miRTarBase - #MIRT023307 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CALD1   
Synonyms CDM, H-CAD, HCAD, L-CAD, LCAD, NAG22
Description caldesmon 1
Transcript NM_004342   
Other Transcripts NM_033138 , NM_033139 , NM_033140 , NM_033157   
Expression
Putative miRNA Targets on CALD1
3'UTR of CALD1
(miRNA target sites are highlighted)
>CALD1|NM_004342|3'UTR
   1 GACAGTTCCAGAAAGAACCCAAGCTCAAGACGCAGGACGAGCTCAGTTGTAGAGGGCTAATTCGCTCTGTTTTGTATTTA
  81 TGTTGATTTACTAAATTGGGTTCATTATCTTTTATTTTTCAATATCCCAGTAAACCCATGTATATTATCACTATATTTAA
 161 TAATCACAGTCTAGAGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAAAGAAACCCATGCTGTGAA
 241 ATAGAGACTTTTCTACTGATCATCATAACTCTGTATCTGAGCAGTGATACCAACCACATCTGAAGTCAACAGAAGATCCA
 321 AGTTTAAAATTGCCTGCGGAATGTGTGCAGTATCTAGAAAAATGAACCGTAGTTTTTGTTTTTTTAAATACAGAAGTCAT
 401 GTTGTTTCTGCACTTTATAATAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTTTGAAAGTAACCCATT
 481 TCAGATTTGAAATACTGCAATAATGGTTGTCTTTAAAAAAAAAAAAGAAATGTACTGTTAAGGTATTACTTTTTTTCATG
 561 CTGATGATTCATATCTAAATTACATTATTATGTTAGCTGACAGTGGTACTGATTTTTTAGGTTGGTTGTTTTGTGGATTT
 641 CTTTAGTAGTGATAGTAGCCTGAACCACATTTTAGATAACTCAATTATGTATGTATGTGCATACACATATACAAACACAC
 721 TAATGGTAGAATGCTTTTTTATGTGCTAGACTATTATATTTAGTAGTATGTCATTGTAACTAGCCAATATCACAGCTTTT
 801 GAAAAATTAAAAAATCACACTATATTAATATTTTATATTTGCCAACAGAAACATGGCAGATAGGTATCAATATGTTTTCA
 881 ATGCCTGATGACCTATAAGAAGAAAGTATTGAAAAGAAGAGAGATTAGAACTGTTAGAAGGAGTTGAAATTTTCTAAAAG
 961 ACATAGTATTTAGTTTATAATTAAATGCATTCTTGAAGTCCAGTGTGAATTTTATTAATGCTATCATCTCGACCAAGCTC
1041 AAAGCCTACTTATTAGAAACAATGAAGTTCACAATAGGTCATAAGGTCTCTTCCTTTTCTAAAATTGAAAGACAAGAAAT
1121 TTAGTGCCAATATTGTACAGACAGAAATTCCATGTATGAGTCTCAACAAAGACTACCTTTGGCTAAATGTCTAGAAGCAG
1201 AGAAGTAAAGTGAGCAAAATCCAGTGTTGAGGAGTCATGACAGTACTTTGATCTTTATATACTCTGAAGCATTTCTTCAA
1281 ACTTTTCTACTTTTATTTGTCATTGATACCTGTAGTAAGTTGACAATGTGGTGAAATTTCAAAATTATATGTAACTTCTA
1361 CTAGTTTTACTTTCTCCCCCAAGTCTTTTTTAACTCATGATTTTTACACACACAATCCAGAACTTATTATATAGCCTCTA
1441 AGTCTTTATTCTTCACAGTAGATAATGAAAGAGTCCTCCAGTGTCTTGGCAAAATGTTCTAGTATAGCTGGATACATACA
1521 GTGGAGTTCTATAAACTCATACCTCAGTGGACTTAACCAAAATTGTGTTAGTCTCAATTCCTACCACACTGAGGGAGCCT
1601 CCCAAATAACTATTTTCTTATCTGCAGTATTCCTCCAGAAGAGCTAACCAGGGCAGGGCTGGCATGAGAAGTGACATCTG
1681 CGTTACAAAGTCTATCTTCCTCATAAGTCTGTAAAGAGCAATTGAATCTTCTAGCTTTAGCAAACCTAAGCCAAAGGAAG
1761 GAAAGCCATGAAGAATGCAGAAGTCAAACCCTCATGACAAAGTAGGCACAAGTCTACAATAAGCTAAATCAGAATTTACA
1841 AATACAAGTGTCCCAGGTAGCATTGACTCCCGTCATTGGAGTGAAATGGATCAAAGTTTGAATTAAGGCCTATGGTAAGG
1921 TAACATTGCTTTGTTGTACTTTTGAACAAGAGCTCCTCCTGATCACTATTACATATTTTTCTAGAAAATCTAAAGTTCAG
2001 AAGAGAATGTATCACTGCTGACTTTTATTCCAATATTTGGATGGAGTAAGTTTTAGGGTAGAATTTTGTTCAGTTTGGAT
2081 TTAATCTTTTGAAAAGTAAATTCCTTGTTTACTGGTTTGACTATAATTCTCTGTTATCTTTACGAGGTAAAACTGCAAGC
2161 TGACTAGCATGTTCTGTGAATCTGCCATTCCTAAAAATTTTATAAACACTTGATACTTTTCACTGATAATGGATCGCTCC
2241 AATAAACATATATTGTGAAAATGCATCCACAATAAATGGAATTCCTTCCTGCAAAATGTCTTTTTCTCACTTATTTTTAT
2321 GTACAATATTGATAGTGAGAGGTATGTCTATTATAATAAAGATTATGGCACAGTAAAACCTGTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             | :| ||||| |||||:: 
Target 5' agtAGGCAATTGTAACACTTTt 3'
444 - 465 135.00 -12.60
2
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               |:| || | |:||||: 
Target 5' ctttgATCTTTAT-ATACTCTg 3'
1246 - 1266 120.00 -6.60
3
miRNA  3' guuuGUGGUAACA------GUGUGAGGu 5'
              ||: ||| |      |||| ||| 
Target 5' aactCATGATTTTTACACACACAATCCa 3'
1392 - 1419 120.00 -11.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26579411 6 COSMIC
COSN30448175 16 COSMIC
COSN30466051 21 COSMIC
COSN26969040 25 COSMIC
COSN30154368 30 COSMIC
COSN28559814 33 COSMIC
COSN14261708 40 COSMIC
COSN30493748 87 COSMIC
COSN30529571 87 COSMIC
COSN1343043 156 COSMIC
COSN31574080 236 COSMIC
COSN26438001 266 COSMIC
COSN16323511 312 COSMIC
COSN16322522 315 COSMIC
COSN31539116 369 COSMIC
COSN31543676 411 COSMIC
COSN7961503 451 COSMIC
COSN24890787 467 COSMIC
COSN26433824 472 COSMIC
COSN28869135 516 COSMIC
COSN27208859 527 COSMIC
COSN27451723 527 COSMIC
COSN8515488 617 COSMIC
COSN22660126 663 COSMIC
COSN31537497 731 COSMIC
COSN28702098 835 COSMIC
COSN32057799 867 COSMIC
COSN20104835 1296 COSMIC
COSN2202963 1495 COSMIC
COSN2202964 1505 COSMIC
COSN28648924 1544 COSMIC
COSN31539048 1585 COSMIC
COSN25489210 1648 COSMIC
COSN31485848 2118 COSMIC
COSN31540230 2132 COSMIC
COSN9923724 2217 COSMIC
COSN31553406 2264 COSMIC
COSN31517913 2301 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1160051695 1 dbSNP
rs768000641 2 dbSNP
rs1385459184 3 dbSNP
rs372018254 6 dbSNP
rs750957341 9 dbSNP
rs1313382858 13 dbSNP
rs1316217741 16 dbSNP
rs1462263735 20 dbSNP
rs978503279 21 dbSNP
rs771636423 23 dbSNP
rs1215442029 27 dbSNP
rs756203762 28 dbSNP
rs766492670 32 dbSNP
rs747179167 33 dbSNP
rs1237932979 37 dbSNP
rs374505727 39 dbSNP
rs779133323 40 dbSNP
rs751314565 45 dbSNP
rs368697586 46 dbSNP
rs531574300 49 dbSNP
rs974900136 64 dbSNP
rs551282156 65 dbSNP
rs1329351731 66 dbSNP
rs1803233 73 dbSNP
rs556970272 83 dbSNP
rs777011296 97 dbSNP
rs145371049 101 dbSNP
rs6967047 108 dbSNP
rs1259348949 109 dbSNP
rs1397765731 130 dbSNP
rs1170155844 142 dbSNP
rs1456713472 147 dbSNP
rs776643588 154 dbSNP
rs1047750944 155 dbSNP
rs1482065204 158 dbSNP
rs781188054 161 dbSNP
rs1416988950 168 dbSNP
rs1415638173 169 dbSNP
rs1176176358 173 dbSNP
rs1236010790 175 dbSNP
rs886425679 177 dbSNP
rs1407399570 179 dbSNP
rs1177413174 180 dbSNP
rs140065054 184 dbSNP
rs566927223 187 dbSNP
rs769408139 188 dbSNP
rs769604103 189 dbSNP
rs1037756316 190 dbSNP
rs1803232 201 dbSNP
rs1269780244 211 dbSNP
rs1355359604 212 dbSNP
rs765258814 213 dbSNP
rs1247942223 214 dbSNP
rs1361799200 216 dbSNP
rs995796340 218 dbSNP
rs1027666303 219 dbSNP
rs1336503178 220 dbSNP
rs1337718263 225 dbSNP
rs1220959470 230 dbSNP
rs748839723 233 dbSNP
rs1322722776 234 dbSNP
rs753185020 243 dbSNP
rs1385646021 245 dbSNP
rs1240805275 249 dbSNP
rs1269762347 251 dbSNP
rs1447323907 254 dbSNP
rs1280493386 257 dbSNP
rs1192233031 260 dbSNP
rs111228789 266 dbSNP
rs1001947371 267 dbSNP
rs1478809988 269 dbSNP
rs1035650509 270 dbSNP
rs1428064457 272 dbSNP
rs1469721881 276 dbSNP
rs1174962325 277 dbSNP
rs1391504750 280 dbSNP
rs1157637055 281 dbSNP
rs556267812 284 dbSNP
rs1470193215 290 dbSNP
rs1401595856 291 dbSNP
rs960148644 301 dbSNP
rs775600850 308 dbSNP
rs1196636621 319 dbSNP
rs146819597 320 dbSNP
rs1269548719 322 dbSNP
rs1224367354 331 dbSNP
rs1351244022 336 dbSNP
rs895750189 338 dbSNP
rs1010138445 339 dbSNP
rs1019999589 340 dbSNP
rs968367472 343 dbSNP
rs925205461 345 dbSNP
rs1345377495 347 dbSNP
rs11552945 354 dbSNP
rs1304292923 358 dbSNP
rs932552191 369 dbSNP
rs539250778 370 dbSNP
rs1317178290 379 dbSNP
rs1400980668 386 dbSNP
rs1330156290 387 dbSNP
rs1018039874 400 dbSNP
rs1170244895 400 dbSNP
rs963806716 405 dbSNP
rs1429832551 428 dbSNP
rs975332073 429 dbSNP
rs923452860 444 dbSNP
rs955155451 454 dbSNP
rs542200063 456 dbSNP
rs1274298035 457 dbSNP
rs181628968 461 dbSNP
rs1236753148 463 dbSNP
rs1241358375 485 dbSNP
rs1215296090 494 dbSNP
rs1272678900 506 dbSNP
rs1286632878 515 dbSNP
rs199709365 515 dbSNP
rs551557292 515 dbSNP
rs896884825 515 dbSNP
rs1339809697 516 dbSNP
rs1284476174 521 dbSNP
rs1225951042 523 dbSNP
rs1048519434 528 dbSNP
rs1270020287 529 dbSNP
rs1431959726 534 dbSNP
rs908099384 538 dbSNP
rs906108976 539 dbSNP
rs1331794793 543 dbSNP
rs942037426 544 dbSNP
rs1035729732 550 dbSNP
rs766207787 550 dbSNP
rs1037640117 559 dbSNP
rs572640681 561 dbSNP
rs1476821099 568 dbSNP
rs1418744994 569 dbSNP
rs541766099 572 dbSNP
rs937429084 573 dbSNP
rs1057382469 586 dbSNP
rs1020401279 591 dbSNP
rs968804157 597 dbSNP
rs1460919876 605 dbSNP
rs572230420 610 dbSNP
rs555255040 614 dbSNP
rs979683849 619 dbSNP
rs1032137035 628 dbSNP
rs763778955 629 dbSNP
rs751170136 648 dbSNP
rs1215453566 654 dbSNP
rs764280432 656 dbSNP
rs1282049630 669 dbSNP
rs1175147140 674 dbSNP
rs574895793 677 dbSNP
rs1251310236 686 dbSNP
rs75771735 693 dbSNP
rs1463630357 705 dbSNP
rs912253122 706 dbSNP
rs1041665162 709 dbSNP
rs1168826129 711 dbSNP
rs1411431442 718 dbSNP
rs965032510 720 dbSNP
rs1444281833 728 dbSNP
rs1244010503 741 dbSNP
rs904402566 748 dbSNP
rs1479700984 758 dbSNP
rs972342014 766 dbSNP
rs186761352 769 dbSNP
rs536301484 771 dbSNP
rs1049076366 774 dbSNP
rs750084516 775 dbSNP
rs964166629 792 dbSNP
rs143681839 793 dbSNP
rs1443108690 797 dbSNP
rs1443856906 802 dbSNP
rs1372068289 809 dbSNP
rs766262287 809 dbSNP
rs1444355166 817 dbSNP
rs1030958061 819 dbSNP
rs11204 835 dbSNP
rs1057380390 836 dbSNP
rs2732898 847 dbSNP
rs1165778236 849 dbSNP
rs151008164 857 dbSNP
rs374454820 864 dbSNP
rs2732897 867 dbSNP
rs1468546428 871 dbSNP
rs1000283950 874 dbSNP
rs1222145851 876 dbSNP
rs927297264 882 dbSNP
rs1032618988 887 dbSNP
rs1293491653 888 dbSNP
rs866195622 892 dbSNP
rs529742620 894 dbSNP
rs937462213 897 dbSNP
rs1315791781 899 dbSNP
rs1057209025 900 dbSNP
rs1307137743 903 dbSNP
rs1225000562 907 dbSNP
rs1343513233 912 dbSNP
rs1302476233 914 dbSNP
rs140902346 920 dbSNP
rs1006653827 935 dbSNP
rs1305163283 936 dbSNP
rs1451945489 950 dbSNP
rs150135469 957 dbSNP
rs758829742 961 dbSNP
rs1159858439 964 dbSNP
rs1420966392 966 dbSNP
rs189723214 967 dbSNP
rs1199418321 984 dbSNP
rs1480962451 987 dbSNP
rs1271567530 988 dbSNP
rs1194422143 991 dbSNP
rs1041550267 1005 dbSNP
rs904454421 1016 dbSNP
rs1485318758 1021 dbSNP
rs1000103430 1031 dbSNP
rs181323365 1032 dbSNP
rs972373454 1041 dbSNP
rs918254084 1045 dbSNP
rs1224098843 1050 dbSNP
rs1347124615 1055 dbSNP
rs1293122660 1057 dbSNP
rs1381457846 1061 dbSNP
rs1384450567 1069 dbSNP
rs1395805136 1083 dbSNP
rs778114078 1106 dbSNP
rs1318596439 1126 dbSNP
rs747142618 1135 dbSNP
rs1029414684 1140 dbSNP
rs952602405 1156 dbSNP
rs886834643 1163 dbSNP
rs554750310 1167 dbSNP
rs1191423510 1181 dbSNP
rs1015030668 1189 dbSNP
rs185607485 1192 dbSNP
rs927479869 1193 dbSNP
rs973678762 1194 dbSNP
rs771043339 1207 dbSNP
rs1382987696 1214 dbSNP
rs189627584 1218 dbSNP
rs937512411 1221 dbSNP
rs1296102073 1233 dbSNP
rs1262006668 1240 dbSNP
rs958740412 1242 dbSNP
rs1057293721 1247 dbSNP
rs1325531093 1250 dbSNP
rs535186328 1257 dbSNP
rs1249554375 1270 dbSNP
rs917514186 1272 dbSNP
rs946242481 1275 dbSNP
rs555342806 1282 dbSNP
rs35092559 1291 dbSNP
rs148525899 1292 dbSNP
rs3832474 1292 dbSNP
rs772891458 1292 dbSNP
rs34720167 1295 dbSNP
rs77059691 1296 dbSNP
rs1292635352 1297 dbSNP
rs533352467 1314 dbSNP
rs1380639631 1316 dbSNP
rs1215061943 1319 dbSNP
rs917359740 1321 dbSNP
rs1404907654 1328 dbSNP
rs946085338 1350 dbSNP
rs1461784201 1361 dbSNP
rs1374042350 1376 dbSNP
rs550480651 1376 dbSNP
rs1205366672 1377 dbSNP
rs1442350001 1382 dbSNP
rs1263317011 1390 dbSNP
rs1000711057 1408 dbSNP
rs575026942 1410 dbSNP
rs977281891 1412 dbSNP
rs925759858 1433 dbSNP
rs1187621158 1457 dbSNP
rs1339807570 1460 dbSNP
rs1252898794 1464 dbSNP
rs1243542247 1468 dbSNP
rs79482080 1469 dbSNP
rs1314648526 1470 dbSNP
rs557094101 1475 dbSNP
rs1476456003 1488 dbSNP
rs1157122175 1489 dbSNP
rs1039618292 1491 dbSNP
rs777551430 1493 dbSNP
rs1391362569 1498 dbSNP
rs1397873061 1500 dbSNP
rs1310182888 1508 dbSNP
rs577142311 1514 dbSNP
rs1384144889 1517 dbSNP
rs1290863090 1518 dbSNP
rs545984655 1520 dbSNP
rs933688440 1522 dbSNP
rs559382208 1533 dbSNP
rs1006686271 1534 dbSNP
rs745837572 1537 dbSNP
rs2718145 1543 dbSNP
rs75037144 1544 dbSNP
rs994034870 1545 dbSNP
rs1252605810 1551 dbSNP
rs1219906907 1554 dbSNP
rs1292409818 1560 dbSNP
rs746595819 1566 dbSNP
rs775377632 1575 dbSNP
rs899332452 1577 dbSNP
rs995378602 1584 dbSNP
rs771216573 1585 dbSNP
rs1315815407 1586 dbSNP
rs1239086836 1590 dbSNP
rs141346037 1599 dbSNP
rs1238446752 1604 dbSNP
rs796072068 1605 dbSNP
rs958412167 1609 dbSNP
rs1310389466 1611 dbSNP
rs1403483201 1614 dbSNP
rs992999353 1623 dbSNP
rs917420974 1625 dbSNP
rs1406778781 1629 dbSNP
rs992856485 1633 dbSNP
rs1157433861 1634 dbSNP
rs1470212796 1644 dbSNP
rs1024299279 1656 dbSNP
rs1197272755 1657 dbSNP
rs1479975005 1658 dbSNP
rs1269383630 1662 dbSNP
rs774070551 1663 dbSNP
rs560878290 1666 dbSNP
rs1282435474 1671 dbSNP
rs1204561497 1676 dbSNP
rs967482013 1678 dbSNP
rs372535005 1680 dbSNP
rs1258652740 1682 dbSNP
rs1486974853 1683 dbSNP
rs926174423 1688 dbSNP
rs761304937 1695 dbSNP
rs767086657 1696 dbSNP
rs529933410 1703 dbSNP
rs749854194 1704 dbSNP
rs1317204842 1720 dbSNP
rs1400779772 1723 dbSNP
rs746396871 1724 dbSNP
rs374792837 1729 dbSNP
rs1174141936 1733 dbSNP
rs550013191 1736 dbSNP
rs935829361 1740 dbSNP
rs1376170001 1747 dbSNP
rs1474304866 1761 dbSNP
rs182351364 1762 dbSNP
rs2244697 1770 dbSNP
rs921202604 1773 dbSNP
rs371983159 1777 dbSNP
rs549420556 1781 dbSNP
rs1270143499 1794 dbSNP
rs1201889758 1796 dbSNP
rs1323394520 1800 dbSNP
rs1264321410 1804 dbSNP
rs1221230382 1808 dbSNP
rs1360398846 1809 dbSNP
rs1269216210 1811 dbSNP
rs933885680 1813 dbSNP
rs1431061579 1816 dbSNP
rs1366953149 1817 dbSNP
rs1050804714 1819 dbSNP
rs775481120 1823 dbSNP
rs886772385 1853 dbSNP
rs1312110634 1856 dbSNP
rs1334061795 1857 dbSNP
rs1451295214 1858 dbSNP
rs939807545 1864 dbSNP
rs1178223078 1867 dbSNP
rs146945756 1872 dbSNP
rs1418585206 1873 dbSNP
rs898209968 1878 dbSNP
rs566032300 1882 dbSNP
rs1450283711 1892 dbSNP
rs1250163750 1893 dbSNP
rs995035640 1901 dbSNP
rs1181773397 1913 dbSNP
rs900997776 1921 dbSNP
rs186215380 1925 dbSNP
rs1306106014 1926 dbSNP
rs1391512913 1927 dbSNP
rs1229629256 1929 dbSNP
rs191999050 1931 dbSNP
rs1312468614 1935 dbSNP
rs548776396 1940 dbSNP
rs1244592899 1945 dbSNP
rs1382953776 1948 dbSNP
rs1304488860 1958 dbSNP
rs1233094569 1959 dbSNP
rs1353893388 1973 dbSNP
rs1329246956 1975 dbSNP
rs1280530892 1984 dbSNP
rs888333091 1990 dbSNP
rs1161974337 1991 dbSNP
rs1444074541 2001 dbSNP
rs1014903546 2004 dbSNP
rs1203409695 2012 dbSNP
rs1232836756 2013 dbSNP
rs1034392443 2033 dbSNP
rs1232824071 2034 dbSNP
rs958483932 2042 dbSNP
rs183478333 2047 dbSNP
rs1289118301 2059 dbSNP
rs778888592 2073 dbSNP
rs967556980 2087 dbSNP
rs1314202200 2097 dbSNP
rs1221601711 2098 dbSNP
rs977964336 2098 dbSNP
rs998824474 2104 dbSNP
rs1033099934 2112 dbSNP
rs936210498 2115 dbSNP
rs535133404 2120 dbSNP
rs957654759 2123 dbSNP
rs371858834 2124 dbSNP
rs1424309009 2130 dbSNP
rs752477136 2144 dbSNP
rs758186945 2145 dbSNP
rs1417407702 2147 dbSNP
rs1407886369 2159 dbSNP
rs1183604821 2164 dbSNP
rs537367887 2166 dbSNP
rs955355613 2168 dbSNP
rs1137082 2175 dbSNP
rs944819382 2177 dbSNP
rs1222251806 2179 dbSNP
rs758847065 2181 dbSNP
rs1266860914 2185 dbSNP
rs188465982 2187 dbSNP
rs1315883431 2190 dbSNP
rs1268675031 2204 dbSNP
rs1436379287 2205 dbSNP
rs939691459 2209 dbSNP
rs138013249 2217 dbSNP
rs919691122 2221 dbSNP
rs1343379715 2228 dbSNP
rs937745434 2233 dbSNP
rs1137098 2234 dbSNP
rs777933106 2236 dbSNP
rs1442831753 2237 dbSNP
rs1005880023 2238 dbSNP
rs113016343 2241 dbSNP
rs1344732077 2242 dbSNP
rs1055992097 2243 dbSNP
rs1299442573 2245 dbSNP
rs1427846384 2248 dbSNP
rs1034054585 2249 dbSNP
rs1439437871 2250 dbSNP
rs374488573 2252 dbSNP
rs1013904471 2254 dbSNP
rs1024073533 2260 dbSNP
rs1268259473 2264 dbSNP
rs1372665546 2265 dbSNP
rs1321261039 2267 dbSNP
rs1262435824 2268 dbSNP
rs1137104 2270 dbSNP
rs1213232866 2276 dbSNP
rs1233698038 2277 dbSNP
rs1014544557 2280 dbSNP
rs751834379 2283 dbSNP
rs1308656692 2284 dbSNP
rs967084851 2296 dbSNP
rs1207257807 2299 dbSNP
rs1271745030 2321 dbSNP
rs1468114350 2322 dbSNP
rs999035198 2325 dbSNP
rs1033590873 2328 dbSNP
rs957676505 2329 dbSNP
rs986772614 2340 dbSNP
rs1172579378 2343 dbSNP
rs1379781728 2344 dbSNP
rs1167844091 2348 dbSNP
rs910574674 2349 dbSNP
rs1189861749 2351 dbSNP
rs903397766 2358 dbSNP
rs998867304 2367 dbSNP
rs1242439178 2373 dbSNP
rs1032996777 2377 dbSNP
rs531220976 2381 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Yang F; Zhang L; Wang F; Wang Y; Huo XS; et al.
- Neoplasia (New York, N.Y.), 2011
The loss of microRNA-122 (miR-122) expression correlates to many characteristic properties of hepatocellular carcinoma (HCC) cells, including clonogenic survival, anchorage-independent growth, migration, invasion, epithelial-mesenchymal transition, and tumorigenesis. However, all of these findings do not sufficiently explain the oncogenic potential of miR-122. In the current study, we used two-dimensional differential in-gel electrophoresis to measure changes in the expression of thousands of proteins in response to the inhibition of miR-122 in human hepatoma cells. Several proteins that were upregulated on miR-122 inhibition were involved in the unfolded protein response (UPR) pathway. The overexpression of miR-122 resulted in the repression of UPR pathway activation. Therefore, miR-122 may act as an inhibitor of the chaperone gene expression and negatively regulate the UPR pathway in HCC. We further showed that the miR-122 inhibitor enhanced the stability of the 26S proteasome non-ATPase regulatory subunit 10 (PSMD10) through the up-regulation of its target gene cyclin-dependent kinase 4 (CDK4). This process may activate the UPR pathway to prevent chemotherapy-mediated tumor cell apoptosis. The current study suggests that miR-122 negatively regulates the UPR through the CDK4-PSMD10 pathway. The down-regulation of miR-122 activated the CDK4-PSMD10-UPR pathway to decrease tumor cell anticancer drug-mediated apoptosis. We identified a new HCC therapeutic target and proclaimed the potential risk of the therapeutic use of miR-122 silencing.
LinkOut: [PMID: 21750653]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*