miRTarBase - #MIRT023308 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TTYH3   
Synonyms -
Description tweety family member 3
Transcript NM_025250   
Expression
Putative miRNA Targets on TTYH3
3'UTR of TTYH3
(miRNA target sites are highlighted)
>TTYH3|NM_025250|3'UTR
   1 ACCGCGCCCGGCAGCCACCCACCCCACGTGCCAACTTCCCCTCCCCGTGCCAGCACTGCCGCTTCCACCTGGGCCACCCA
  81 CCGGACCCTCGCACGCCGTGCCAGGCCTGCCCCAGACGCGTCTGCAGGCCGCTTGCCCTCCTGTCCCCTCCCCGCAGGGG
 161 CACAGTGGAGACGCAGGGGCTCTGGGCCCGTACCGCCAACTCGGGTCACACCTGAACGCTGCTGCCAGCCGATGCCCCAG
 241 CCCTGCACGCCACCCACTATCCCGGCACGCTCCCTCTGCAGATGGTCGCCGCACCTACAAGCCCTGGCCGCACCCAACCT
 321 GTGTTGTTGCCGCCCGGCCCTTCCCTCCACAGCTCTCCTTCCTCCCGCCCGGCACTTCTGTGGACCCCTTCTTAGTTCAC
 401 AGGCACGGCTGGGGCCGCTCTGTGCTGGCGCCTGCTGGCCACTGAGGGACAGGGACACGTGCCACCTGCTCATCTCTGCC
 481 CTGAGGTCACCCCGTGGTCCCTCCACGTGCCCATCTCTCTGCAGTGCCCTCCTCGCCTGTGCAGCCCGCCCACCCACAGG
 561 CTCACCCCTCCTGCCGGCTGCCAGAGGCCCCCTCCAGCAGGGCCTCTCTCCGTTGCCCCAGCTTCACTCTCTCCCTCAGC
 641 ACCTGCCCTGCTGGAGGCCCCAGCCCTCCGTGGACAGCAGGGGCCACGTGGAGCCCGGGCCGCTCACCCGCCACCCAGTG
 721 CTGGCCGCCTTCTTGGTGCCAAACCCCCTTCCCCCACCCAGAGACTGGGCAGCTGTGTCTGGTTCGTTCTTTGCACTAAC
 801 CACATTTGTCATCTCTAGGGCAGGCTGGGGCTGCGGGCTGAGGGGGACCGCTGGCACCCCCCTTCCCTCCCTTCTTGGTT
 881 CCATTTCCATCCATGACAGGTACAGCATCCCAGGAGCCCGGCCTGAGGGGCTGGACCCGAGCCGGCTGTGAACATCCCTC
 961 AGCCCCTGCTGTCCCCCCTTGGGACTAACCACTAACCTCACCCCCAAACTCCACGGGTGCCCCTAGCTGGCCCAGAGCCG
1041 GCAGTGTGAGCCCAAGTCCGGGCTGGAGCCGAGGCCGGAGCAGCTGTCTGGGAGTCAAGGCTGCAGTAGCGTTTCTTCAT
1121 GGGGTGCTCCAGGGGGTGCCACAGACCGACAGGCAGCCCAAGGGCCTGGACACCCCTCCCCAGGCAGGTGCTGCCCCAGG
1201 AGGACTGTCCTCGGGAATGAACCTCCCGCGGGCTTTGGACTGAGGTCCCTGTGGCCTCGGTCTCCTCCCCATGAAGTGGG
1281 AGCGAGGCTCCCCAATGGTGCTTTTGGCTTTAGTGTACGATGTTTGCTGTGCTTCCCGCCGTGGAGGGCAGAGCCACCCC
1361 ACATCAGGATCGGACGTGCTACCCCTCCCGGTCCCGGCCCTGGCCCAGCCAGCCCAGCCCTCGAGGCTCGATGCCTGTGC
1441 CAAGGCCAGGGGCAGCCAGAGGGCAGCTGGATGGCCACGTGCAGGGGTCAAGGCTGGGCCCTGCAGTGGGGCGGGCCGCC
1521 AGCCCCAGCAGTTTACAGACGCATGGCTCTTCCTCCCAGAGCAGCCGGCAGCTACCTGGACCGGAAATGTCCTCATCCCC
1601 TCCCTGGGGCCAGGCTCTGCCCTGGCCTTCCTCTGTGAACCCCTCCTTTCTTTGTGCTGGTGTCTGGGACCAAAAAGGGG
1681 GAATATGGGAGGGCAGAGTGGGGAGGGGAGTCCATGGGCCTGGGGCCCCAAGCCGGGGCGTCTGAGCTCCCCAGGCATGA
1761 CCAAACCTCAGTGGAGGGGCCTCTGCTTCAGGCCCCGCCTGGCTGACATTCTGAGCCCCCCTCGGAGGCCCCGCCACAGC
1841 CAACCTGCCCAGTCTTTCCTCTGGGCTTGACCCGCCAGGGGAGTTCTCCAGGCCTAGGGCCAGGAGAGAGGCCCTGGCAC
1921 CCTGGCGTGGGTGCCCGCCAAACGCCCTGCGACCGCTCAGAAGCACAAATGCTGTCCATGGCCGTGAGGCTGCCTGCCAG
2001 GTGAATGGACATAGCGTGAGAGGCGGTGAGGCCAGGGCTTCCAGCCTCGTGCTGTCTCGGGACTCCTGACCGTGGTGTGC
2081 GTGTGTGCCCGTCTGTGACTTTCTACTCACCAAGGTTGAAGAAAGGAAACGGGGAAAATCAAAAGGGGTTCAAACCCCAC
2161 CTCAGTAGGTGGAGGGGAGCGCCTGCCATTGGTTGTATTTTTGTTCTGAGTTTTCGGTGCCGTGTTCCTAACTACTCCAT
2241 CCCATGACCTCGCCACACCTACTGGGGCATCTGGCTGGTGCCTGCTGCCATGGCCAGCCCCCACTCTCACCCTGCACAGG
2321 GGGTCTTGCAGCCCCCAGGCCCACAGCCTCGTTGGGAGGACAGGGTGGCCCTGGGGACAAGAGGGAGGAGCCCAGGGGCT
2401 TACCTCACTGAGAGTGCTCCCCAGCAGGCATCCACTACCCCAGGGCCCCCCACATGTCATGGCAAGGTTGGTAGTGAATG
2481 GGCCTGGTTGGGAGCAGCCCCTGGCCCATTGCCCACCCACCCATCTCACTATGCAATTCGAGTTCCAAGCAACATTTGCT
2561 CCTGCCCTGGGGCCAGCTCTGCCCCAGCCCTGAGAGGGGTGGTGAGGCAGCCCCCTGGACCCCAGAACCCCAGACAAGGG
2641 GGCAGGCGGGGGACCAGGGCCTCTCCTGTGGGATCTTTGTTTTGTGTTTAACCATAATGGTTGTGTACTGAACCACTTCA
2721 TATTTGTTATATATAATATATATATATATAATCTCCTTAAGACTCAGCCTCCTGGTTTACCCCCCCGGCCTGGGCATCTG
2801 ACCTCCCCCACCCCAGTGTGATTTAACATCCAGGAACTGAGGCCTGAACCATTTTGCATTTCCCCCTCCTCCAGCCTCTG
2881 TAGGGCCATGGCTGTATGTACTGTCGCTGTGTTTTTTTGTTTTTTTAGAACTGGGTTTGGGGGCTGATTTTTATTTCTTT
2961 GGGGGCTTTTTTTCTTGGCAAATACTAAAAATCTCGTCAATGTAATTTCTGTGGTTTCTATTCAGCTTGGGTTTCATGTT
3041 TTAAAATAAATTTTAAAAAGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUA--ACAGUGUGAGGu 5'
              |||:||   | |||:|||| 
Target 5' caccCACTATCCCGGCACGCTCCc 3'
251 - 274 144.00 -17.00
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||| :||    || ||||| 
Target 5' ctAACCTCACCCCCAAACTCCa 3'
992 - 1013 124.00 -12.50
3
miRNA  3' guUUGUGGUAACAG---UG-UGAGGu 5'
            ::::||:|  ||   || ||||| 
Target 5' tcGGTGCCGTGTTCCTAACTACTCCa 3'
2214 - 2239 120.00 -15.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20091497 5 COSMIC
COSN30502469 29 COSMIC
COSN2529153 44 COSMIC
COSN30498084 48 COSMIC
COSN31590001 131 COSMIC
COSN31539645 155 COSMIC
COSN31538484 173 COSMIC
COSN31538117 230 COSMIC
COSN31559175 232 COSMIC
COSN20091498 310 COSMIC
COSN28196090 324 COSMIC
COSN22036431 549 COSMIC
COSN8516334 588 COSMIC
COSN28791969 692 COSMIC
COSN20985899 710 COSMIC
COSN26676998 855 COSMIC
COSN28737654 910 COSMIC
COSN8516337 944 COSMIC
COSN1347908 958 COSMIC
COSN31577250 979 COSMIC
COSN9984035 989 COSMIC
COSN21174812 1015 COSMIC
COSN8516338 1016 COSMIC
COSN31521774 1042 COSMIC
COSN29325439 1406 COSMIC
COSN28737714 1503 COSMIC
COSN31481686 1505 COSMIC
COSN21722136 1553 COSMIC
COSN8516339 1608 COSMIC
COSN31540007 1692 COSMIC
COSN16725602 1720 COSMIC
COSN2484885 1787 COSMIC
COSN30302984 1865 COSMIC
COSN17892708 1914 COSMIC
COSN26547889 1951 COSMIC
COSN30159552 2016 COSMIC
COSN30169503 2038 COSMIC
COSN30165501 2049 COSMIC
COSN31480308 2060 COSMIC
COSN25871514 2082 COSMIC
COSN28681753 2092 COSMIC
COSN20091499 2229 COSMIC
COSN6877108 2250 COSMIC
COSN31594706 2312 COSMIC
COSN24301976 2482 COSMIC
COSN31481566 2540 COSMIC
COSN31483569 2580 COSMIC
COSN28802208 2607 COSMIC
COSN30543008 2611 COSMIC
COSN31524644 2787 COSMIC
COSN26576060 2912 COSMIC
COSN31565030 2994 COSMIC
COSN31530839 3016 COSMIC
rs7811528 1444 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750033155 3 dbSNP
rs112743770 4 dbSNP
rs754388689 5 dbSNP
rs368271682 6 dbSNP
rs372063657 7 dbSNP
rs997828547 8 dbSNP
rs376731151 10 dbSNP
rs1447635355 11 dbSNP
rs1302905824 12 dbSNP
rs778122172 13 dbSNP
rs747136492 20 dbSNP
rs1275875812 24 dbSNP
rs771057539 28 dbSNP
rs776524436 29 dbSNP
rs1454510580 33 dbSNP
rs763019661 38 dbSNP
rs768758069 42 dbSNP
rs555045602 47 dbSNP
rs761760908 48 dbSNP
rs762105219 53 dbSNP
rs767351864 53 dbSNP
rs751317984 57 dbSNP
rs111233676 61 dbSNP
rs868855821 62 dbSNP
rs945341564 67 dbSNP
rs1385882278 69 dbSNP
rs982112751 83 dbSNP
rs574878171 91 dbSNP
rs1057047315 92 dbSNP
rs1166264777 93 dbSNP
rs937908708 96 dbSNP
rs1387842250 97 dbSNP
rs1055490178 98 dbSNP
rs543982177 99 dbSNP
rs563570672 102 dbSNP
rs113064345 103 dbSNP
rs1223309125 113 dbSNP
rs1206384376 118 dbSNP
rs1036721627 119 dbSNP
rs904639709 120 dbSNP
rs896884766 121 dbSNP
rs1031833924 131 dbSNP
rs532585847 132 dbSNP
rs998844867 135 dbSNP
rs1327250688 142 dbSNP
rs1297984787 149 dbSNP
rs756926103 151 dbSNP
rs1029879182 154 dbSNP
rs780769206 154 dbSNP
rs954537797 155 dbSNP
rs985788293 156 dbSNP
rs1050748319 163 dbSNP
rs1463506676 168 dbSNP
rs546051451 173 dbSNP
rs770524152 174 dbSNP
rs963154675 175 dbSNP
rs559626432 176 dbSNP
rs1194863284 177 dbSNP
rs1007809951 180 dbSNP
rs919133068 189 dbSNP
rs1018310481 190 dbSNP
rs528039811 191 dbSNP
rs1209085372 195 dbSNP
rs1057422744 196 dbSNP
rs1253348168 200 dbSNP
rs547922717 203 dbSNP
rs568136970 204 dbSNP
rs948748074 208 dbSNP
rs1443125748 211 dbSNP
rs1044403787 212 dbSNP
rs904523731 218 dbSNP
rs1021152584 219 dbSNP
rs966756559 220 dbSNP
rs1399057415 223 dbSNP
rs1426361022 228 dbSNP
rs982612424 231 dbSNP
rs1427446170 233 dbSNP
rs1368523208 236 dbSNP
rs1389108534 239 dbSNP
rs927983948 242 dbSNP
rs1193717649 243 dbSNP
rs959671371 248 dbSNP
rs990738771 249 dbSNP
rs1244966676 250 dbSNP
rs1438221773 255 dbSNP
rs909825412 255 dbSNP
rs1459033610 263 dbSNP
rs1053092549 264 dbSNP
rs1165980334 265 dbSNP
rs891965673 267 dbSNP
rs1341744301 268 dbSNP
rs941299577 269 dbSNP
rs1036794673 270 dbSNP
rs530553488 273 dbSNP
rs1342944215 277 dbSNP
rs1030343187 278 dbSNP
rs1364278373 283 dbSNP
rs745391583 284 dbSNP
rs1404660453 288 dbSNP
rs890065715 289 dbSNP
rs1364607915 290 dbSNP
rs141983505 291 dbSNP
rs1369633900 292 dbSNP
rs570626197 293 dbSNP
rs1341098370 295 dbSNP
rs1248288323 303 dbSNP
rs112933284 304 dbSNP
rs1171438611 306 dbSNP
rs539653910 309 dbSNP
rs553258916 310 dbSNP
rs774871859 315 dbSNP
rs566701927 316 dbSNP
rs1258556962 318 dbSNP
rs1358646154 319 dbSNP
rs1440811663 321 dbSNP
rs190444214 323 dbSNP
rs1026035577 328 dbSNP
rs1353474367 332 dbSNP
rs1039270981 333 dbSNP
rs950622307 336 dbSNP
rs894040125 337 dbSNP
rs1449814133 340 dbSNP
rs1011176264 341 dbSNP
rs1332950333 353 dbSNP
rs1400720317 354 dbSNP
rs1021100095 366 dbSNP
rs367987100 367 dbSNP
rs1003622743 368 dbSNP
rs1035542725 369 dbSNP
rs769185037 371 dbSNP
rs925957928 372 dbSNP
rs935968392 373 dbSNP
rs1053142830 377 dbSNP
rs35940346 385 dbSNP
rs891853484 387 dbSNP
rs1266830269 392 dbSNP
rs1181232254 401 dbSNP
rs1336052088 402 dbSNP
rs181630583 407 dbSNP
rs991204074 408 dbSNP
rs1283235511 409 dbSNP
rs115868877 417 dbSNP
rs768166127 418 dbSNP
rs1347288151 421 dbSNP
rs972624707 423 dbSNP
rs543480936 424 dbSNP
rs1166655447 425 dbSNP
rs1452123945 430 dbSNP
rs557053235 431 dbSNP
rs918414155 442 dbSNP
rs1007189839 450 dbSNP
rs1187304899 451 dbSNP
rs55930249 454 dbSNP
rs113513073 459 dbSNP
rs113373873 460 dbSNP
rs1187946248 462 dbSNP
rs1469318149 464 dbSNP
rs1275527458 472 dbSNP
rs1219917247 475 dbSNP
rs1240752114 476 dbSNP
rs942485253 477 dbSNP
rs1054095272 480 dbSNP
rs892814515 481 dbSNP
rs994477383 495 dbSNP
rs559993289 502 dbSNP
rs113185570 507 dbSNP
rs1042694604 508 dbSNP
rs902666428 510 dbSNP
rs541794435 512 dbSNP
rs1295201738 515 dbSNP
rs1456238844 516 dbSNP
rs369656248 517 dbSNP
rs1004142181 520 dbSNP
rs561557489 535 dbSNP
rs530549005 536 dbSNP
rs1431884729 540 dbSNP
rs1201460878 542 dbSNP
rs1012338221 543 dbSNP
rs550654636 548 dbSNP
rs1439825897 549 dbSNP
rs1270171300 552 dbSNP
rs962721089 554 dbSNP
rs1179768757 557 dbSNP
rs1410829670 558 dbSNP
rs1233852258 564 dbSNP
rs1207008461 565 dbSNP
rs1417641771 568 dbSNP
rs1169974677 571 dbSNP
rs972619572 576 dbSNP
rs1025547819 581 dbSNP
rs1347937678 582 dbSNP
rs955218947 584 dbSNP
rs987016182 587 dbSNP
rs1360173076 588 dbSNP
rs1419523090 589 dbSNP
rs911071789 590 dbSNP
rs925842029 599 dbSNP
rs1366759170 603 dbSNP
rs1471069206 612 dbSNP
rs1298544964 616 dbSNP
rs1335023408 621 dbSNP
rs957383742 627 dbSNP
rs1369020121 630 dbSNP
rs988794214 631 dbSNP
rs1379417996 655 dbSNP
rs1405408094 658 dbSNP
rs942411185 670 dbSNP
rs564173043 671 dbSNP
rs989902021 681 dbSNP
rs914238864 689 dbSNP
rs114231264 697 dbSNP
rs1482268961 698 dbSNP
rs1249224748 699 dbSNP
rs1203954747 701 dbSNP
rs1042643843 702 dbSNP
rs1301716814 706 dbSNP
rs902740596 710 dbSNP
rs563048728 711 dbSNP
rs1056999546 716 dbSNP
rs1415663237 717 dbSNP
rs895318444 720 dbSNP
rs1404560228 723 dbSNP
rs546856155 726 dbSNP
rs374570094 727 dbSNP
rs1012280547 728 dbSNP
rs898725384 737 dbSNP
rs1161971974 744 dbSNP
rs1017006074 745 dbSNP
rs898491197 746 dbSNP
rs994154504 748 dbSNP
rs148875498 749 dbSNP
rs530466191 753 dbSNP
rs955443221 754 dbSNP
rs986745069 756 dbSNP
rs1198299438 757 dbSNP
rs143572148 759 dbSNP
rs1268749636 763 dbSNP
rs1481644037 767 dbSNP
rs778619945 769 dbSNP
rs969876122 771 dbSNP
rs1287518998 776 dbSNP
rs377713115 786 dbSNP
rs1233617832 787 dbSNP
rs893793486 790 dbSNP
rs989885572 790 dbSNP
rs1466157878 792 dbSNP
rs747957957 801 dbSNP
rs549278519 812 dbSNP
rs1322588502 818 dbSNP
rs74826884 821 dbSNP
rs967137258 825 dbSNP
rs1166107120 827 dbSNP
rs1441377212 830 dbSNP
rs1441416423 831 dbSNP
rs1369898125 832 dbSNP
rs1184933577 835 dbSNP
rs368847449 836 dbSNP
rs928326994 846 dbSNP
rs776989261 850 dbSNP
rs112629992 851 dbSNP
rs1189887253 855 dbSNP
rs916724981 858 dbSNP
rs1347127615 859 dbSNP
rs1210269561 861 dbSNP
rs948253960 864 dbSNP
rs1358169947 871 dbSNP
rs1402895654 875 dbSNP
rs1282180482 878 dbSNP
rs911268936 882 dbSNP
rs1327194788 885 dbSNP
rs1318163583 894 dbSNP
rs1216029101 904 dbSNP
rs11546977 910 dbSNP
rs1038573133 914 dbSNP
rs898563310 918 dbSNP
rs1388939077 919 dbSNP
rs994227510 920 dbSNP
rs186765397 921 dbSNP
rs1457118479 938 dbSNP
rs777761164 939 dbSNP
rs867112473 940 dbSNP
rs72570997 944 dbSNP
rs765207791 945 dbSNP
rs1199446789 957 dbSNP
rs1453210399 965 dbSNP
rs1265024274 975 dbSNP
rs1268368948 977 dbSNP
rs116694861 978 dbSNP
rs1226348707 998 dbSNP
rs1045502608 1000 dbSNP
rs1276005325 1003 dbSNP
rs1236110614 1004 dbSNP
rs1169928511 1006 dbSNP
rs1329807594 1016 dbSNP
rs1417436989 1023 dbSNP
rs866893518 1033 dbSNP
rs868624131 1034 dbSNP
rs553326149 1040 dbSNP
rs1309443973 1046 dbSNP
rs1021480001 1048 dbSNP
rs1165334812 1053 dbSNP
rs1001224464 1060 dbSNP
rs967084928 1061 dbSNP
rs1389041636 1063 dbSNP
rs1032839117 1071 dbSNP
rs1422443346 1072 dbSNP
rs573461203 1075 dbSNP
rs551872744 1077 dbSNP
rs959765792 1078 dbSNP
rs1020588378 1079 dbSNP
rs992804886 1095 dbSNP
rs1482828949 1100 dbSNP
rs542130458 1101 dbSNP
rs1279449907 1108 dbSNP
rs1268083313 1111 dbSNP
rs1220964857 1118 dbSNP
rs35423580 1121 dbSNP
rs1360609498 1122 dbSNP
rs955416012 1123 dbSNP
rs1274775786 1130 dbSNP
rs1229461590 1133 dbSNP
rs562413950 1134 dbSNP
rs1018270870 1136 dbSNP
rs1272001355 1140 dbSNP
rs948327224 1143 dbSNP
rs1334249550 1146 dbSNP
rs1038474670 1148 dbSNP
rs1400050465 1149 dbSNP
rs575264197 1159 dbSNP
rs1171903979 1160 dbSNP
rs1472819943 1165 dbSNP
rs1413948753 1178 dbSNP
rs1179685696 1180 dbSNP
rs369900258 1185 dbSNP
rs1362230807 1186 dbSNP
rs1472395447 1198 dbSNP
rs1220992389 1204 dbSNP
rs544270256 1207 dbSNP
rs1212421766 1209 dbSNP
rs1447989084 1210 dbSNP
rs1440761280 1212 dbSNP
rs113829011 1213 dbSNP
rs930023290 1214 dbSNP
rs564160118 1216 dbSNP
rs1266637881 1220 dbSNP
rs533092190 1223 dbSNP
rs891113017 1228 dbSNP
rs983067419 1229 dbSNP
rs1338161089 1230 dbSNP
rs1475091456 1231 dbSNP
rs918138638 1232 dbSNP
rs1008251708 1237 dbSNP
rs762831618 1242 dbSNP
rs899721176 1246 dbSNP
rs1442683185 1251 dbSNP
rs1045834794 1256 dbSNP
rs141995106 1257 dbSNP
rs1471908524 1258 dbSNP
rs937133832 1259 dbSNP
rs892981721 1260 dbSNP
rs1246722019 1263 dbSNP
rs1021427602 1269 dbSNP
rs967242064 1272 dbSNP
rs1402259467 1276 dbSNP
rs1315724991 1281 dbSNP
rs999000196 1284 dbSNP
rs1020220565 1285 dbSNP
rs1353765982 1288 dbSNP
rs1035471861 1295 dbSNP
rs1313754094 1296 dbSNP
rs1367356469 1299 dbSNP
rs560059436 1308 dbSNP
rs891062383 1309 dbSNP
rs1318450305 1313 dbSNP
rs76734424 1319 dbSNP
rs548968015 1326 dbSNP
rs1380016081 1336 dbSNP
rs1244397638 1338 dbSNP
rs991149418 1339 dbSNP
rs569138172 1341 dbSNP
rs1207273463 1342 dbSNP
rs974162637 1342 dbSNP
rs969580012 1348 dbSNP
rs1219750610 1349 dbSNP
rs1027041901 1352 dbSNP
rs974299759 1359 dbSNP
rs920091531 1364 dbSNP
rs1010005416 1365 dbSNP
rs1446631504 1369 dbSNP
rs537046703 1372 dbSNP
rs983259389 1373 dbSNP
rs146338665 1376 dbSNP
rs944133329 1377 dbSNP
rs1039672833 1379 dbSNP
rs899835664 1390 dbSNP
rs918077371 1391 dbSNP
rs570597066 1395 dbSNP
rs947283147 1396 dbSNP
rs537650429 1397 dbSNP
rs1388432227 1400 dbSNP
rs1169767531 1401 dbSNP
rs1337201742 1403 dbSNP
rs903003641 1403 dbSNP
rs1189909437 1409 dbSNP
rs553454081 1423 dbSNP
rs1035953259 1424 dbSNP
rs573323006 1430 dbSNP
rs895540643 1431 dbSNP
rs1483811470 1444 dbSNP
rs7811528 1444 dbSNP
rs1203124720 1447 dbSNP
rs1312767648 1450 dbSNP
rs1022549497 1452 dbSNP
rs1156602724 1463 dbSNP
rs963055087 1468 dbSNP
rs1288704304 1470 dbSNP
rs751369469 1479 dbSNP
rs1368886363 1480 dbSNP
rs1469986032 1502 dbSNP
rs7779625 1503 dbSNP
rs951613021 1504 dbSNP
rs982941723 1505 dbSNP
rs1018169702 1506 dbSNP
rs1184710873 1508 dbSNP
rs1451319374 1513 dbSNP
rs141094806 1516 dbSNP
rs912728689 1518 dbSNP
rs944096415 1524 dbSNP
rs975940376 1525 dbSNP
rs576046294 1531 dbSNP
rs899845462 1532 dbSNP
rs1241893184 1536 dbSNP
rs866685920 1541 dbSNP
rs1026966857 1542 dbSNP
rs1306546464 1544 dbSNP
rs544210227 1550 dbSNP
rs1350466051 1564 dbSNP
rs73281129 1567 dbSNP
rs1265264232 1568 dbSNP
rs765473453 1571 dbSNP
rs1004290146 1578 dbSNP
rs1251075437 1583 dbSNP
rs903080953 1584 dbSNP
rs114755822 1590 dbSNP
rs1423989556 1597 dbSNP
rs1056934468 1600 dbSNP
rs1232070489 1601 dbSNP
rs981000349 1603 dbSNP
rs767228592 1606 dbSNP
rs11546981 1607 dbSNP
rs1181151422 1616 dbSNP
rs138183032 1618 dbSNP
rs1248566671 1620 dbSNP
rs1178095611 1622 dbSNP
rs560204900 1623 dbSNP
rs1210420828 1625 dbSNP
rs1348250875 1640 dbSNP
rs1260405327 1646 dbSNP
rs1012666499 1647 dbSNP
rs1468770180 1651 dbSNP
rs1323683121 1652 dbSNP
rs1310664315 1654 dbSNP
rs1451995449 1660 dbSNP
rs11546978 1669 dbSNP
rs1366630515 1671 dbSNP
rs1167985844 1676 dbSNP
rs1433399269 1677 dbSNP
rs1398079579 1678 dbSNP
rs1164148836 1680 dbSNP
rs1458107226 1687 dbSNP
rs752966841 1688 dbSNP
rs1327479541 1692 dbSNP
rs989798594 1697 dbSNP
rs190822652 1701 dbSNP
rs758178753 1702 dbSNP
rs914230172 1709 dbSNP
rs1445173594 1715 dbSNP
rs542856582 1727 dbSNP
rs562435497 1730 dbSNP
rs531535251 1735 dbSNP
rs1210158646 1736 dbSNP
rs994486084 1738 dbSNP
rs1025948795 1740 dbSNP
rs951628379 1741 dbSNP
rs550540515 1748 dbSNP
rs1004873103 1751 dbSNP
rs751389002 1756 dbSNP
rs1251955451 1763 dbSNP
rs1342921596 1766 dbSNP
rs1341624648 1780 dbSNP
rs1226869650 1781 dbSNP
rs965961094 1782 dbSNP
rs1388884237 1786 dbSNP
rs1193975815 1787 dbSNP
rs1300881026 1788 dbSNP
rs912391966 1794 dbSNP
rs111904319 1795 dbSNP
rs1490438465 1796 dbSNP
rs181206273 1797 dbSNP
rs866130964 1798 dbSNP
rs1372421682 1800 dbSNP
rs1199375372 1802 dbSNP
rs1479898581 1808 dbSNP
rs1267083969 1816 dbSNP
rs1193513667 1817 dbSNP
rs1222062919 1821 dbSNP
rs968806477 1822 dbSNP
rs533171538 1824 dbSNP
rs34650249 1825 dbSNP
rs888080177 1829 dbSNP
rs150687794 1832 dbSNP
rs1057430875 1833 dbSNP
rs917082234 1834 dbSNP
rs1343995469 1835 dbSNP
rs1166612524 1840 dbSNP
rs948588875 1841 dbSNP
rs1282998320 1843 dbSNP
rs1048458520 1844 dbSNP
rs1425614034 1845 dbSNP
rs1370732978 1851 dbSNP
rs1309325202 1864 dbSNP
rs1407697562 1866 dbSNP
rs1305338355 1867 dbSNP
rs1344090759 1872 dbSNP
rs1386407109 1873 dbSNP
rs1044107612 1874 dbSNP
rs11546976 1875 dbSNP
rs1198348919 1881 dbSNP
rs115386344 1885 dbSNP
rs1254240411 1887 dbSNP
rs1047346396 1890 dbSNP
rs1437294408 1895 dbSNP
rs886143838 1896 dbSNP
rs769465535 1903 dbSNP
rs11546975 1904 dbSNP
rs1360062424 1919 dbSNP
rs779828783 1922 dbSNP
rs569548659 1927 dbSNP
rs1289295274 1928 dbSNP
rs1490136362 1930 dbSNP
rs1350785499 1934 dbSNP
rs989684382 1937 dbSNP
rs1439440129 1938 dbSNP
rs1020311955 1944 dbSNP
rs1334189802 1945 dbSNP
rs538509219 1951 dbSNP
rs1403730521 1952 dbSNP
rs996991721 1955 dbSNP
rs1028511069 1956 dbSNP
rs1426160265 1959 dbSNP
rs1191846817 1965 dbSNP
rs1414528210 1966 dbSNP
rs1385393334 1967 dbSNP
rs968757531 1972 dbSNP
rs772316154 1974 dbSNP
rs1364073902 1975 dbSNP
rs978846538 1979 dbSNP
rs924634660 1983 dbSNP
rs1039584557 1984 dbSNP
rs921088993 1985 dbSNP
rs1282544204 1988 dbSNP
rs1380535569 1990 dbSNP
rs558500618 1995 dbSNP
rs956269808 2008 dbSNP
rs992745884 2009 dbSNP
rs1349432389 2016 dbSNP
rs1284279685 2017 dbSNP
rs917178600 2018 dbSNP
rs1380567770 2023 dbSNP
rs140479181 2025 dbSNP
rs577668633 2025 dbSNP
rs1248039225 2026 dbSNP
rs1346780042 2029 dbSNP
rs201385417 2030 dbSNP
rs1315905412 2036 dbSNP
rs948658374 2045 dbSNP
rs1414723763 2049 dbSNP
rs1044173753 2050 dbSNP
rs920430050 2057 dbSNP
rs1320834781 2058 dbSNP
rs931254762 2059 dbSNP
rs930392809 2060 dbSNP
rs887117795 2064 dbSNP
rs1047968984 2072 dbSNP
rs886090732 2073 dbSNP
rs1215429434 2075 dbSNP
rs1446135441 2077 dbSNP
rs540229984 2081 dbSNP
rs553586060 2082 dbSNP
rs901391456 2085 dbSNP
rs906643485 2086 dbSNP
rs140039773 2088 dbSNP
rs1363919710 2089 dbSNP
rs1002231778 2091 dbSNP
rs13188 2092 dbSNP
rs1028457226 2096 dbSNP
rs1305149861 2100 dbSNP
rs562372370 2107 dbSNP
rs1365057543 2110 dbSNP
rs1423545999 2113 dbSNP
rs1169235752 2125 dbSNP
rs1011116073 2131 dbSNP
rs1365970435 2137 dbSNP
rs1417984539 2140 dbSNP
rs1451864320 2145 dbSNP
rs1478548222 2147 dbSNP
rs1000275121 2152 dbSNP
rs35414010 2152 dbSNP
rs1032202053 2156 dbSNP
rs531424855 2161 dbSNP
rs1454666490 2166 dbSNP
rs11971690 2172 dbSNP
rs1024322725 2176 dbSNP
rs796454134 2180 dbSNP
rs969908727 2181 dbSNP
rs1308867048 2182 dbSNP
rs980025930 2187 dbSNP
rs1368071041 2188 dbSNP
rs920420221 2199 dbSNP
rs930505588 2204 dbSNP
rs1403344272 2208 dbSNP
rs1308776241 2210 dbSNP
rs564845527 2216 dbSNP
rs796367676 2217 dbSNP
rs574446535 2229 dbSNP
rs1479258518 2233 dbSNP
rs547011845 2237 dbSNP
rs900173732 2238 dbSNP
rs566835371 2243 dbSNP
rs1249066920 2252 dbSNP
rs529415764 2254 dbSNP
rs1203773791 2259 dbSNP
rs932888995 2262 dbSNP
rs1264787664 2263 dbSNP
rs1221454092 2264 dbSNP
rs549518986 2266 dbSNP
rs185812660 2268 dbSNP
rs3801075 2280 dbSNP
rs1031858106 2281 dbSNP
rs1371303413 2283 dbSNP
rs558448490 2285 dbSNP
rs1297641138 2288 dbSNP
rs1014343595 2292 dbSNP
rs1024723113 2293 dbSNP
rs970066181 2297 dbSNP
rs1174792406 2299 dbSNP
rs938136861 2303 dbSNP
rs1055095522 2304 dbSNP
rs979975465 2305 dbSNP
rs1027549996 2309 dbSNP
rs572020396 2313 dbSNP
rs533547613 2318 dbSNP
rs907707226 2319 dbSNP
rs1358711602 2324 dbSNP
rs1442813539 2326 dbSNP
rs1021522236 2332 dbSNP
rs553766097 2347 dbSNP
rs573634698 2350 dbSNP
rs975898205 2351 dbSNP
rs921592323 2352 dbSNP
rs1370863143 2362 dbSNP
rs1409015927 2372 dbSNP
rs1315281348 2373 dbSNP
rs1009554176 2379 dbSNP
rs1019313623 2384 dbSNP
rs931666950 2393 dbSNP
rs1385705117 2412 dbSNP
rs1049987303 2415 dbSNP
rs1452425473 2422 dbSNP
rs1389885843 2427 dbSNP
rs765360624 2429 dbSNP
rs536318418 2434 dbSNP
rs965002373 2442 dbSNP
rs1157822356 2443 dbSNP
rs561499482 2446 dbSNP
rs367667790 2447 dbSNP
rs1387066374 2450 dbSNP
rs1307609073 2452 dbSNP
rs1460785238 2454 dbSNP
rs1262172073 2457 dbSNP
rs535201427 2461 dbSNP
rs904753658 2466 dbSNP
rs1485047578 2473 dbSNP
rs1260357349 2482 dbSNP
rs1253616983 2485 dbSNP
rs936281555 2491 dbSNP
rs1482242798 2493 dbSNP
rs1053663726 2512 dbSNP
rs983996880 2515 dbSNP
rs1366486662 2517 dbSNP
rs908360929 2519 dbSNP
rs1380884239 2528 dbSNP
rs1382377283 2540 dbSNP
rs892002729 2543 dbSNP
rs1481532277 2549 dbSNP
rs1287902733 2560 dbSNP
rs1197600312 2563 dbSNP
rs1014745472 2566 dbSNP
rs1366931081 2571 dbSNP
rs939987955 2580 dbSNP
rs149823359 2581 dbSNP
rs1195143728 2584 dbSNP
rs1426482729 2588 dbSNP
rs1261355411 2593 dbSNP
rs370822978 2594 dbSNP
rs927973041 2595 dbSNP
rs1410638574 2596 dbSNP
rs1490883986 2599 dbSNP
rs1289704919 2600 dbSNP
rs1221829861 2601 dbSNP
rs937979920 2604 dbSNP
rs905851296 2605 dbSNP
rs1001464377 2606 dbSNP
rs4721928 2607 dbSNP
rs1302367038 2611 dbSNP
rs1405183587 2615 dbSNP
rs951928401 2621 dbSNP
rs1423447337 2634 dbSNP
rs1042593975 2648 dbSNP
rs1004807052 2649 dbSNP
rs1372298231 2655 dbSNP
rs1273909544 2656 dbSNP
rs1361978421 2658 dbSNP
rs1481576543 2659 dbSNP
rs1215829486 2661 dbSNP
rs1298282733 2662 dbSNP
rs1009151965 2664 dbSNP
rs1205146015 2669 dbSNP
rs1438446084 2672 dbSNP
rs1252699389 2674 dbSNP
rs1015170337 2676 dbSNP
rs1194621213 2676 dbSNP
rs1339224480 2680 dbSNP
rs1264158571 2681 dbSNP
rs1225718069 2684 dbSNP
rs1325323269 2685 dbSNP
rs34820944 2690 dbSNP
rs1280934965 2694 dbSNP
rs1435188754 2697 dbSNP
rs544849785 2701 dbSNP
rs1490955395 2704 dbSNP
rs1040613769 2710 dbSNP
rs1246372535 2716 dbSNP
rs1395673404 2719 dbSNP
rs564827810 2721 dbSNP
rs900849737 2728 dbSNP
rs996492931 2728 dbSNP
rs1470817381 2730 dbSNP
rs1188364795 2731 dbSNP
rs1470612324 2734 dbSNP
rs1365611095 2735 dbSNP
rs1027975978 2736 dbSNP
rs145257684 2736 dbSNP
rs572338741 2736 dbSNP
rs1480679327 2750 dbSNP
rs568589742 2750 dbSNP
rs952471900 2752 dbSNP
rs577226842 2753 dbSNP
rs921703684 2754 dbSNP
rs1015467560 2756 dbSNP
rs961464091 2761 dbSNP
rs1376124727 2767 dbSNP
rs1337288726 2776 dbSNP
rs1454466342 2777 dbSNP
rs1367161336 2780 dbSNP
rs763743009 2782 dbSNP
rs927857057 2782 dbSNP
rs1422537705 2783 dbSNP
rs1156966151 2784 dbSNP
rs953126056 2785 dbSNP
rs544369645 2786 dbSNP
rs189740541 2787 dbSNP
rs201514710 2787 dbSNP
rs936246646 2788 dbSNP
rs1202906166 2789 dbSNP
rs1053405793 2800 dbSNP
rs913376936 2804 dbSNP
rs944839926 2806 dbSNP
rs950270059 2807 dbSNP
rs1431194578 2808 dbSNP
rs560507879 2809 dbSNP
rs1045891537 2810 dbSNP
rs1419272081 2812 dbSNP
rs529284611 2813 dbSNP
rs996420779 2814 dbSNP
rs1049459100 2815 dbSNP
rs1361981991 2817 dbSNP
rs905925750 2819 dbSNP
rs1226982446 2828 dbSNP
rs1001580354 2833 dbSNP
rs1385159268 2838 dbSNP
rs1289342769 2845 dbSNP
rs1187513924 2849 dbSNP
rs1476582743 2859 dbSNP
rs1049010661 2860 dbSNP
rs887824963 2863 dbSNP
rs1487719719 2867 dbSNP
rs1013786510 2869 dbSNP
rs1014873870 2872 dbSNP
rs966254900 2876 dbSNP
rs1447796298 2880 dbSNP
rs1005304665 2883 dbSNP
rs1289017949 2889 dbSNP
rs1214992754 2891 dbSNP
rs1218284856 2893 dbSNP
rs1015726636 2903 dbSNP
rs1464524139 2904 dbSNP
rs997326927 2906 dbSNP
rs1305111281 2907 dbSNP
rs1403153132 2908 dbSNP
rs1028844384 2909 dbSNP
rs1412094196 2910 dbSNP
rs953075431 2911 dbSNP
rs1003354339 2912 dbSNP
rs1034801934 2912 dbSNP
rs1477325041 2912 dbSNP
rs549455692 2917 dbSNP
rs979179359 2919 dbSNP
rs1162423654 2921 dbSNP
rs1201003887 2925 dbSNP
rs924931655 2932 dbSNP
rs1489625305 2939 dbSNP
rs956426584 2940 dbSNP
rs1245574053 2945 dbSNP
rs13225081 2947 dbSNP
rs879092211 2951 dbSNP
rs959316111 2954 dbSNP
rs1270635506 2958 dbSNP
rs1408509601 2960 dbSNP
rs1402059757 2961 dbSNP
rs989448917 2964 dbSNP
rs990694270 2966 dbSNP
rs915243051 2967 dbSNP
rs1387228661 2969 dbSNP
rs968417473 2970 dbSNP
rs913460632 2972 dbSNP
rs557016371 2977 dbSNP
rs950360496 2980 dbSNP
rs1258952247 2996 dbSNP
rs1045840238 2997 dbSNP
rs1331172382 3010 dbSNP
rs1470488581 3012 dbSNP
rs923995818 3015 dbSNP
rs1178170012 3021 dbSNP
rs944792924 3026 dbSNP
rs927467967 3027 dbSNP
rs562971565 3032 dbSNP
rs937425305 3054 dbSNP
rs1481607691 3055 dbSNP
rs1231075835 3061 dbSNP
rs1385631085 3064 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.806 1.0e-6 0.775 4.4e-6 24 Click to see details
GSE32688 Pancreatic cancer -0.387 1.4e-2 -0.313 4.1e-2 32 Click to see details
GSE38226 Liver fibrosis -0.359 5.5e-2 -0.365 5.2e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.449 6.2e-2 -0.137 3.3e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.318 7.0e-2 0.177 2.1e-1 23 Click to see details
GSE14794 Lymphoblastoid cells -0.128 1.1e-1 -0.196 3.2e-2 90 Click to see details
GSE17306 Multiple myeloma -0.153 1.5e-1 -0.149 1.5e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.254 1.7e-1 0.450 4.0e-2 16 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.163 2.2e-1 0.136 2.6e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.17 2.4e-1 0.071 3.8e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.095 3.3e-1 0.113 3.0e-1 25 Click to see details
GSE21849 B cell lymphoma -0.084 3.3e-1 0.202 1.5e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.055 3.3e-1 -0.178 8.0e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.074 3.7e-1 0.152 2.4e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.089 3.9e-1 0.217 2.5e-1 12 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.015 4.9e-1 -0.257 3.1e-1 6 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.375 0 -0.271 0.03 49 Click to see details
CHOL 0.667 0.02 0.650 0.03 9 Click to see details
KIRP 0.542 0.07 0.233 0.27 9 Click to see details
HNSC 0.939 0.11 1.000 0.5 3 Click to see details
KICH 0.385 0.17 0.214 0.31 8 Click to see details
KIRC 0.106 0.29 0.095 0.31 29 Click to see details
THCA 0.285 0.32 0.100 0.44 5 Click to see details
STAD 0.187 0.33 0.286 0.25 8 Click to see details
ESCA 0.171 0.39 0.100 0.44 5 Click to see details
ESCA 0.171 0.39 0.100 0.44 5 Click to see details
ESCA 0.171 0.39 0.100 0.44 5 Click to see details
ESCA 0.171 0.39 0.100 0.44 5 Click to see details
ESCA 0.171 0.39 0.100 0.44 5 Click to see details
ESCA 0.171 0.39 0.100 0.44 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*