP
rs1230893093 3007 dbSNP
rs1368468322 3007 dbSNP
rs1300713761 3032 dbSNP
rs563648991 3033 dbSNP
rs887269597 3047 dbSNP
rs757159733 3048 dbSNP
rs1452713500 3068 dbSNP
rs914043426 3087 dbSNP
rs1003567491 3089 dbSNP
rs576531477 3092 dbSNP
rs1190170099 3095 dbSNP
rs960928094 3096 dbSNP
rs1033707962 3097 dbSNP
rs115526522 3106 dbSNP
rs558131163 3109 dbSNP
rs72700638 3112 dbSNP
rs1461924460 3118 dbSNP
rs147734450 3119 dbSNP
rs951233284 3120 dbSNP
rs1319274529 3137 dbSNP
rs1326051409 3140 dbSNP
rs1225453161 3143 dbSNP
rs1286057840 3144 dbSNP
rs1357057120 3152 dbSNP
rs75961329 3154 dbSNP
rs772969312 3186 dbSNP
rs1209721561 3188 dbSNP
rs986576956 3189 dbSNP
rs998083520 3190 dbSNP
rs899748299 3191 dbSNP
rs1475216486 3193 dbSNP
rs1164197254 3200 dbSNP
rs1039405976 3201 dbSNP
rs553232488 3211 dbSNP
rs536472526 3230 dbSNP
rs145783694 3241 dbSNP
rs1158952476 3242 dbSNP
rs1383918057 3243 dbSNP
rs1224280386 3247 dbSNP
rs1336334373 3252 dbSNP
rs1356237284 3258 dbSNP
rs1414237911 3258 dbSNP
rs1347458160 3274 dbSNP
rs1292027167 3280 dbSNP
rs766489852 3283 dbSNP
rs1276597594 3291 dbSNP
rs180714687 3302 dbSNP
rs1331816449 3308 dbSNP
rs537101028 3310 dbSNP
rs191977340 3312 dbSNP
rs551345801 3318 dbSNP
rs1327209823 3319 dbSNP
rs1017221171 3321 dbSNP
rs141931083 3330 dbSNP
rs951575218 3333 dbSNP
rs1413063935 3336 dbSNP
rs1041866297 3338 dbSNP
rs945791369 3345 dbSNP
rs914095798 3353 dbSNP
rs1470701121 3355 dbSNP
rs1035139939 3357 dbSNP
rs796411798 3362 dbSNP
rs939616139 3363 dbSNP
rs763034199 3364 dbSNP
rs780511972 3365 dbSNP
rs963039184 3369 dbSNP
rs1010940141 3372 dbSNP
rs750686662 3379 dbSNP
rs144881409 3385 dbSNP
rs1185151557 3401 dbSNP
rs1392486474 3404 dbSNP
rs1441630041 3417 dbSNP
rs983293150 3418 dbSNP
rs934550502 3420 dbSNP
rs1243737314 3424 dbSNP
rs549234641 3432 dbSNP
rs1348180764 3433 dbSNP
rs1325808874 3445 dbSNP
rs951450897 3460 dbSNP
rs765557277 3463 dbSNP
rs997967471 3468 dbSNP
rs12878599 3478 dbSNP
rs1218042800 3479 dbSNP
rs1340342679 3484 dbSNP
rs1249722366 3485 dbSNP
rs1417120067 3486 dbSNP
rs1272076724 3488 dbSNP
rs963970914 3495 dbSNP
rs142652960 3496 dbSNP
rs1000084441 3503 dbSNP
rs1171939946 3504 dbSNP
rs1455022740 3504 dbSNP
rs1372505780 3505 dbSNP
rs933777891 3506 dbSNP
rs1398686607 3507 dbSNP
rs1298174049 3508 dbSNP
rs1394930163 3515 dbSNP
rs1388980435 3516 dbSNP
rs1304668071 3522 dbSNP
rs1370627121 3526 dbSNP
rs1169366125 3527 dbSNP
rs187675074 3529 dbSNP
rs182074269 3536 dbSNP
rs1204566085 3539 dbSNP
rs1010017356 3542 dbSNP
rs895559611 3548 dbSNP
rs1056684964 3549 dbSNP
rs1253402244 3552 dbSNP
rs1467821951 3553 dbSNP
rs1472372339 3559 dbSNP
rs1385604681 3560 dbSNP
rs1192054169 3565 dbSNP
rs1185162706 3566 dbSNP
rs1429239262 3567 dbSNP
rs867971601 3570 dbSNP
rs1371366578 3579 dbSNP
rs1459900395 3587 dbSNP
rs983025608 3588 dbSNP
rs1456406087 3591 dbSNP
rs1439149467 3592 dbSNP
rs1237434632 3593 dbSNP
rs1203917403 3596 dbSNP
rs1003830129 3602 dbSNP
rs539505236 3603 dbSNP
rs1305192633 3604 dbSNP
rs1275447839 3613 dbSNP
rs1226796197 3614 dbSNP
rs1333981041 3617 dbSNP
rs1356141429 3618 dbSNP
rs1211556154 3619 dbSNP
rs1316207753 3620 dbSNP
rs1037247354 3624 dbSNP
rs1486333572 3629 dbSNP
rs10141666 3630 dbSNP
rs1248560178 3632 dbSNP
rs1375342340 3633 dbSNP
rs888593783 3634 dbSNP
rs1417731733 3635 dbSNP
rs1442379905 3636 dbSNP
rs1355753082 3638 dbSNP
rs1321222643 3648 dbSNP
rs1161857739 3653 dbSNP
rs1431022607 3653 dbSNP
rs1460248790 3653 dbSNP
rs1485431299 3653 dbSNP
rs34651300 3653 dbSNP
rs576069021 3653 dbSNP
rs1404433767 3656 dbSNP
rs201420011 3659 dbSNP
rs939501573 3662 dbSNP
rs1354716754 3663 dbSNP
rs149913053 3672 dbSNP
rs1045737155 3676 dbSNP
rs941599622 3682 dbSNP
rs1286090602 3684 dbSNP
rs1317228722 3689 dbSNP
rs909900280 3691 dbSNP
rs1259178205 3706 dbSNP
rs1486716213 3706 dbSNP
rs982791153 3706 dbSNP
rs1256832000 3709 dbSNP
rs1474532829 3710 dbSNP
rs982250566 3710 dbSNP
rs1409195355 3722 dbSNP
rs1400481545 3724 dbSNP
rs969950290 3724 dbSNP
rs1177695461 3730 dbSNP
rs1023759217 3738 dbSNP
rs1436096919 3754 dbSNP
rs1312983729 3755 dbSNP
rs1470579661 3759 dbSNP
rs951501982 3764 dbSNP
rs541416021 3765 dbSNP
rs893834228 3768 dbSNP
rs922686939 3770 dbSNP
rs1222960681 3777 dbSNP
rs1031020790 3781 dbSNP
rs34029173 3785 dbSNP
rs999503153 3790 dbSNP
rs572444167 3791 dbSNP
rs963854271 3792 dbSNP
rs1484700493 3794 dbSNP
rs1207318091 3800 dbSNP
rs1233963826 3804 dbSNP
rs1018078491 3805 dbSNP
rs979110696 3806 dbSNP
rs933874884 3808 dbSNP
rs968651795 3809 dbSNP
rs559699835 3817 dbSNP
rs542902653 3823 dbSNP
rs1020403474 3831 dbSNP
rs1173811149 3840 dbSNP
rs1009901791 3843 dbSNP
rs895443085 3844 dbSNP
rs371402420 3851 dbSNP
rs1412255923 3853 dbSNP
rs1330855768 3854 dbSNP
rs1355012472 3856 dbSNP
rs1035444446 3862 dbSNP
rs376263025 3863 dbSNP
rs905379886 3866 dbSNP
rs373316348 3867 dbSNP
rs1216372998 3871 dbSNP
rs536784083 3880 dbSNP
rs941637503 3883 dbSNP
rs1274383677 3892 dbSNP
rs1437784948 3893 dbSNP
rs888698249 3902 dbSNP
rs1255298869 3925 dbSNP
rs1469176713 3926 dbSNP
rs1049963231 3935 dbSNP
rs1193945982 3937 dbSNP
rs867803860 3946 dbSNP
rs866049944 3950 dbSNP
rs929982291 3951 dbSNP
rs1365816664 3954 dbSNP
rs1169161225 3959 dbSNP
rs909609461 3965 dbSNP
rs1304575183 3975 dbSNP
rs1329157036 3979 dbSNP
rs577649724 3984 dbSNP
rs1441367255 3990 dbSNP
rs922571303 3992 dbSNP
rs976819111 3993 dbSNP
rs1329542156 3996 dbSNP
rs982433464 4011 dbSNP
rs139087043 4018 dbSNP
rs184458021 4021 dbSNP
rs201336332 4024 dbSNP
rs978608990 4024 dbSNP
rs1422915861 4033 dbSNP
rs982767367 4034 dbSNP
rs969079149 4038 dbSNP
rs969605266 4042 dbSNP
rs1251468107 4045 dbSNP
rs201409876 4060 dbSNP
rs746439990 4060 dbSNP
rs1020201200 4063 dbSNP
rs1269944908 4068 dbSNP
rs1474788438 4074 dbSNP
rs1201831037 4076 dbSNP
rs181341103 4077 dbSNP
rs188535480 4083 dbSNP
rs959705326 4092 dbSNP
rs554201598 4094 dbSNP
rs1260536440 4095 dbSNP
rs1001311607 4107 dbSNP
rs1388262723 4108 dbSNP
rs1402670931 4108 dbSNP
rs1031051832 4110 dbSNP
rs762215910 4114 dbSNP
rs151207449 4115 dbSNP
rs905602098 4116 dbSNP
rs1024259073 4118 dbSNP
rs1233162230 4120 dbSNP
rs112572018 4123 dbSNP
rs1353212431 4130 dbSNP
rs888574587 4142 dbSNP
rs1206590778 4146 dbSNP
rs777110878 4146 dbSNP
rs1284518680 4150 dbSNP
rs184374069 4151 dbSNP
rs1190851720 4154 dbSNP
rs901200572 4156 dbSNP
rs1475513494 4157 dbSNP
rs1039958350 4159 dbSNP
rs1041010845 4169 dbSNP
rs1366559545 4169 dbSNP
rs1005363751 4170 dbSNP
rs533295666 4171 dbSNP
rs1046766949 4172 dbSNP
rs1418039269 4180 dbSNP
rs927613408 4183 dbSNP
rs929681373 4183 dbSNP
rs911306897 4184 dbSNP
rs948316376 4187 dbSNP
rs564625994 4194 dbSNP
rs990057723 4195 dbSNP
rs1279825608 4197 dbSNP
rs1178629871 4209 dbSNP
rs372759624 4226 dbSNP
rs958157459 4244 dbSNP
rs924055415 4247 dbSNP
rs947246673 4250 dbSNP
rs761258979 4256 dbSNP
rs988742992 4259 dbSNP
rs959929514 4262 dbSNP
rs1030324540 4264 dbSNP
rs1187478383 4274 dbSNP
rs1362965786 4277 dbSNP
rs1487053647 4282 dbSNP
rs1236290406 4284 dbSNP
rs1203561425 4285 dbSNP
rs1323671341 4286 dbSNP
rs1264488889 4293 dbSNP
rs761278370 4294 dbSNP
rs1175695734 4295 dbSNP
rs928316336 4299 dbSNP
rs1395827818 4300 dbSNP
rs1434182029 4309 dbSNP
rs547878635 4311 dbSNP
rs56398423 4316 dbSNP
rs1392430251 4317 dbSNP
rs1328640278 4320 dbSNP
rs1295760533 4323 dbSNP
rs1375059456 4328 dbSNP
rs139977792 4336 dbSNP
rs1305168175 4337 dbSNP
rs760261343 4339 dbSNP
rs1348024363 4340 dbSNP
rs1006350893 4341 dbSNP
rs1253693671 4352 dbSNP
rs952924450 4352 dbSNP
rs542988743 4355 dbSNP
rs1196233156 4358 dbSNP
rs1237353166 4360 dbSNP
rs573868929 4362 dbSNP
rs1456265633 4366 dbSNP
rs146020701 4370 dbSNP
rs1395891001 4375 dbSNP
rs565960139 4376 dbSNP
rs1338801135 4383 dbSNP
rs1046820645 4384 dbSNP
rs142789833 4391 dbSNP
rs1372792596 4397 dbSNP
rs1167785860 4408 dbSNP
rs1398635340 4410 dbSNP
rs1443523316 4412 dbSNP
rs906261335 4415 dbSNP
rs1371305651 4420 dbSNP
rs1171384580 4423 dbSNP
rs1385836460 4424 dbSNP
rs1298558155 4425 dbSNP
rs759536812 4429 dbSNP
rs1006894613 4437 dbSNP
rs1257336795 4448 dbSNP
rs577733050 4458 dbSNP
rs1043157187 4462 dbSNP
rs1253347488 4463 dbSNP
rs947434132 4467 dbSNP
rs557445023 4476 dbSNP
rs1355650857 4497 dbSNP
rs1189626834 4505 dbSNP
rs1263964202 4506 dbSNP
rs1183322966 4507 dbSNP
rs1462169011 4514 dbSNP
rs1422079017 4518 dbSNP
rs1245447514 4519 dbSNP
rs1196212508 4522 dbSNP
rs913091730 4534 dbSNP
rs1394114985 4536 dbSNP
rs1052928457 4541 dbSNP
rs1291414732 4558 dbSNP
rs1363537861 4562 dbSNP
rs774194482 4566 dbSNP
rs1277546627 4574 dbSNP
rs534372366 4576 dbSNP
rs865781013 4580 dbSNP
rs192518133 4603 dbSNP
rs1229119491 4605 dbSNP
rs1273585245 4606 dbSNP
rs1319511665 4607 dbSNP
rs1314137803 4608 dbSNP
rs1246366312 4609 dbSNP
rs1262711057 4612 dbSNP
rs928537098 4614 dbSNP
rs1384917235 4615 dbSNP
rs1193067635 4616 dbSNP
rs1329223460 4616 dbSNP
rs187585079 4619 dbSNP
rs45438105 4620 dbSNP
rs908842192 4623 dbSNP
rs1422426269 4634 dbSNP
rs570309067 4644 dbSNP
rs1346576256 4655 dbSNP
rs1453956713 4657 dbSNP
rs139545958 4665 dbSNP
rs1363887856 4670 dbSNP
rs1357997900 4674 dbSNP
rs1163354297 4677 dbSNP
rs950502192 4678 dbSNP
rs1378258353 4681 dbSNP
rs1226375609 4686 dbSNP
rs11160687 4691 dbSNP
rs1177298838 4697 dbSNP
rs983982593 4700 dbSNP
rs571016344 4701 dbSNP
rs185842878 4702 dbSNP
rs1025443151 4705 dbSNP
rs993936561 4711 dbSNP
rs1482510773 4723 dbSNP
rs1179345570 4730 dbSNP
rs748143353 4731 dbSNP
rs1157615106 4732 dbSNP
rs1024692406 4734 dbSNP
rs1290503936 4737 dbSNP
rs527782136 4740 dbSNP
rs1007523129 4741 dbSNP
rs373785353 4748 dbSNP
rs1445676735 4749 dbSNP
rs1299673252 4750 dbSNP
rs1307059474 4753 dbSNP
rs1373714352 4756 dbSNP
rs547942405 4758 dbSNP
rs1238199564 4760 dbSNP
rs532859247 4765 dbSNP
rs936896177 4767 dbSNP
rs1307821019 4769 dbSNP
rs1277947266 4770 dbSNP
rs548585003 4774 dbSNP
rs1052982306 4775 dbSNP
rs1042597940 4776 dbSNP
rs192427636 4777 dbSNP
rs1235946706 4778 dbSNP
rs933437506 4779 dbSNP
rs1302775530 4785 dbSNP
rs563621044 4787 dbSNP
rs938499805 4788 dbSNP
rs1367824106 4789 dbSNP
rs187454123 4790 dbSNP
rs1412700659 4795 dbSNP
rs943386373 4796 dbSNP
rs1364821397 4797 dbSNP
rs1445730882 4797 dbSNP
rs1044333203 4800 dbSNP
rs148493365 4803 dbSNP
rs948622312 4803 dbSNP
rs908902967 4809 dbSNP
rs1262167605 4810 dbSNP
rs543315256 4811 dbSNP
rs769015825 4812 dbSNP
rs1430949124 4814 dbSNP
rs747163892 4830 dbSNP
rs929096964 4840 dbSNP
rs533157724 4846 dbSNP
rs1216892362 4847 dbSNP
rs1199674873 4852 dbSNP
rs758548709 4855 dbSNP
rs1490790069 4865 dbSNP
rs1317740130 4871 dbSNP
rs975770449 4876 dbSNP
rs909200360 4886 dbSNP
rs563938369 4903 dbSNP
rs965529563 4918 dbSNP
rs867422312 4922 dbSNP
rs1199055461 4948 dbSNP
rs34878683 4950 dbSNP
rs1204272846 4958 dbSNP
rs540770784 4961 dbSNP
rs111812355 4962 dbSNP
rs954426398 4964 dbSNP
rs1464990273 4965 dbSNP
rs1168313298 4968 dbSNP
rs750590129 4971 dbSNP
rs765502168 4972 dbSNP
rs1021663296 4979 dbSNP
rs1025183567 4981 dbSNP
rs1340481446 4987 dbSNP
rs1011981191 4988 dbSNP
rs370968524 4989 dbSNP
rs757614770 4992 dbSNP
rs1011990112 4993 dbSNP
rs1217338437 4995 dbSNP
rs891765089 4997 dbSNP
rs1032021239 4998 dbSNP
rs1486542707 5003 dbSNP
rs1191345690 5009 dbSNP
rs1419835242 5010 dbSNP
rs754134976 5014 dbSNP
rs1160790083 5015 dbSNP
rs1467821606 5018 dbSNP
rs541831286 5019 dbSNP
rs1002929957 5022 dbSNP
rs1298885691 5025 dbSNP
rs907053769 5025 dbSNP
rs45564331 5027 dbSNP
rs1176466000 5030 dbSNP
rs1398754931 5030 dbSNP
rs761046913 5035 dbSNP
rs1042630570 5037 dbSNP
rs1244489011 5050 dbSNP
rs948694074 5063 dbSNP
rs1225047276 5065 dbSNP
rs144670380 5067 dbSNP
rs111972611 5079 dbSNP
rs1214446766 5080 dbSNP
rs1447360330 5085 dbSNP
rs1263839002 5090 dbSNP
rs1259494801 5095 dbSNP
rs1442841913 5103 dbSNP
rs943477480 5106 dbSNP
rs1366429048 5110 dbSNP
rs928982189 5114 dbSNP
rs918893884 5116 dbSNP
rs1379829705 5118 dbSNP
rs975819828 5120 dbSNP
rs944438480 5121 dbSNP
rs1403565584 5123 dbSNP
rs149388316 5126 dbSNP
rs1332616988 5127 dbSNP
rs986026504 5131 dbSNP
rs1337845715 5132 dbSNP
rs918536664 5135 dbSNP
rs776103748 5137 dbSNP
rs554397595 5138 dbSNP
rs538823929 5140 dbSNP
rs1451131248 5150 dbSNP
rs1253883908 5157 dbSNP
rs991032348 5166 dbSNP
rs1179535548 5167 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Lin CJ; Gong HY; Tseng HC; Wang WL; Wu JL
- Biochemical and biophysical research communications, 2008
miR-122, a hepato-specific microRNA (miRNA), is frequently down-regulated in human hepatocellular carcinoma (HCC). In an effort to identify novel miR-122 targets, we performed an in silico analysis and detected a putative binding site in the 3'-untranslated region (3'-UTR) of Bcl-w, an anti-apoptotic Bcl-2 family member. In the HCC-derived cell lines, Hep3B and HepG2, we confirmed that miR-122 modulates Bcl-w expression by directly targeting binding site within the 3'-UTR. The cellular mRNA and protein levels of Bcl-w were repressed by elevated levels of miR-122, which subsequently led to reduction of cell viability and activation of caspase-3. Thus, Bcl-w is a direct target of miR-122 that functions as an endogenous apoptosis regulator in these HCC-derived cell lines.
LinkOut: [PMID: 18692484]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|:|||||   :|||||| 
Target 5' auuGCGCCAUU---GCACUCCa 3'
10 - 28
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000559651.1 | 3UTR | UGAGCCAAGAUUGCGCCAUUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16