miRTarBase - #MIRT023297 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol STAU2   
Synonyms 39K2, 39K3
Description staufen double-stranded RNA binding protein 2
Transcript NM_001164384   
Other Transcripts NM_001164381 , NM_001164382 , NM_001164383 , NM_001164380 , NM_001164385 , NM_014393   
Expression
Putative miRNA Targets on STAU2
3'UTR of STAU2
(miRNA target sites are highlighted)
>STAU2|NM_001164384|3'UTR
   1 ATTAAAAGCAAAAACAAAAAACAAAACAATTCATTAGCCTCAGATTCTTCATCTGTATACATCACAAGGCTCATTCTTGC
  81 CTGCTAGTATGGCCTACATGCCACTTACGTTTTAAGTTATTTAGGAACACAAAGGACAGACAAAAAAGCCATATGCACAT
 161 GCCTCATTTTCTCTTATTTTTGATCTATCTAGTAATTCTTTTGCTGCCTGTCTCTTCTCCATTTTCCTTCTTCTTTTTTA
 241 AGCATTTTTCATATTCTTCACTGTCTTCTATTTGGTCTTGATTAGGTGCATCTATCTCTTCGCTCTGTCTTCCACAAACA
 321 AAAATTCTGCCTTCAGACATTTGGTGTTAGTATTTCACACTCAGTTCTCCCTTTTTTTACATAAGGATTGAGTTTCTTTT
 401 TATGATGATTTTACCTTTATAGCAATTTTGAATTTTGCATTCTATTGCTAGTATTGATTCAGGTACACCATTAAGATACA
 481 ACATTCTAGAAGTCTATTACCTTAGGAGTTAATTAAACATGATATTTGAAGAATAATGAAATGCTTTATAGTTGTTTGAG
 561 GCATAACAATGTGTATTTGTTTTACTGGATCATGTTTTGAACTGACTAGGGAGGGTAGCACCTGCCTCAGATAGTACCAA
 641 CAATTCTGTTTCACTGGGTAGTCTAAAACTAGCTTATAGTTTAACTTAACTTGTTGTGTATGTGAATTTAGGGATGGAAA
 721 CTTTTTTTCCCCTATTTATTCTTTGTTTCCTTCTGGGAAAAAACCCCACAAAAATCAGCACTCCTTTATGGATACATTGG
 801 AGCTTTTGAAAGAATTGTAAACTCTAGGAAGGGGAAATATCTGTGTCTTGATTTCTTAGTTGCCTTGAAAATCATGTACT
 881 GAACTGTAACCGCTAACTTGACTGGATGAACTAGTTTGCTTGTGTGTAGAGAGTGTATTGCTTCCTCAGATTTCACTGTT
 961 TTCATCTCCTTTTCCATCTTAGTCTTTATTCCTTAAGACCAAAAACTGTAATATCCTTTAGAAATGCTCTAGAAGATCTG
1041 TATTGTGTAGAATGATCATGTATTTATAAATATTTTACAAGTTTAGATTATAAAATGAAAAAGAAGGTCATGTGTTTTGG
1121 GGGGTATTTTGCATGTTCGGATTTTTTTTTCACTTCACCGAACCCTTCTGATTCTTTCAAACTATTGCCAGGTAGTTGTT
1201 AGTGTTTCTAATTGGACTCTTAATATGAACTTCAAGAAGCTGTTACCAGTTATCGGCTCTGTCATCTGAAATTTTAACCA
1281 CTTAATTTAAAGTTACAATTTTAGAATTTGTTTTTGTTGTTTTACCTTAAGAAACACAATAAATCACTGTTTAAAAAAGA
1361 TCTCAATTTATATAAAGTACTGGAAAAAAGCTAAGTAATTTTTAGTTCTATCTATAATCTCCGTAGGATGAATTAGAAAT
1441 AAATTGTGATGAAAAGAAATTAACTGCTTATTTATGAATCTAATCATTTAGAAATGTCTGAGAGTAACACTGCATTCTTA
1521 TAGAAACAAAGCACAAATTGCATTCAAGCTCTGAATTGATTTTTTGCTTGGAGCTGTTGTTACAGTAGCTGTAATTTTGC
1601 TACCAGAATGTCTTAATTTTTTAAATTTGTTTTTATTTCTAAGCTCTTGGCAATGACAATAATTATAATTTTAACATATC
1681 TTCACTGTAGTCAACATGTAGAGTCTGCTTCCCTCATTATTGCATTGCTAAGGCCTTTTTAAAAAGCTTATGCTTACATA
1761 ATATACTCTTTTTTATGGACACGTTATATGTTTCCAAATCTGTGTATTGTGATTTTTACATACTAATGAATATAAACAGG
1841 TGATTTTAAAATATTACTGTGCTTCTTTGGTTGAATGAGCTGGTATTGATGTAAAATACTCTGTCATTGATGGACCACTA
1921 CCTGCAGCTAAGCAGTGAGCAGAATCTCCGGGAAATGACTTAGTCTGGCCACATGCATAGCCCATCTTCATAATGTCGCA
2001 GCAGAAGGTTCTTTGTGGTTAAAAGTTTTAAAGCCTATTTCTTTATAGGTAACCCTCTCAGGTATATTTACCTGGTAGAA
2081 AAACATGTAGATTGTTTCTATTACTTAAATGTTTTAATTGGACTGTAGTTTAGAAATTACAGGACCAGCTTGTTACAGAT
2161 TATACACTATTCTGTTACTTTTATTTCTGAAACTTAAAAACAATAAATTCTTTTTCTGTGTTTCTAGGTTAGAACTTTTT
2241 TATTTTATTGCACACTGAACAGATACTGTTGCTTATTGAATATTGTGTAAACCCTTCTTTGGCTTTCCTTGCCCATTGCA
2321 ATTTGATTTAAGCCTACTAGAGCCATTGTATGTGACAGCTATATTGTATTACAAAGTAAAAATATATGAGTGTATTGAAA
2401 ACAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAGUGUGAGgu 5'
              :| :||| ||||||||  
Target 5' gtgtTAGTATT-TCACACTCag 3'
344 - 364 141.00 -13.30
2
miRNA  3' guuuGUGGUAACAG-UGUGAGGu 5'
              ||| |   || :|||||| 
Target 5' acccCACAAAAATCAGCACTCCt 3'
763 - 785 134.00 -12.90
3
miRNA  3' guuUGUGGUAA--C-A-G-UGUGAGGu 5'
             ||||||||  | | | |||:||: 
Target 5' ggtACACCATTAAGATACAACATTCTa 3'
462 - 488 129.00 -15.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM7624778 2 COSMIC
COSM7460309 3 COSMIC
COSM7852342 3 COSMIC
COSN30647876 15 COSMIC
COSN31507028 26 COSMIC
COSN30469361 32 COSMIC
COSN31535087 32 COSMIC
COSN31499578 57 COSMIC
COSN30116634 101 COSMIC
COSN30117869 110 COSMIC
COSN30584501 136 COSMIC
COSN30641018 141 COSMIC
COSN28556663 151 COSMIC
COSN26731702 162 COSMIC
COSN30530971 176 COSMIC
COSN30540772 189 COSMIC
COSN21886968 249 COSMIC
COSN28841624 371 COSMIC
COSN30671697 372 COSMIC
COSN18971481 437 COSMIC
COSN28558486 444 COSMIC
COSN20076347 502 COSMIC
COSN20105564 509 COSMIC
COSN30695070 636 COSMIC
COSN30547905 722 COSMIC
COSN30674405 758 COSMIC
COSN28186360 764 COSMIC
COSN9268815 902 COSMIC
COSN30636591 919 COSMIC
COSN30680650 1127 COSMIC
COSN30668475 1141 COSMIC
COSN19731730 1150 COSMIC
COSN30569314 1152 COSMIC
COSN26731602 1212 COSMIC
COSN30626587 1351 COSMIC
COSN30661748 1384 COSMIC
COSN9678712 1457 COSMIC
COSN15661311 1480 COSMIC
COSN6362531 1763 COSMIC
COSN9678711 1828 COSMIC
COSN24596961 1922 COSMIC
COSN30169415 2087 COSMIC
COSN22093222 2098 COSMIC
COSN24302751 2149 COSMIC
COSN9678710 2228 COSMIC
COSN18971440 2274 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766259598 2 dbSNP
rs762896178 3 dbSNP
rs1293965939 8 dbSNP
rs1247031636 9 dbSNP
rs750407075 10 dbSNP
rs367870826 11 dbSNP
rs761455599 15 dbSNP
rs1336127750 16 dbSNP
rs1393669265 20 dbSNP
rs1178034961 21 dbSNP
rs1429372634 22 dbSNP
rs1470611080 22 dbSNP
rs776137246 24 dbSNP
rs1407860829 30 dbSNP
rs1366924951 32 dbSNP
rs1383288078 33 dbSNP
rs764069256 34 dbSNP
rs1402762450 37 dbSNP
rs1423419099 38 dbSNP
rs1050907252 41 dbSNP
rs375320759 44 dbSNP
rs760881263 46 dbSNP
rs775954715 49 dbSNP
rs1364674217 50 dbSNP
rs772659172 51 dbSNP
rs1346199644 55 dbSNP
rs546210172 70 dbSNP
rs1490905760 83 dbSNP
rs933899011 84 dbSNP
rs1205440090 89 dbSNP
rs1290739185 92 dbSNP
rs897113729 93 dbSNP
rs1201093852 96 dbSNP
rs1037035014 108 dbSNP
rs1417951609 108 dbSNP
rs941362740 109 dbSNP
rs909934738 119 dbSNP
rs572248336 124 dbSNP
rs1423020977 136 dbSNP
rs1366301294 148 dbSNP
rs537409425 148 dbSNP
rs569939156 148 dbSNP
rs560438520 151 dbSNP
rs1270750744 153 dbSNP
rs1337524586 155 dbSNP
rs982310388 158 dbSNP
rs966947953 161 dbSNP
rs116944196 162 dbSNP
rs865988746 171 dbSNP
rs1291968293 173 dbSNP
rs1480043685 176 dbSNP
rs116823426 177 dbSNP
rs1252019622 182 dbSNP
rs1032736859 187 dbSNP
rs1179807170 188 dbSNP
rs115210042 192 dbSNP
rs1443098372 201 dbSNP
rs1300886835 206 dbSNP
rs1369226570 213 dbSNP
rs889559571 221 dbSNP
rs1029444859 236 dbSNP
rs1391955080 239 dbSNP
rs1335938768 240 dbSNP
rs766303511 241 dbSNP
rs1315338515 242 dbSNP
rs998015052 242 dbSNP
rs1169965598 251 dbSNP
rs1224748927 269 dbSNP
rs537922961 270 dbSNP
rs1480664631 275 dbSNP
rs1199833548 276 dbSNP
rs1242997558 284 dbSNP
rs1460281518 289 dbSNP
rs1185868504 290 dbSNP
rs139538875 294 dbSNP
rs558263615 301 dbSNP
rs888463523 302 dbSNP
rs1466148728 309 dbSNP
rs1175654798 343 dbSNP
rs1403754300 347 dbSNP
rs147788085 348 dbSNP
rs1303252142 352 dbSNP
rs1361004526 360 dbSNP
rs1380226575 362 dbSNP
rs1481457805 379 dbSNP
rs61195199 379 dbSNP
rs558177850 380 dbSNP
rs555784430 381 dbSNP
rs1490137220 388 dbSNP
rs1322089854 389 dbSNP
rs1273490514 395 dbSNP
rs1238475401 400 dbSNP
rs1485714732 402 dbSNP
rs1185004369 407 dbSNP
rs1264077621 410 dbSNP
rs555564915 410 dbSNP
rs760926782 419 dbSNP
rs1337388586 422 dbSNP
rs928072447 423 dbSNP
rs1198852357 425 dbSNP
rs982236715 432 dbSNP
rs1223654492 437 dbSNP
rs10112019 444 dbSNP
rs914129589 450 dbSNP
rs1290293227 452 dbSNP
rs990155743 453 dbSNP
rs1403923739 456 dbSNP
rs1280890490 462 dbSNP
rs1281019507 466 dbSNP
rs1225903272 481 dbSNP
rs1279876186 482 dbSNP
rs1316731910 491 dbSNP
rs1403984076 493 dbSNP
rs1214031274 496 dbSNP
rs1350673744 505 dbSNP
rs79320778 517 dbSNP
rs144842169 548 dbSNP
rs761868642 571 dbSNP
rs985124143 573 dbSNP
rs1481424972 577 dbSNP
rs1396500022 600 dbSNP
rs953796195 606 dbSNP
rs1407105619 613 dbSNP
rs535623795 618 dbSNP
rs1417102540 619 dbSNP
rs774911635 621 dbSNP
rs997943000 631 dbSNP
rs961516420 632 dbSNP
rs568334466 635 dbSNP
rs1436526896 637 dbSNP
rs1275987541 656 dbSNP
rs769202184 692 dbSNP
rs1373311887 693 dbSNP
rs1222532982 700 dbSNP
rs1015487486 702 dbSNP
rs1354846365 727 dbSNP
rs1005865047 728 dbSNP
rs1234764802 729 dbSNP
rs4333589 731 dbSNP
rs1222331786 734 dbSNP
rs1232347095 736 dbSNP
rs1435849804 753 dbSNP
rs1272261771 758 dbSNP
rs867928318 764 dbSNP
rs1055125749 765 dbSNP
rs531674901 769 dbSNP
rs906581916 780 dbSNP
rs1046531076 797 dbSNP
rs746950264 802 dbSNP
rs775792581 809 dbSNP
rs1327651058 822 dbSNP
rs1352254842 823 dbSNP
rs945539115 826 dbSNP
rs62508211 837 dbSNP
rs1378114312 845 dbSNP
rs1245645111 847 dbSNP
rs1053984671 851 dbSNP
rs1358795582 852 dbSNP
rs4574838 855 dbSNP
rs1222313278 856 dbSNP
rs1436098635 860 dbSNP
rs1238674818 873 dbSNP
rs936910227 873 dbSNP
rs1460723166 876 dbSNP
rs910845910 891 dbSNP
rs183462197 892 dbSNP
rs1166947175 893 dbSNP
rs1416786145 906 dbSNP
rs1411088878 911 dbSNP
rs1440539613 922 dbSNP
rs556266256 926 dbSNP
rs1452515684 929 dbSNP
rs181266863 931 dbSNP
rs976488923 934 dbSNP
rs1449054115 942 dbSNP
rs1269758323 953 dbSNP
rs1336330672 954 dbSNP
rs961177850 959 dbSNP
rs1015831225 962 dbSNP
rs1220495677 964 dbSNP
rs1404483490 974 dbSNP
rs1322786792 978 dbSNP
rs1005419731 982 dbSNP
rs952696481 988 dbSNP
rs1192028306 993 dbSNP
rs1457779986 999 dbSNP
rs542131378 1006 dbSNP
rs1476119501 1014 dbSNP
rs1193811558 1015 dbSNP
rs530049906 1024 dbSNP
rs756884708 1034 dbSNP
rs754176160 1036 dbSNP
rs562650600 1037 dbSNP
rs1468443474 1040 dbSNP
rs1174836345 1041 dbSNP
rs1232119290 1042 dbSNP
rs1183917688 1045 dbSNP
rs544464822 1049 dbSNP
rs577003207 1052 dbSNP
rs1415364841 1057 dbSNP
rs906551006 1058 dbSNP
rs1324956350 1065 dbSNP
rs1462608199 1066 dbSNP
rs1344952135 1068 dbSNP
rs1046454868 1073 dbSNP
rs764560587 1077 dbSNP
rs1345489648 1080 dbSNP
rs1204274019 1090 dbSNP
rs1202560490 1094 dbSNP
rs1316973690 1098 dbSNP
rs201455395 1101 dbSNP
rs188409875 1106 dbSNP
rs539794474 1121 dbSNP
rs936858820 1122 dbSNP
rs369130672 1124 dbSNP
rs1197413733 1132 dbSNP
rs1316201238 1133 dbSNP
rs1478630993 1138 dbSNP
rs776197458 1138 dbSNP
rs78692741 1139 dbSNP
rs1421815777 1141 dbSNP
rs1050651898 1150 dbSNP
rs1336651548 1151 dbSNP
rs3088139 1152 dbSNP
rs1347020557 1153 dbSNP
rs922253771 1155 dbSNP
rs549592976 1156 dbSNP
rs939759629 1157 dbSNP
rs568446337 1159 dbSNP
rs984326366 1160 dbSNP
rs774324595 1164 dbSNP
rs185296507 1187 dbSNP
rs1267402801 1192 dbSNP
rs1033572160 1195 dbSNP
rs1181704500 1197 dbSNP
rs1378867423 1211 dbSNP
rs116896707 1212 dbSNP
rs570817169 1226 dbSNP
rs552644495 1230 dbSNP
rs376123947 1240 dbSNP
rs1243366290 1249 dbSNP
rs566841090 1254 dbSNP
rs1295399849 1255 dbSNP
rs1391534433 1257 dbSNP
rs36047758 1257 dbSNP
rs954069263 1263 dbSNP
rs368447333 1266 dbSNP
rs548629966 1269 dbSNP
rs1390803206 1276 dbSNP
rs1326698477 1285 dbSNP
rs776339239 1289 dbSNP
rs1291973638 1291 dbSNP
rs56149319 1294 dbSNP
rs1225254608 1298 dbSNP
rs1447191122 1306 dbSNP
rs1009608657 1330 dbSNP
rs1315030763 1332 dbSNP
rs111746539 1347 dbSNP
rs1265579393 1349 dbSNP
rs117520406 1353 dbSNP
rs1195737267 1361 dbSNP
rs1001415537 1366 dbSNP
rs1430039642 1371 dbSNP
rs889303818 1372 dbSNP
rs1242882632 1390 dbSNP
rs1012678621 1420 dbSNP
rs1422349674 1422 dbSNP
rs193060066 1423 dbSNP
rs1369137365 1433 dbSNP
rs1027806235 1446 dbSNP
rs902139371 1453 dbSNP
rs994548133 1463 dbSNP
rs373444478 1466 dbSNP
rs1335918633 1485 dbSNP
rs1380290216 1495 dbSNP
rs1397433475 1497 dbSNP
rs1312905960 1504 dbSNP
rs746931945 1521 dbSNP
rs1163746758 1532 dbSNP
rs564798913 1533 dbSNP
rs1259403199 1534 dbSNP
rs1421485046 1537 dbSNP
rs1184267304 1540 dbSNP
rs1262971551 1542 dbSNP
rs1009572252 1545 dbSNP
rs1474784922 1546 dbSNP
rs1434464109 1577 dbSNP
rs1482446600 1581 dbSNP
rs367585067 1582 dbSNP
rs796332525 1582 dbSNP
rs1257066964 1589 dbSNP
rs1224230527 1597 dbSNP
rs1489693852 1608 dbSNP
rs188955032 1618 dbSNP
rs1191653488 1623 dbSNP
rs572888529 1626 dbSNP
rs1050602564 1635 dbSNP
rs1175549645 1636 dbSNP
rs932121515 1639 dbSNP
rs1357220691 1641 dbSNP
rs1467352546 1643 dbSNP
rs915361044 1645 dbSNP
rs931073519 1651 dbSNP
rs926427617 1653 dbSNP
rs1397713876 1654 dbSNP
rs1279612673 1657 dbSNP
rs1340576449 1670 dbSNP
rs1219795996 1676 dbSNP
rs749257223 1679 dbSNP
rs1054276640 1687 dbSNP
rs1214128709 1688 dbSNP
rs532832279 1695 dbSNP
rs1212745366 1696 dbSNP
rs1285484318 1698 dbSNP
rs1485705552 1706 dbSNP
rs185640877 1707 dbSNP
rs923945090 1708 dbSNP
rs542264863 1715 dbSNP
rs117096064 1717 dbSNP
rs192391375 1722 dbSNP
rs745337647 1730 dbSNP
rs991309355 1733 dbSNP
rs1344381693 1736 dbSNP
rs186809743 1744 dbSNP
rs1000938933 1746 dbSNP
rs1403745332 1761 dbSNP
rs1132131 1764 dbSNP
rs973566404 1779 dbSNP
rs961789371 1782 dbSNP
rs1221434542 1783 dbSNP
rs753612751 1788 dbSNP
rs865810119 1797 dbSNP
rs1238255242 1802 dbSNP
rs1288379790 1826 dbSNP
rs1488670443 1829 dbSNP
rs890735896 1839 dbSNP
rs1221904403 1840 dbSNP
rs1245022244 1843 dbSNP
rs1489461283 1844 dbSNP
rs182174772 1856 dbSNP
rs1029239321 1861 dbSNP
rs939657400 1863 dbSNP
rs996384632 1864 dbSNP
rs1380583999 1865 dbSNP
rs1423574415 1870 dbSNP
rs893981477 1871 dbSNP
rs1351107470 1875 dbSNP
rs1048564426 1877 dbSNP
rs750656008 1883 dbSNP
rs1266160184 1885 dbSNP
rs1376670585 1892 dbSNP
rs1178198493 1902 dbSNP
rs1481821560 1903 dbSNP
rs1231713593 1917 dbSNP
rs1354736061 1920 dbSNP
rs1227954669 1923 dbSNP
rs1287888076 1924 dbSNP
rs1323514916 1925 dbSNP
rs935424659 1927 dbSNP
rs1204413867 1934 dbSNP
rs1222221379 1939 dbSNP
rs190315635 1949 dbSNP
rs1046853906 1950 dbSNP
rs1238561500 1959 dbSNP
rs1221690657 1962 dbSNP
rs1443698586 1963 dbSNP
rs542533642 1971 dbSNP
rs529237415 1973 dbSNP
rs1307957748 1981 dbSNP
rs561826120 1989 dbSNP
rs1044879910 1990 dbSNP
rs1400274591 1997 dbSNP
rs372241426 1998 dbSNP
rs73328708 2007 dbSNP
rs374114192 2011 dbSNP
rs1406646489 2013 dbSNP
rs1282573001 2019 dbSNP
rs920434006 2037 dbSNP
rs1381466967 2041 dbSNP
rs1177987604 2044 dbSNP
rs1228911145 2046 dbSNP
rs973232392 2048 dbSNP
rs187106000 2051 dbSNP
rs917799528 2056 dbSNP
rs962121266 2064 dbSNP
rs569123230 2066 dbSNP
rs1159340445 2071 dbSNP
rs1421300362 2080 dbSNP
rs1014658491 2086 dbSNP
rs987165573 2087 dbSNP
rs550913197 2093 dbSNP
rs1028623837 2100 dbSNP
rs1462158261 2104 dbSNP
rs979438743 2109 dbSNP
rs1185469677 2110 dbSNP
rs1420828916 2114 dbSNP
rs996438853 2121 dbSNP
rs894029359 2123 dbSNP
rs953462211 2125 dbSNP
rs1255646220 2140 dbSNP
rs1332462111 2163 dbSNP
rs1029038237 2167 dbSNP
rs1449029049 2169 dbSNP
rs1338453417 2171 dbSNP
rs200482183 2171 dbSNP
rs1220397835 2172 dbSNP
rs966198378 2173 dbSNP
rs1209946874 2174 dbSNP
rs1344064284 2175 dbSNP
rs1198568410 2197 dbSNP
rs1482962479 2199 dbSNP
rs1261568314 2201 dbSNP
rs1241481649 2203 dbSNP
rs1032942522 2207 dbSNP
rs1215425531 2214 dbSNP
rs1315314276 2216 dbSNP
rs183555076 2227 dbSNP
rs1005119846 2228 dbSNP
rs888060803 2247 dbSNP
rs902625225 2254 dbSNP
rs565077057 2268 dbSNP
rs1338621164 2274 dbSNP
rs1046455508 2289 dbSNP
rs1297753643 2294 dbSNP
rs1449884176 2300 dbSNP
rs949428352 2301 dbSNP
rs546507835 2305 dbSNP
rs904908812 2312 dbSNP
rs528188197 2313 dbSNP
rs1330493213 2321 dbSNP
rs1132134 2325 dbSNP
rs1276456539 2336 dbSNP
rs545552305 2339 dbSNP
rs542175626 2342 dbSNP
rs937272958 2344 dbSNP
rs1488995455 2345 dbSNP
rs1158431136 2349 dbSNP
rs1216761545 2364 dbSNP
rs578126317 2366 dbSNP
rs1451599675 2370 dbSNP
rs1197307341 2378 dbSNP
rs373629781 2386 dbSNP
rs1454950823 2390 dbSNP
rs1158297682 2392 dbSNP
rs1315817700 2394 dbSNP
rs1387703409 2398 dbSNP
rs1159397729 2403 dbSNP
rs1390089712 2404 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*