miRTarBase - #MIRT023288 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CLDN18   
Synonyms SFTA5, SFTPJ
Description claudin 18
Transcript NM_001002026   
Other Transcripts NM_016369   
Expression
Putative miRNA Targets on CLDN18
3'UTR of CLDN18
(miRNA target sites are highlighted)
>CLDN18|NM_001002026|3'UTR
   1 TGCTCTAAGACCTCTCAGCACGGGCGGAAGAAACTCCCGGAGAGCTCACCCAAAAAACAAGGAGATCCCATCTAGATTTC
  81 TTCTTGCTTTTGACTCACAGCTGGAAGTTAGAAAAGCCTCGATTTCATCTTTGGAGAGGCCAAATGGTCTTAGCCTCAGT
 161 CTCTGTCTCTAAATATTCCACCATAAAACAGCTGAGTTATTTATGAATTAGAGGCTATAGCTCACATTTTCAATCCTCTA
 241 TTTCTTTTTTTAAATATAACTTTCTACTCTGATGAGAGAATGTGGTTTTAATCTCTCTCTCACATTTTGATGATTTAGAC
 321 AGACTCCCCCTCTTCCTCCTAGTCAATAAACCCATTGATGATCTATTTCCCAGCTTATCCCCAAGAAAACTTTTGAAAGG
 401 AAAGAGTAGACCCAAAGATGTTATTTTCTGCTGTTTGAATTTTGTCTCCCCACCCCCAACTTGGCTAGTAATAAACACTT
 481 ACTGAAGAAGAAGCAATAAGAGAAAGATATTTGTAATCTCTCCAGCCCATGATCTCGGTTTTCTTACACTGTGATCTTAA
 561 AAGTTACCAAACCAAAGTCATTTTCAGTTTGAGGCAACCAAACCTTTCTACTGCTGTTGACATCTTCTTATTACAGCAAC
 641 ACCATTCTAGGAGTTTCCTGAGCTCTCCACTGGAGTCCTCTTTCTGTCGCGGGTCAGAAATTGTCCCTAGATGAATGAGA
 721 AAATTATTTTTTTTAATTTAAGTCCTAAATATAGTTAAAATAAATAATGTTTTAGTAAAATGATACACTATCTCTGTGAA
 801 ATAGCCTCACCCCTACATGTGGATAGAAGGAAATGAAAAAATAATTGCTTTGACATTGTCTATATGGTACTTTGTAAAGT
 881 CATGCTTAAGTACAAATTCCATGAAAAGCTCACTGATCCTAATTCTTTCCCTTTGAGGTCTCTATGGCTCTGATTGTACA
 961 TGATAGTAAGTGTAAGCCATGTAAAAAGTAAATAATGTCTGGGCACAGTGGCTCACGCCTGTAATCCTAGCACTTTGGGA
1041 GGCTGAGGAGGAAGGATCACTTGAGCCCAGAAGTTCGAGACTAGCCTGGGCAACATGGAGAAGCCCTGTCTCTACAAAAT
1121 ACAGAGAGAAAAAATCAGCCAGTCATGGTGGCCTACACCTGTAGTCCCAGCATTCCGGGAGGCTGAGGTGGGAGGATCAC
1201 TTGAGCCCAGGGAGGTTGGGGCTGCAGTGAGCCATGATCACACCACTGCACTCCAGCCAGGTGACATAGCGAGATCCTGT
1281 CTAAAAAAATAAAAAATAAATAATGGAACACAGCAAGTCCTAGGAAGTAGGTTAAAACTAATTCTTTAAAAAAAAAAAAA
1361 AGTTGAGCCTGAATTAAATGTAATGTTTCCAAGTGACAGGTATCCACATTTGCATGGTTACAAGCCACTGCCAGTTAGCA
1441 GTAGCACTTTCCTGGCACTGTGGTCGGTTTTGTTTTGTTTTGCTTTGTTTAGAGACGGGGTCTCACTTTCCAGGCTGGCC
1521 TCAAACTCCTGCACTCAAGCAATTCTTCTACCCTGGCCTCCCAAGTAGCTGGAATTACAGGTGTGCGCCATCACAACTAG
1601 CTGGTGGTCAGTTTTGTTACTCTGAGAGCTGTTCACTTCTCTGAATTCACCTAGAGTGGTTGGACCATCAGATGTTTGGG
1681 CAAAACTGAAAGCTCTTTGCAACCACACACCTTCCCTGAGCTTACATCACTGCCCTTTTGAGCAGAAAGTCTAAATTCCT
1761 TCCAAGACAGTAGAATTCCATCCCAGTACCAAAGCCAGATAGGCCCCCTAGGAAACTGAGGTAAGAGCAGTCTCTAAAAA
1841 CTACCCACAGCAGCATTGGTGCAGGGGAACTTGGCCATTAGGTTATTATTTGAGAGGAAAGTCCTCACATCAATAGTACA
1921 TATGAAAGTGACCTCCAAGGGGATTGGTGAATACTCATAAGGATCTTCAGGCTGAACAGACTATGTCTGGGGAAAGAACG
2001 GATTATGCCCCATTAAATAACAAGTTGTGTTCAAGAGTCAGAGCAGTGAGCTCAGAGGCCCTTCTCACTGAGACAGCAAC
2081 ATTTAAACCAAACCAGAGGAAGTATTTGTGGAACTCACTGCCTCAGTTTGGGTAAAGGATGAGCAGACAAGTCAACTAAA
2161 GAAAAAAGAAAAGCAAGGAGGAGGGTTGAGCAATCTAGAGCATGGAGTTTGTTAAGTGCTCTCTGGATTTGAGTTGAAGA
2241 GCATCCATTTGAGTTGAAGGCCACAGGGCACAATGAGCTCTCCCTTCTACCACCAGAAAGTCCCTGGTCAGGTCTCAGGT
2321 AGTGCGGTGTGGCTCAGCTGGGTTTTTAATTAGCGCATTCTCTATCCAACATTTAATTGTTTGAAAGCCTCCATATAGTT
2401 AGATTGTGCTTTGTAATTTTGTTGTTGTTGCTCTATCTTATTGTATATGCATTGAGTATTAACCTGAATGTTTTGTTACT
2481 TAAATATTAAAAACACTGTTATCCTACAGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' atcACACCACT---GCACTCCa 3'
1237 - 1255 144.00 -18.50
2
miRNA  3' guuUGUGG-UAACAG---UGUGAGGu 5'
             ||||| :| |||   :||:||| 
Target 5' cctACACCTGTAGTCCCAGCATTCCg 3'
1152 - 1177 131.00 -17.30
3
miRNA  3' guuugUGGUAA--CAGUGUGAGGu 5'
               |: |||  | || ||||| 
Target 5' ttttgATGATTTAGACAGACTCCc 3'
305 - 328 123.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31554707 4 COSMIC
COSN31479676 17 COSMIC
COSN30147108 31 COSMIC
COSN30499613 58 COSMIC
COSN31514945 59 COSMIC
COSN30146229 63 COSMIC
COSN31569264 102 COSMIC
COSN30465982 104 COSMIC
COSN30466278 105 COSMIC
COSN14035364 122 COSMIC
COSN30153783 127 COSMIC
COSN30161205 147 COSMIC
COSN9239638 460 COSMIC
COSN21221900 495 COSMIC
COSN5521418 566 COSMIC
COSN16741454 604 COSMIC
COSN7820289 1078 COSMIC
COSN32055534 1291 COSMIC
COSN20099143 1362 COSMIC
COSN27255802 1362 COSMIC
COSN27521065 1362 COSMIC
COSN21266259 1464 COSMIC
COSN16204243 1588 COSMIC
COSN5521419 1659 COSMIC
COSN8362499 1684 COSMIC
COSN30385293 1735 COSMIC
COSN23363280 2024 COSMIC
COSN16776728 2091 COSMIC
COSN26095218 2189 COSMIC
COSN29716890 2225 COSMIC
COSN21979140 2428 COSMIC
COSN20202839 2487 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs964701497 3 dbSNP
rs1337451190 4 dbSNP
rs200380058 5 dbSNP
rs770153777 8 dbSNP
rs1475356237 11 dbSNP
rs777364119 14 dbSNP
rs576521499 22 dbSNP
rs756927400 23 dbSNP
rs199985015 26 dbSNP
rs372664208 27 dbSNP
rs1329489739 31 dbSNP
rs751399907 34 dbSNP
rs771871196 35 dbSNP
rs779996032 36 dbSNP
rs201892247 37 dbSNP
rs768735958 39 dbSNP
rs374979503 40 dbSNP
rs922555406 43 dbSNP
rs1216653364 44 dbSNP
rs754748790 45 dbSNP
rs1359703405 48 dbSNP
rs769964897 50 dbSNP
rs778117984 52 dbSNP
rs571741712 58 dbSNP
rs1352622146 59 dbSNP
rs1041591608 63 dbSNP
rs1441329419 68 dbSNP
rs55923693 74 dbSNP
rs560519244 86 dbSNP
rs966031562 99 dbSNP
rs1366409571 103 dbSNP
rs1163228396 107 dbSNP
rs1403847156 110 dbSNP
rs994223037 118 dbSNP
rs574690650 119 dbSNP
rs543309126 121 dbSNP
rs894121980 122 dbSNP
rs1012599961 123 dbSNP
rs1200943929 131 dbSNP
rs1490385244 139 dbSNP
rs1267697181 141 dbSNP
rs1046370929 144 dbSNP
rs1432694523 146 dbSNP
rs1270519719 153 dbSNP
rs1364762605 155 dbSNP
rs952684191 183 dbSNP
rs990807248 190 dbSNP
rs1223002376 193 dbSNP
rs1326984211 205 dbSNP
rs75363623 214 dbSNP
rs1305725525 215 dbSNP
rs1346272577 219 dbSNP
rs1293042881 221 dbSNP
rs1434512203 222 dbSNP
rs369925737 238 dbSNP
rs994067379 241 dbSNP
rs1347189353 245 dbSNP
rs1319389753 251 dbSNP
rs532202145 256 dbSNP
rs1400551998 261 dbSNP
rs1410372667 266 dbSNP
rs1179260362 272 dbSNP
rs1481067282 281 dbSNP
rs1427927379 285 dbSNP
rs1348776959 286 dbSNP
rs748013571 292 dbSNP
rs1188965566 296 dbSNP
rs1476151587 299 dbSNP
rs970992103 301 dbSNP
rs982680839 304 dbSNP
rs1026515450 316 dbSNP
rs1449208512 331 dbSNP
rs952115394 332 dbSNP
rs1204170650 334 dbSNP
rs186179451 340 dbSNP
rs1247739403 347 dbSNP
rs1280125437 356 dbSNP
rs1300600726 369 dbSNP
rs935517849 386 dbSNP
rs1017657895 390 dbSNP
rs565365289 391 dbSNP
rs779994164 395 dbSNP
rs1186204306 400 dbSNP
rs1434786356 402 dbSNP
rs527717485 407 dbSNP
rs1339127844 410 dbSNP
rs914355012 418 dbSNP
rs150050712 420 dbSNP
rs1400030666 424 dbSNP
rs1402334046 426 dbSNP
rs1049464012 436 dbSNP
rs1318742011 440 dbSNP
rs191425190 449 dbSNP
rs924463947 451 dbSNP
rs943937865 454 dbSNP
rs997078753 457 dbSNP
rs567632885 460 dbSNP
rs1183978361 475 dbSNP
rs145407892 477 dbSNP
rs1254242636 479 dbSNP
rs948349088 481 dbSNP
rs1045437970 484 dbSNP
rs994417961 491 dbSNP
rs1227882687 497 dbSNP
rs373078185 508 dbSNP
rs867643991 510 dbSNP
rs1317527388 512 dbSNP
rs1453919042 521 dbSNP
rs1379059037 527 dbSNP
rs1273115726 532 dbSNP
rs888552509 537 dbSNP
rs1047865102 538 dbSNP
rs768311881 541 dbSNP
rs1427351152 558 dbSNP
rs181450586 568 dbSNP
rs1163972781 574 dbSNP
rs887919431 575 dbSNP
rs116559189 579 dbSNP
rs1253959850 580 dbSNP
rs76261706 582 dbSNP
rs970710356 590 dbSNP
rs1215930010 600 dbSNP
rs900636507 602 dbSNP
rs11707127 604 dbSNP
rs534379533 605 dbSNP
rs1030361426 614 dbSNP
rs1247141864 616 dbSNP
rs1321534356 617 dbSNP
rs1031683799 621 dbSNP
rs1374702172 623 dbSNP
rs977343487 623 dbSNP
rs1197586274 631 dbSNP
rs554151208 641 dbSNP
rs1031605560 650 dbSNP
rs957157674 667 dbSNP
rs1367032057 669 dbSNP
rs1163873138 672 dbSNP
rs1159141642 673 dbSNP
rs956881486 678 dbSNP
rs1366451740 679 dbSNP
rs1161036160 684 dbSNP
rs11707222 690 dbSNP
rs1411237599 691 dbSNP
rs914322498 692 dbSNP
rs968491287 694 dbSNP
rs981498653 696 dbSNP
rs1395528400 703 dbSNP
rs1271274981 704 dbSNP
rs928343259 707 dbSNP
rs1263979409 711 dbSNP
rs543743825 727 dbSNP
rs888034093 727 dbSNP
rs910853736 732 dbSNP
rs943718576 735 dbSNP
rs1303256204 742 dbSNP
rs1040936782 743 dbSNP
rs1443019479 747 dbSNP
rs767462277 750 dbSNP
rs186923182 758 dbSNP
rs1290407081 762 dbSNP
rs1454170806 774 dbSNP
rs866461435 783 dbSNP
rs1387790206 787 dbSNP
rs1156902087 789 dbSNP
rs1481393266 791 dbSNP
rs1048255097 793 dbSNP
rs888521542 794 dbSNP
rs1199687751 797 dbSNP
rs1012252571 799 dbSNP
rs372249046 801 dbSNP
rs1265610138 822 dbSNP
rs535122438 825 dbSNP
rs997636071 827 dbSNP
rs1030851747 855 dbSNP
rs374546679 856 dbSNP
rs902482254 859 dbSNP
rs866760735 860 dbSNP
rs1235577188 865 dbSNP
rs1274156368 875 dbSNP
rs554755411 878 dbSNP
rs906506123 884 dbSNP
rs574608178 890 dbSNP
rs11707988 900 dbSNP
rs1382543761 906 dbSNP
rs1031236149 915 dbSNP
rs760162345 921 dbSNP
rs191710814 925 dbSNP
rs957218213 934 dbSNP
rs1439103391 940 dbSNP
rs1182239578 945 dbSNP
rs148762227 955 dbSNP
rs552067990 961 dbSNP
rs1406825807 971 dbSNP
rs953531235 971 dbSNP
rs1173222978 981 dbSNP
rs1471544211 984 dbSNP
rs1434895359 1000 dbSNP
rs1011405359 1004 dbSNP
rs1166852541 1008 dbSNP
rs1368763976 1014 dbSNP
rs1450353943 1017 dbSNP
rs6804932 1018 dbSNP
rs1187076844 1035 dbSNP
rs143810887 1038 dbSNP
rs981189757 1042 dbSNP
rs530039073 1051 dbSNP
rs778469462 1052 dbSNP
rs1342306865 1058 dbSNP
rs976846709 1059 dbSNP
rs1227637356 1063 dbSNP
rs750139600 1078 dbSNP
rs757348048 1091 dbSNP
rs1307467090 1095 dbSNP
rs550491227 1096 dbSNP
rs1333474606 1099 dbSNP
rs1048306539 1110 dbSNP
rs909679856 1112 dbSNP
rs1400101819 1123 dbSNP
rs1294294888 1124 dbSNP
rs909462427 1126 dbSNP
rs947907981 1127 dbSNP
rs1039160384 1131 dbSNP
rs1243051691 1138 dbSNP
rs1141890 1142 dbSNP
rs922100733 1144 dbSNP
rs1045116387 1147 dbSNP
rs906634091 1150 dbSNP
rs1003544255 1152 dbSNP
rs1251974811 1153 dbSNP
rs6804883 1154 dbSNP
rs892477252 1163 dbSNP
rs999522982 1168 dbSNP
rs1273217256 1176 dbSNP
rs1242450099 1177 dbSNP
rs532811567 1178 dbSNP
rs1330975820 1184 dbSNP
rs1410575343 1206 dbSNP
rs1370158670 1208 dbSNP
rs1306443815 1217 dbSNP
rs893042688 1225 dbSNP
rs1022574601 1230 dbSNP
rs528068910 1238 dbSNP
rs1414915563 1242 dbSNP
rs1163056029 1243 dbSNP
rs1256777576 1249 dbSNP
rs1366123843 1268 dbSNP
rs1011521880 1271 dbSNP
rs1423090993 1272 dbSNP
rs1224193197 1276 dbSNP
rs372621582 1278 dbSNP
rs552367959 1295 dbSNP
rs1226466022 1298 dbSNP
rs1007757750 1302 dbSNP
rs1375044789 1307 dbSNP
rs1430601597 1312 dbSNP
rs1168063031 1315 dbSNP
rs541951552 1323 dbSNP
rs969887081 1323 dbSNP
rs1018004560 1324 dbSNP
rs965540571 1333 dbSNP
rs1349900048 1344 dbSNP
rs1368723591 1345 dbSNP
rs976436687 1345 dbSNP
rs1160505341 1348 dbSNP
rs1438804204 1348 dbSNP
rs764505280 1348 dbSNP
rs1472564436 1349 dbSNP
rs1003123622 1352 dbSNP
rs200226240 1362 dbSNP
rs950558343 1362 dbSNP
rs74535985 1370 dbSNP
rs1025696483 1373 dbSNP
rs781561992 1377 dbSNP
rs1303991719 1381 dbSNP
rs1245830743 1384 dbSNP
rs983066307 1385 dbSNP
rs1402091801 1386 dbSNP
rs376231633 1387 dbSNP
rs1394692696 1398 dbSNP
rs1298129600 1399 dbSNP
rs565892805 1401 dbSNP
rs908907153 1405 dbSNP
rs1268558636 1406 dbSNP
rs951081771 1408 dbSNP
rs1327012711 1423 dbSNP
rs1266244509 1426 dbSNP
rs1221079619 1431 dbSNP
rs1368556648 1434 dbSNP
rs983979151 1435 dbSNP
rs909832031 1436 dbSNP
rs9858250 1438 dbSNP
rs1222718533 1442 dbSNP
rs183153196 1466 dbSNP
rs554239237 1467 dbSNP
rs939399509 1468 dbSNP
rs1177953817 1470 dbSNP
rs1414595733 1474 dbSNP
rs568086150 1476 dbSNP
rs1482869447 1477 dbSNP
rs1198550851 1493 dbSNP
rs536624616 1497 dbSNP
rs747989913 1498 dbSNP
rs1463484870 1501 dbSNP
rs1264991577 1509 dbSNP
rs868038548 1535 dbSNP
rs1212297013 1541 dbSNP
rs1053767226 1543 dbSNP
rs578252358 1544 dbSNP
rs557252302 1546 dbSNP
rs1344592785 1552 dbSNP
rs1298797714 1562 dbSNP
rs577086571 1575 dbSNP
rs546088688 1580 dbSNP
rs893785880 1581 dbSNP
rs1188241648 1582 dbSNP
rs146812070 1587 dbSNP
rs889392595 1588 dbSNP
rs1007728224 1589 dbSNP
rs1019563412 1598 dbSNP
rs1431181833 1600 dbSNP
rs1002704017 1602 dbSNP
rs1167712379 1612 dbSNP
rs1447483816 1617 dbSNP
rs1244779995 1619 dbSNP
rs757947141 1622 dbSNP
rs1377586092 1637 dbSNP
rs140627353 1649 dbSNP
rs1025411137 1654 dbSNP
rs1208195033 1655 dbSNP
rs1484154227 1657 dbSNP
rs1275684108 1661 dbSNP
rs886172006 1663 dbSNP
rs1340426756 1665 dbSNP
rs951022363 1668 dbSNP
rs1004566199 1698 dbSNP
rs1229331398 1700 dbSNP
rs1379086019 1705 dbSNP
rs1300563012 1720 dbSNP
rs1015981389 1726 dbSNP
rs983774880 1727 dbSNP
rs541587699 1731 dbSNP
rs1306982848 1735 dbSNP
rs1312925478 1740 dbSNP
rs1427449620 1744 dbSNP
rs777590236 1760 dbSNP
rs1165222653 1804 dbSNP
rs1434827183 1804 dbSNP
rs1423172666 1805 dbSNP
rs1180171203 1814 dbSNP
rs980722968 1829 dbSNP
rs76613552 1835 dbSNP
rs927749446 1842 dbSNP
rs1252664246 1846 dbSNP
rs1204637735 1847 dbSNP
rs1482202268 1852 dbSNP
rs1267532501 1855 dbSNP
rs939218407 1856 dbSNP
rs561218227 1857 dbSNP
rs1321628620 1868 dbSNP
rs955163656 1874 dbSNP
rs1229664250 1879 dbSNP
rs1350517321 1883 dbSNP
rs1287177655 1887 dbSNP
rs574804358 1893 dbSNP
rs1407543629 1898 dbSNP
rs1392521985 1899 dbSNP
rs1319547512 1905 dbSNP
rs1362556411 1908 dbSNP
rs62280604 1914 dbSNP
rs1370349945 1918 dbSNP
rs1161238634 1921 dbSNP
rs1472888820 1924 dbSNP
rs9825593 1929 dbSNP
rs1311556288 1931 dbSNP
rs1417549055 1943 dbSNP
rs1192115393 1945 dbSNP
rs187828330 1956 dbSNP
rs189567724 1957 dbSNP
rs1043785731 1958 dbSNP
rs989534204 1963 dbSNP
rs915334797 1978 dbSNP
rs1266935362 1984 dbSNP
rs1465226255 1985 dbSNP
rs552404735 1991 dbSNP
rs770532682 1993 dbSNP
rs948034595 1998 dbSNP
rs1332445885 2000 dbSNP
rs943566681 2001 dbSNP
rs1385907688 2008 dbSNP
rs905768781 2017 dbSNP
rs1057067160 2019 dbSNP
rs2589258 2022 dbSNP
rs1158502996 2028 dbSNP
rs1451782915 2040 dbSNP
rs901985130 2041 dbSNP
rs1004682256 2045 dbSNP
rs1015926366 2062 dbSNP
rs898958630 2073 dbSNP
rs1191866564 2074 dbSNP
rs528650968 2095 dbSNP
rs993693808 2098 dbSNP
rs746345457 2100 dbSNP
rs770344189 2107 dbSNP
rs995848686 2115 dbSNP
rs1465734868 2118 dbSNP
rs1431946654 2126 dbSNP
rs1248006281 2137 dbSNP
rs1161993667 2144 dbSNP
rs1029104585 2158 dbSNP
rs1346461240 2162 dbSNP
rs1256102979 2167 dbSNP
rs182214462 2169 dbSNP
rs1310075408 2173 dbSNP
rs988102527 2174 dbSNP
rs1435612944 2176 dbSNP
rs886898644 2180 dbSNP
rs1364341201 2182 dbSNP
rs1031270058 2183 dbSNP
rs568042559 2185 dbSNP
rs1005168691 2192 dbSNP
rs1173239627 2209 dbSNP
rs1242780444 2219 dbSNP
rs1157358756 2221 dbSNP
rs151047753 2230 dbSNP
rs1393566753 2241 dbSNP
rs1170855129 2242 dbSNP
rs1450528123 2243 dbSNP
rs1389984893 2247 dbSNP
rs969030689 2254 dbSNP
rs1191607444 2259 dbSNP
rs1438108693 2260 dbSNP
rs187774253 2263 dbSNP
rs1199450585 2272 dbSNP
rs140941500 2275 dbSNP
rs915321779 2276 dbSNP
rs1276393281 2277 dbSNP
rs1228825419 2278 dbSNP
rs779860868 2288 dbSNP
rs1295155805 2291 dbSNP
rs376101110 2294 dbSNP
rs1290191392 2299 dbSNP
rs764177409 2302 dbSNP
rs774537108 2303 dbSNP
rs1395575654 2312 dbSNP
rs1373838513 2318 dbSNP
rs980780462 2324 dbSNP
rs762064299 2325 dbSNP
rs767582259 2326 dbSNP
rs913982717 2327 dbSNP
rs1474054608 2338 dbSNP
rs150154800 2343 dbSNP
rs553301872 2355 dbSNP
rs907800275 2356 dbSNP
rs1482527560 2363 dbSNP
rs115125952 2366 dbSNP
rs1211479817 2371 dbSNP
rs1356938672 2395 dbSNP
rs535631435 2397 dbSNP
rs1253222170 2405 dbSNP
rs1472529682 2410 dbSNP
rs1353597054 2426 dbSNP
rs910515069 2433 dbSNP
rs76203754 2436 dbSNP
rs1410592775 2442 dbSNP
rs59733755 2443 dbSNP
rs73867007 2445 dbSNP
rs1407483586 2453 dbSNP
rs563535362 2453 dbSNP
rs774544477 2457 dbSNP
rs1392039222 2467 dbSNP
rs867790447 2468 dbSNP
rs1050199361 2472 dbSNP
rs890087356 2483 dbSNP
rs1182359281 2496 dbSNP
rs1472052918 2500 dbSNP
rs1348916825 2509 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.887 2.6e-5 -0.835 1.9e-4 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.58 1.9e-3 0.661 3.0e-4 23 Click to see details
GSE21687 Ependynoma primary tumors 0.323 4.6e-3 0.313 5.9e-3 64 Click to see details
GSE27834 Pluripotent stem cells 0.602 6.8e-3 0.594 7.6e-3 16 Click to see details
GSE38226 Liver fibrosis 0.376 4.6e-2 0.337 6.8e-2 21 Click to see details
GSE19350 CNS germ cell tumors 0.5 4.9e-2 0.308 1.7e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.302 7.1e-2 -0.343 4.7e-2 25 Click to see details
GSE32688 Pancreatic cancer -0.225 1.1e-1 -0.139 2.2e-1 32 Click to see details
GSE14794 Lymphoblastoid cells 0.131 1.1e-1 0.060 2.9e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.458 1.8e-1 -0.371 2.3e-1 6 Click to see details
GSE17498 Multiple myeloma -0.074 3.2e-1 -0.004 4.9e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.07 3.7e-1 0.268 9.8e-2 25 Click to see details
GSE17306 Multiple myeloma 0.033 4.1e-1 0.174 1.2e-1 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.045 4.3e-1 0.295 1.0e-1 20 Click to see details
GSE28544 Breast cancer -0.034 4.4e-1 -0.017 4.7e-1 24 Click to see details
GSE21849 B cell lymphoma -0.027 4.4e-1 0.120 2.7e-1 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.003 4.9e-1 -0.130 2.7e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP 0.565 0.06 0.567 0.06 9 Click to see details
STAD 0.481 0.11 0.238 0.29 8 Click to see details
LIHC -0.175 0.11 -0.309 0.02 49 Click to see details
ESCA 0.58 0.15 0.300 0.31 5 Click to see details
THCA 0.407 0.25 0.600 0.14 5 Click to see details
KICH 0.261 0.27 0.143 0.37 8 Click to see details
CHOL -0.186 0.32 -0.283 0.23 9 Click to see details
KIRC -0.065 0.37 0.032 0.43 29 Click to see details
HNSC -0.232 0.43 0.500 0.33 3 Click to see details
HNSC -0.232 0.43 0.500 0.33 3 Click to see details
HNSC -0.232 0.43 0.500 0.33 3 Click to see details
HNSC -0.232 0.43 0.500 0.33 3 Click to see details
HNSC -0.232 0.43 0.500 0.33 3 Click to see details
HNSC -0.232 0.43 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*