miRTarBase - #MIRT023310 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SCN4B   
Synonyms ATFB17, LQT10, Navbeta4
Description sodium voltage-gated channel beta subunit 4
Transcript NM_001142348   
Other Transcripts NM_001142349 , NM_174934   
Expression
Putative miRNA Targets on SCN4B
3'UTR of SCN4B
(miRNA target sites are highlighted)
>SCN4B|NM_001142348|3'UTR
   1 GCCCTGCTTCGGGCTGAGCAGCTGCAGGGAGCCCCCTTTCTGATGATGAAACTGATGCTTGAGCCCCGACCGTAGAACCC
  81 ACGTGCCTGAGACATCTGCTGCTTGGCTCAAACTGTAGTCTTTCCGGGCACAAGAAACCAGAGTCCTGCCCAGCCTGCCC
 161 ATCCCCTTCCCAGTCAGGGCTCCCCAGGGACAAGGGATGGCCAGGGGAGGGGGTCTGTGGAAGATTCAGGAGAAAGAAAG
 241 GAGAGGCTAGGGTGGTGTGGAGGGGCTGGTCCCCTGACACCTGGGCAGATGGGGTCTCCTTCAGTCTCCCTACCCTGCAC
 321 AAGCAGGGCCTTGATTTTCCTCCAGGCTTCTCTTCACAAGAGACTGGGAGGATCCGTAAGGGATGTCCTAAGAGCTGCAC
 401 CCTGGAGATGGGGTGTAGGAAGAAGTGGCTTCCTTTGGAGGTGGGAGTGGGCTGGAGGCCTCTGGAGAAGACCTGGGGTG
 481 GGGGCTGATGGGGGCAGGCCCACAGTGAGAGACTGCCTCTGCTTCATAGGATACCAGATCCCCCACAGTCTTCCAAGTAG
 561 GAAACTTCCTTTCCCCTGCCCCGGGACCCTATCTGCCTATCCCCTCCCCTGCTCAGAGTTTTTAAGCCCTCTCAACCAGG
 641 GCTGGCCACCCTGGTCTTGAGGGTTCCTGGCCACCTAGCCTGCTCCTCTGCTCTCTGGGTTACTGAGGGGCTCAGGAAGG
 721 GGCCCCTCGAGCCTTCCTGGAGTACCCGAGTGCTCCCTATGCCTTTCCAAGCATTTCTACTTGGGGAATTGGGCCACAGA
 801 GGTAGTGAGCCAGTGTCCTGGGCCTCTGGGATGCCCGCCCCATTGCTGCCAATGCTGGCAGCCCCTCCCCTGGCATGGCA
 881 GGACCATCGCCACTCTGGGCACTCCTGAGCCCAGCTCTCCCCTGCTTCTCCCCCTCCTACCTGAGAGGCTGCACCCTCCA
 961 ACCTCCCATTGGCTCGCTCCCCCCCCCCCACCGTGCCCTCCATCACGCCCTGCCCCCAGGGTGGTTCATTTCCCAGCCCT
1041 GGGTCAAGGGCCTGCCTTCGCCTCAGGGACTCTCTTCCTTTGGATGAGGGGGTCCTTGGGTTTCCCAGCTGCTTCCTGCT
1121 CAGCTGGGCCACCCCCTCCCACCCTGGGGTTGGGGAGGAGCAGGGAGTGGGTGCCCACAGTTTTCCTTTGCTTCTCCCAG
1201 AGCTGGTTTGCACAGCCCTTGTGTGTGGGGCTAGAATGTGCCTTAGTCCTGAATCCTAGCCCTTACCCCCATCCTCTCTA
1281 GACGGTATGTCCTGACATAACAGCAGAGTCTGGTGTGGTGCTGGTGAGGGTTCGCCAGCCCTCCCCTCCCCAGGGTCATA
1361 GAGGGGGCCATGAGGCTGGAATTGGCCAGTGACTGAATCTTGGAGATGTCGGCCAGGTGCTCCCATTGGGGTTTCTAGCC
1441 TGCCCTAGGGGGAGGTGGTGATGTTGGGAGTGGGATCTCCTGAGTCCTTGTTGGGCAGAATTGGTGAGGCCAGGGATGGC
1521 AGGGAAAAGTGGTAACAAGCCTCTCTGCCCATCTACTTCCAATCCCTCTCTCCCTTACTGATTTTTTGATGCCCTGTCTT
1601 CTGGGCCCCTAGGAGGGATGAGAGAGGAGTAGCCCCCTTTTTCAGAGAGTTTGGGGTCTACCTCAGAGCTCTCCCTGTCA
1681 AAAAGCAGCTGCAAGCCTCGCAAGGGTGGAGTGGGGGGAGACTGAGGACCAGTAGTACCTGCAGGGTGCCCGTGGCTGTG
1761 GCCAGTGTCCCTTAGCCAACCTGCTGGGCTCACCAGTTCCCCGTCTGATCTGCCTGTGCGCCTCCCATTCTTCTCTACCC
1841 AGAACCTGTCATGGGCTGGGGCTCAGATTTTCCTGGCTTTGGGAGCAGACAGACCAGAGCCACCAGCCATTCAGAAAACT
1921 TCTTATAGCTACCTTCATGCAAAACTGTTTTCTTCTTCCTTCTCAATGGTGACATTTGAAGAGGCAGAGCACCTTGGGGC
2001 TCCTCCTTCTGTCTTAAGAGAAAGCCAAGGCACGTAGAGTAGGGAGAAGAAGGGCACCATCCTCTCTTTCCTCCCCAGGG
2081 TCTACTGCTGATTTCTAGATGGATCATGCAGCTTCTCTCAGCTCAGCTCTTTCCATCTACCAAATGGGTGTAATAATACT
2161 TACCTACCTCACAGGACTGTTGTGAGGCTTGGCAAGTTTTGTCTAAAAACATCTTTTTGGCTTGGAAAGGGATCTGGGAA
2241 GCCAGGTATTAATTGCAGGGATAGTTCCAAGTCTGTCCTGTCTTCATCTCTGTGTCCCATCTCTACAACCCACATACAGA
2321 CACACACACTCTCTCTCTCTTTCTTTCCATCCCACCCCCCTTGGAATTATTTAGTCTTTGCAATATTAGAAACCTTGACT
2401 CTGATGCTTAAAGCTTCTTGTCCATGGCTTTTGTTTGATGGTTTTCAATAGAGGTGACTGAGATTGTAGGGGGGGCATTT
2481 TTGGTTGCCCCCATGCGTGGGGGCACTACTAAGAATGCTAAACTTAGTCCCCACAACAAAGAATCATCCTGTCCCATGTC
2561 AACATTATACCCATGGAGAAACACTGGCATGGATTTGCACTAGGATGTATATGGGCAAAGCTATCTTCCCCAAGTGGAAC
2641 CTCAGTGCATGCAAATCTCTGATGGTGGCTTCCAGGGCTTGTGGGCTAGAGAGAGCCACTTACAAAGTCGATCTTGAGAG
2721 ACCTGGCCACATGCAGCTGGGCTGAGTGATGTCAGCGAGACTAAAGACAAAGTTCTGAGCTCCTCATCAACTACAAAATA
2801 TGAAATCAGCATTCCAGGTTCTGGGCTTCTCCCCATGTCGTAATTGAACAGAAGGCAGCCCGAATAAACCCCTGATGTTA
2881 GAGAGGCCTGGGGAGAGCAGCCGATGGGGCTCAGACTACATATGGCAGGCCGATCAGAGCTCTTGTGGAGCGAGGGCTTG
2961 AGAGCATGCTTGTGAGATGGCAGGAGGTGGGGTGTGCTTGTGTGGAGTGTGCGTGTGCAGGCAGTGTGGGTGCATGGCAG
3041 CGTAACTGTGGAGTGGATGGGCTCTGCATGTAAGGGGTGATGCATGATGGGCAGATGCTGGACATTTGAGGAGCCGTCTT
3121 TCTTGGCCTGAGCTATGCCTGTTGAGGCATCTGGAGACTGAGAAAGAATCAAAGGCAGAGAAGACCAGCCGTGCTCCTGC
3201 ATTCCGTCACTCCATGACTTCATCTCAGTGTCACAGACAGCTGCCATCAGAGGGCTGGCAGTAGGGAGTTCCAGGAGCGG
3281 GGACTTCTCGGGAAAATCCTATAACTTGCTTTACTTTACTTTGTCCCAGGTTGGAGTCCCTACCCTCCCACCTCCCACCT
3361 GATATGCAGTGCTTTTGACTATCTTATGCATGGTTTATTCCTCTGGCTTGGATGACAACAATACCCATAGTCAATTTTCC
3441 TATGTAACTATAGATCAAATGATGCAACAACAGGCCTTGGGAGGCCTCAGGTGTGCGAGTGCCTCTGGGAGGCGCAGATG
3521 CCCACACAGCCAGCACTGACTTGTGTTCGAGCACAGAACGGATATAATCAGTCTGGCCTCTACAACAAGTTTTGCATTGT
3601 AGAATTGTATTTAGCTTTGCCTTGGATGAAATAAAAATTATGTTTAATAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACA-GUGUGAGGu 5'
            | |:||| | |  :|||||| 
Target 5' ccATCGCCACTCTGGGCACTCCt 3'
884 - 906 140.00 -15.70
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :||| ||    |||||||: 
Target 5' caGACA-CA----CACACTCTc 3'
2317 - 2333 133.00 -16.10
3
miRNA  3' guUUG--UGGUAACAGUGUGAGGu 5'
            |||   |||||| | |:|||| 
Target 5' ccAACCTCCCATTGGCTCGCTCCc 3'
958 - 981 126.00 -17.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
929095 7 ClinVar
302644 258 ClinVar
1182110 328 ClinVar
302643 362 ClinVar
302642 434 ClinVar
302641 449 ClinVar
302640 471 ClinVar
302639 489 ClinVar
302638 525 ClinVar
302637 670 ClinVar
302636 680 ClinVar
302635 785 ClinVar
302633 812 ClinVar
302634 812 ClinVar
302632 868 ClinVar
302631 889 ClinVar
302630 905 ClinVar
302629 935 ClinVar
302628 961 ClinVar
302627 979 ClinVar
302625 986 ClinVar
302626 986 ClinVar
302624 987 ClinVar
302623 989 ClinVar
302622 990 ClinVar
302621 991 ClinVar
302620 1007 ClinVar
302619 1053 ClinVar
302618 1071 ClinVar
302617 1164 ClinVar
302616 1193 ClinVar
302615 1334 ClinVar
302614 1343 ClinVar
302613 1410 ClinVar
302612 1430 ClinVar
302611 1810 ClinVar
302610 1819 ClinVar
302609 1820 ClinVar
302608 1842 ClinVar
302607 1962 ClinVar
302606 1994 ClinVar
302605 2080 ClinVar
302604 2120 ClinVar
302603 2137 ClinVar
302602 2196 ClinVar
302601 2220 ClinVar
302600 2268 ClinVar
302599 2324 ClinVar
302598 2487 ClinVar
302597 2496 ClinVar
302596 2497 ClinVar
302595 2591 ClinVar
302594 2623 ClinVar
302593 2785 ClinVar
302592 2876 ClinVar
302591 2879 ClinVar
302590 2918 ClinVar
302589 2939 ClinVar
302588 2952 ClinVar
302587 2977 ClinVar
302586 3004 ClinVar
302585 3054 ClinVar
302584 3279 ClinVar
302583 3549 ClinVar
302582 3612 ClinVar
302581 3633 ClinVar
COSN20077400 11 COSMIC
COSN31507515 15 COSMIC
COSN1080148 19 COSMIC
COSN1080149 24 COSMIC
COSN30465041 33 COSMIC
COSN30105088 38 COSMIC
COSN30473985 40 COSMIC
COSN30520999 42 COSMIC
COSN30100239 68 COSMIC
COSN29467874 83 COSMIC
COSN30102059 96 COSMIC
COSN1080150 120 COSMIC
COSN31876072 148 COSMIC
COSN20077543 158 COSMIC
COSN5896411 300 COSMIC
COSN24294670 405 COSMIC
COSN15348879 450 COSMIC
COSN6607265 785 COSMIC
COSN6607264 889 COSMIC
COSN1127319 915 COSMIC
COSN32062300 923 COSMIC
COSN6988096 923 COSMIC
COSN26218029 935 COSMIC
COSN31593763 942 COSMIC
COSN28754741 976 COSMIC
COSN8640939 979 COSMIC
COSN30163266 987 COSMIC
COSN28747525 990 COSMIC
COSN24381038 1003 COSMIC
COSN31552163 1086 COSMIC
COSN26677099 1134 COSMIC
COSN16127540 1200 COSMIC
COSN10078974 1226 COSMIC
COSN31584293 1303 COSMIC
COSN31564580 1311 COSMIC
COSN16115303 1452 COSMIC
COSN22168559 1733 COSMIC
COSN5896410 1864 COSMIC
COSN30245822 2330 COSMIC
COSN25884926 2497 COSMIC
COSN16163096 2733 COSMIC
COSN24294669 2756 COSMIC
COSN21680059 2826 COSMIC
COSN1127318 2857 COSMIC
COSN31778898 3104 COSMIC
COSN31577097 3205 COSMIC
COSN6988095 3217 COSMIC
COSN30177014 3250 COSMIC
COSN28641136 3377 COSMIC
COSN15660709 3505 COSMIC
COSN30177235 3517 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1573577 1 dbSNP
rs1573578 3 dbSNP
rs1398960584 4 dbSNP
rs79071006 7 dbSNP
rs759936364 10 dbSNP
rs774052029 11 dbSNP
rs766009781 13 dbSNP
rs762685269 19 dbSNP
rs772529983 23 dbSNP
rs1437380513 24 dbSNP
rs1031651679 29 dbSNP
rs1316719977 33 dbSNP
rs977851977 36 dbSNP
rs1202449761 37 dbSNP
rs1482462247 40 dbSNP
rs1262865387 42 dbSNP
rs1229421897 52 dbSNP
rs532464225 55 dbSNP
rs1227567022 65 dbSNP
rs968719673 66 dbSNP
rs748050952 67 dbSNP
rs534237428 68 dbSNP
rs1486549949 70 dbSNP
rs776759954 71 dbSNP
rs768564207 72 dbSNP
rs746836377 75 dbSNP
rs1435624941 77 dbSNP
rs779911332 79 dbSNP
rs1403465389 80 dbSNP
rs757355479 82 dbSNP
rs1457573605 83 dbSNP
rs1054557315 104 dbSNP
rs1390735525 106 dbSNP
rs1156801542 115 dbSNP
rs757215459 116 dbSNP
rs1369165427 118 dbSNP
rs1313376858 121 dbSNP
rs567025946 125 dbSNP
rs777778613 126 dbSNP
rs756233303 129 dbSNP
rs1297026915 136 dbSNP
rs1309942155 138 dbSNP
rs1209680143 139 dbSNP
rs1232031084 142 dbSNP
rs753169114 145 dbSNP
rs911878549 146 dbSNP
rs1205113651 157 dbSNP
rs1051042511 160 dbSNP
rs1262383963 165 dbSNP
rs1349297458 169 dbSNP
rs1284236384 170 dbSNP
rs1008462764 174 dbSNP
rs1380031434 175 dbSNP
rs1314004513 177 dbSNP
rs1435522126 179 dbSNP
rs887385703 182 dbSNP
rs543593401 184 dbSNP
rs1431533404 196 dbSNP
rs1163172346 197 dbSNP
rs770645878 197 dbSNP
rs1395959329 200 dbSNP
rs1399999267 201 dbSNP
rs1391389324 205 dbSNP
rs574719547 208 dbSNP
rs1422830112 211 dbSNP
rs751816527 212 dbSNP
rs930958608 213 dbSNP
rs1360305658 217 dbSNP
rs1451696484 217 dbSNP
rs898172039 226 dbSNP
rs1044760056 227 dbSNP
rs766775803 229 dbSNP
rs1452630632 236 dbSNP
rs1364818509 238 dbSNP
rs1292647060 240 dbSNP
rs1224059465 243 dbSNP
rs762473800 245 dbSNP
rs947842792 252 dbSNP
rs917744647 253 dbSNP
rs973918403 254 dbSNP
rs554886053 255 dbSNP
rs749107016 255 dbSNP
rs886047730 258 dbSNP
rs1228736331 265 dbSNP
rs1231823885 267 dbSNP
rs1033526370 270 dbSNP
rs370314626 270 dbSNP
rs1366953051 271 dbSNP
rs1573579 272 dbSNP
rs1268145601 280 dbSNP
rs935247300 289 dbSNP
rs1429788294 291 dbSNP
rs1331545083 293 dbSNP
rs772940723 294 dbSNP
rs1403168710 299 dbSNP
rs1365094304 312 dbSNP
rs1169437882 314 dbSNP
rs1431822176 317 dbSNP
rs1417668263 321 dbSNP
rs1193159986 323 dbSNP
rs1489556354 324 dbSNP
rs1167630754 328 dbSNP
rs1455699453 337 dbSNP
rs1478598109 346 dbSNP
rs1248947145 352 dbSNP
rs541675028 358 dbSNP
rs72546681 362 dbSNP
rs552887524 363 dbSNP
rs1009820331 375 dbSNP
rs548823722 376 dbSNP
rs1308834911 408 dbSNP
rs1270453704 409 dbSNP
rs1213771528 410 dbSNP
rs968667424 411 dbSNP
rs530184831 413 dbSNP
rs1021641712 414 dbSNP
rs1444065549 417 dbSNP
rs1221248477 422 dbSNP
rs776694589 425 dbSNP
rs1344844949 428 dbSNP
rs1373756086 430 dbSNP
rs1308665488 432 dbSNP
rs1411743198 433 dbSNP
rs886047729 434 dbSNP
rs1328497675 437 dbSNP
rs1415377100 440 dbSNP
rs1427743655 441 dbSNP
rs1174765617 447 dbSNP
rs67276909 449 dbSNP
rs1413359209 451 dbSNP
rs1019767560 452 dbSNP
rs1182187679 454 dbSNP
rs1481367359 462 dbSNP
rs539487703 471 dbSNP
rs1373169066 475 dbSNP
rs1203439230 481 dbSNP
rs1442760216 485 dbSNP
rs886047728 489 dbSNP
rs760666286 492 dbSNP
rs1322659394 493 dbSNP
rs1166322619 494 dbSNP
rs1419323548 495 dbSNP
rs570554801 499 dbSNP
rs1225523487 503 dbSNP
rs1371338022 511 dbSNP
rs887303150 513 dbSNP
rs1026279338 515 dbSNP
rs995724118 516 dbSNP
rs1448978744 521 dbSNP
rs66491110 525 dbSNP
rs1444092504 526 dbSNP
rs1335073122 530 dbSNP
rs1300803074 531 dbSNP
rs1469614574 532 dbSNP
rs1390013185 538 dbSNP
rs557128655 544 dbSNP
rs771920018 545 dbSNP
rs1420332219 546 dbSNP
rs537223779 549 dbSNP
rs898160741 550 dbSNP
rs1216919567 551 dbSNP
rs1405216063 565 dbSNP
rs749445472 571 dbSNP
rs1472895689 576 dbSNP
rs890510689 577 dbSNP
rs1244614008 579 dbSNP
rs1438670606 580 dbSNP
rs1201527951 582 dbSNP
rs187776222 583 dbSNP
rs764375393 587 dbSNP
rs1485561194 589 dbSNP
rs1268661450 592 dbSNP
rs866880037 597 dbSNP
rs1217911139 601 dbSNP
rs1260273869 602 dbSNP
rs1044747304 603 dbSNP
rs778008349 604 dbSNP
rs897086268 606 dbSNP
rs1283588553 611 dbSNP
rs774537685 612 dbSNP
rs1228976870 615 dbSNP
rs755759321 616 dbSNP
rs1350272350 617 dbSNP
rs1313277825 618 dbSNP
rs752178625 619 dbSNP
rs1419627582 626 dbSNP
rs1366439514 628 dbSNP
rs1291114431 629 dbSNP
rs1173559221 631 dbSNP
rs896250894 635 dbSNP
rs1452216715 638 dbSNP
rs1345144326 643 dbSNP
rs1038278741 650 dbSNP
rs1056227514 662 dbSNP
rs182613927 670 dbSNP
rs927113930 671 dbSNP
rs1181418333 674 dbSNP
rs1216495796 676 dbSNP
rs886047727 680 dbSNP
rs1248364520 682 dbSNP
rs923799827 683 dbSNP
rs1484818460 685 dbSNP
rs1241450589 688 dbSNP
rs1222394146 689 dbSNP
rs979929122 692 dbSNP
rs1361757013 699 dbSNP
rs1289834467 707 dbSNP
rs1043629198 708 dbSNP
rs1177696521 709 dbSNP
rs1343180149 710 dbSNP
rs1242147723 712 dbSNP
rs949844061 719 dbSNP
rs1380901683 723 dbSNP
rs946649298 724 dbSNP
rs1361795349 728 dbSNP
rs1473314193 730 dbSNP
rs1294701035 734 dbSNP
rs1266111424 738 dbSNP
rs1405001954 739 dbSNP
rs1366937956 744 dbSNP
rs1161162887 746 dbSNP
rs916975282 747 dbSNP
rs1390415923 748 dbSNP
rs988450375 751 dbSNP
rs1358410138 756 dbSNP
rs955694090 757 dbSNP
rs1260943770 761 dbSNP
rs1327075726 763 dbSNP
rs1267621848 772 dbSNP
rs1033248439 776 dbSNP
rs766335360 779 dbSNP
rs1191748865 781 dbSNP
rs1814964 785 dbSNP
rs1351998466 789 dbSNP
rs1266814171 791 dbSNP
rs1221875146 794 dbSNP
rs964941000 797 dbSNP
rs1018196738 798 dbSNP
rs1009027155 801 dbSNP
rs1483472972 802 dbSNP
rs781266462 807 dbSNP
rs1317544 812 dbSNP
rs1307331018 814 dbSNP
rs1302544881 816 dbSNP
rs1225844907 817 dbSNP
rs964053509 821 dbSNP
rs1344193702 828 dbSNP
rs1159042419 834 dbSNP
rs375888927 836 dbSNP
rs912614533 837 dbSNP
rs1405791742 840 dbSNP
rs986909151 844 dbSNP
rs1323903975 845 dbSNP
rs565880138 846 dbSNP
rs552141222 848 dbSNP
rs1460257849 850 dbSNP
rs1372329494 855 dbSNP
rs780232802 857 dbSNP
rs1441863222 860 dbSNP
rs532403270 861 dbSNP
rs1481349992 862 dbSNP
rs1427135049 865 dbSNP
rs549353088 868 dbSNP
rs1473000757 869 dbSNP
rs1252917218 879 dbSNP
rs899143737 881 dbSNP
rs1038330943 888 dbSNP
rs113579428 889 dbSNP
rs1208596681 891 dbSNP
rs565174265 905 dbSNP
rs1205980127 909 dbSNP
rs1321947430 911 dbSNP
rs1283285529 913 dbSNP
rs1222359772 917 dbSNP
rs1335884397 919 dbSNP
rs1236019227 920 dbSNP
rs1426620063 921 dbSNP
rs1308657068 922 dbSNP
rs1437010160 922 dbSNP
rs1786194 923 dbSNP
rs397753873 924 dbSNP
rs962953486 930 dbSNP
rs761569060 932 dbSNP
rs780800329 932 dbSNP
rs144216378 934 dbSNP
rs1370870059 935 dbSNP
rs1417191442 935 dbSNP
rs1391167039 936 dbSNP
rs1470837831 937 dbSNP
rs1329900864 938 dbSNP
rs1403815196 938 dbSNP
rs1175696719 939 dbSNP
rs1470533688 943 dbSNP
rs1337909358 946 dbSNP
rs1231957841 957 dbSNP
rs561492722 961 dbSNP
rs1179772726 963 dbSNP
rs1418663228 964 dbSNP
rs949886643 965 dbSNP
rs1234663677 968 dbSNP
rs1243978872 969 dbSNP
rs1185803877 971 dbSNP
rs1485776074 972 dbSNP
rs1460305138 973 dbSNP
rs1023243203 975 dbSNP
rs763728308 976 dbSNP
rs747888755 978 dbSNP
rs1187109603 979 dbSNP
rs372617878 979 dbSNP
rs541268607 979 dbSNP
rs1261921919 980 dbSNP
rs896169982 981 dbSNP
rs765831490 983 dbSNP
rs773412025 983 dbSNP
rs748377170 984 dbSNP
rs747454349 985 dbSNP
rs1026423478 986 dbSNP
rs28675746 986 dbSNP
rs559032799 987 dbSNP
rs762140499 987 dbSNP
rs545793192 988 dbSNP
rs905790338 988 dbSNP
rs576946955 989 dbSNP
rs5795119 989 dbSNP
rs1233126824 990 dbSNP
rs1361923572 990 dbSNP
rs1491351207 990 dbSNP
rs5795117 990 dbSNP
rs879065793 990 dbSNP
rs886047726 990 dbSNP
rs1157517572 991 dbSNP
rs1455892056 991 dbSNP
rs747111771 991 dbSNP
rs763488889 992 dbSNP
rs1303725337 993 dbSNP
rs1321956031 993 dbSNP
rs775573631 993 dbSNP
rs1315390702 995 dbSNP
rs1372885648 996 dbSNP
rs1221905593 1000 dbSNP
rs1306182779 1002 dbSNP
rs557009752 1006 dbSNP
rs886047725 1007 dbSNP
rs1270045902 1009 dbSNP
rs1335871467 1010 dbSNP
rs1213274953 1013 dbSNP
rs1253911076 1015 dbSNP
rs1401166090 1021 dbSNP
rs1050453193 1022 dbSNP
rs1052835889 1025 dbSNP
rs1175907691 1032 dbSNP
rs760271823 1037 dbSNP
rs1156821518 1039 dbSNP
rs1420135439 1040 dbSNP
rs1314008627 1042 dbSNP
rs1453230358 1043 dbSNP
rs752571129 1044 dbSNP
rs934418829 1048 dbSNP
rs1165760290 1051 dbSNP
rs1443131592 1052 dbSNP
rs1460512774 1053 dbSNP
rs191989669 1053 dbSNP
rs1194375236 1054 dbSNP
rs912575405 1055 dbSNP
rs925664857 1056 dbSNP
rs1396313829 1059 dbSNP
rs759484587 1060 dbSNP
rs772086614 1061 dbSNP
rs774067361 1062 dbSNP
rs766193806 1065 dbSNP
rs117263855 1071 dbSNP
rs951535863 1083 dbSNP
rs1320922349 1086 dbSNP
rs1437206262 1087 dbSNP
rs1356849478 1088 dbSNP
rs1332723109 1092 dbSNP
rs1314031840 1094 dbSNP
rs776892033 1100 dbSNP
rs1328122316 1101 dbSNP
rs554742649 1105 dbSNP
rs1381695658 1106 dbSNP
rs918730275 1112 dbSNP
rs974239306 1115 dbSNP
rs1175615478 1121 dbSNP
rs1165584827 1127 dbSNP
rs1422922894 1129 dbSNP
rs1378842259 1130 dbSNP
rs962861684 1136 dbSNP
rs1202701311 1139 dbSNP
rs1023817309 1149 dbSNP
rs1481179281 1152 dbSNP
rs1184944858 1154 dbSNP
rs1476633473 1155 dbSNP
rs1167936435 1157 dbSNP
rs1371837217 1160 dbSNP
rs1193162352 1162 dbSNP
rs1793158 1164 dbSNP
rs910822107 1167 dbSNP
rs565945137 1169 dbSNP
rs1489679973 1171 dbSNP
rs1288785376 1174 dbSNP
rs960617240 1175 dbSNP
rs1341270875 1176 dbSNP
rs1268313404 1180 dbSNP
rs1226552725 1181 dbSNP
rs1034724970 1186 dbSNP
rs1304972587 1187 dbSNP
rs886047724 1193 dbSNP
rs1403188503 1203 dbSNP
rs1354874306 1204 dbSNP
rs552089757 1205 dbSNP
rs1329864625 1213 dbSNP
rs1411982709 1215 dbSNP
rs1394838818 1216 dbSNP
rs1167717207 1219 dbSNP
rs1481014853 1223 dbSNP
rs1432085422 1230 dbSNP
rs1354804267 1234 dbSNP
rs1200950940 1237 dbSNP
rs1484299882 1238 dbSNP
rs954895744 1240 dbSNP
rs1293915614 1245 dbSNP
rs538563610 1250 dbSNP
rs1212978288 1251 dbSNP
rs1204825302 1252 dbSNP
rs1439224787 1256 dbSNP
rs1270562564 1259 dbSNP
rs768309654 1261 dbSNP
rs1197795099 1267 dbSNP
rs1324104300 1268 dbSNP
rs1285188361 1269 dbSNP
rs972188291 1270 dbSNP
rs902289382 1271 dbSNP
rs1043509313 1273 dbSNP
rs1010721263 1274 dbSNP
rs12793713 1276 dbSNP
rs1485591398 1279 dbSNP
rs772561360 1283 dbSNP
rs1238650975 1284 dbSNP
rs1474167423 1285 dbSNP
rs1280331975 1291 dbSNP
rs1444592614 1292 dbSNP
rs1419869716 1298 dbSNP
rs1431386806 1316 dbSNP
rs537792120 1318 dbSNP
rs1328518803 1320 dbSNP
rs1470544159 1321 dbSNP
rs1171459042 1330 dbSNP
rs1408919547 1333 dbSNP
rs7124127 1334 dbSNP
rs1467755803 1335 dbSNP
rs779367494 1336 dbSNP
rs187754283 1340 dbSNP
rs886047723 1343 dbSNP
rs1470921186 1349 dbSNP
rs891119535 1351 dbSNP
rs1051128219 1354 dbSNP
rs1002645825 1355 dbSNP
rs930036581 1356 dbSNP
rs1461653076 1363 dbSNP
rs1264889432 1365 dbSNP
rs766323527 1366 dbSNP
rs1230885125 1367 dbSNP
rs1201741042 1368 dbSNP
rs757744268 1370 dbSNP
rs748917471 1374 dbSNP
rs969397323 1375 dbSNP
rs918641349 1381 dbSNP
rs1308891593 1384 dbSNP
rs1453799997 1386 dbSNP
rs1385499748 1388 dbSNP
rs777546970 1389 dbSNP
rs1212193501 1393 dbSNP
rs1452496736 1395 dbSNP
rs1346312361 1405 dbSNP
rs974144530 1409 dbSNP
rs886047722 1410 dbSNP
rs755564095 1411 dbSNP
rs895703098 1412 dbSNP
rs991470760 1413 dbSNP
rs549766687 1417 dbSNP
rs752195716 1426 dbSNP
rs1170092787 1428 dbSNP
rs45548134 1430 dbSNP
rs1242695171 1431 dbSNP
rs1384980313 1437 dbSNP
rs1218037645 1438 dbSNP
rs561265492 1440 dbSNP
rs904294071 1445 dbSNP
rs1285554481 1447 dbSNP
rs1246926603 1448 dbSNP
rs977757713 1449 dbSNP
rs966796456 1450 dbSNP
rs943050884 1451 dbSNP
rs1228122870 1452 dbSNP
rs1022016048 1460 dbSNP
rs1370671938 1468 dbSNP
rs1363252578 1475 dbSNP
rs1291211694 1477 dbSNP
rs1235559731 1478 dbSNP
rs910214980 1490 dbSNP
rs1010670463 1493 dbSNP
rs1052478461 1496 dbSNP
rs1297063632 1501 dbSNP
rs1424853566 1504 dbSNP
rs547966576 1505 dbSNP
rs1161432226 1506 dbSNP
rs1423100433 1507 dbSNP
rs1420107668 1511 dbSNP
rs1188262010 1513 dbSNP
rs754871102 1515 dbSNP
rs1468750029 1520 dbSNP
rs527907208 1521 dbSNP
rs1223326838 1522 dbSNP
rs1200813533 1526 dbSNP
rs1490885265 1535 dbSNP
rs933564883 1536 dbSNP
rs900330918 1538 dbSNP
rs1308485994 1539 dbSNP
rs1298341027 1540 dbSNP
rs972241991 1541 dbSNP
rs1442058733 1542 dbSNP
rs565560574 1547 dbSNP
rs1277117270 1554 dbSNP
rs1340479898 1559 dbSNP
rs1276943265 1560 dbSNP
rs1163046527 1568 dbSNP
rs1405093929 1570 dbSNP
rs1367050753 1572 dbSNP
rs1291473819 1575 dbSNP
rs1457201120 1576 dbSNP
rs751520543 1583 dbSNP
rs1172312010 1584 dbSNP
rs1426597096 1586 dbSNP
rs1422846466 1592 dbSNP
rs1200215706 1596 dbSNP
rs1325866108 1604 dbSNP
rs1481497265 1605 dbSNP
rs1266998171 1606 dbSNP
rs1334386897 1607 dbSNP
rs1209517555 1617 dbSNP
rs1009214307 1620 dbSNP
rs1253401283 1621 dbSNP
rs1202865485 1626 dbSNP
rs548222780 1628 dbSNP
rs1317832668 1629 dbSNP
rs1264381989 1633 dbSNP
rs759474360 1638 dbSNP
rs545680911 1642 dbSNP
rs1346902035 1643 dbSNP
rs1298589576 1654 dbSNP
rs1048117483 1660 dbSNP
rs1385839438 1675 dbSNP
rs766144398 1679 dbSNP
rs929968344 1682 dbSNP
rs1314043175 1688 dbSNP
rs757842710 1689 dbSNP
rs576828422 1699 dbSNP
rs1038382510 1700 dbSNP
rs941482296 1707 dbSNP
rs1013500708 1708 dbSNP
rs776716535 1709 dbSNP
rs1437062492 1711 dbSNP
rs916744904 1713 dbSNP
rs183108662 1715 dbSNP
rs1417255233 1720 dbSNP
rs1419822500 1720 dbSNP
rs764436838 1722 dbSNP
rs1031521303 1724 dbSNP
rs1342137793 1727 dbSNP
rs1252938748 1732 dbSNP
rs998673498 1733 dbSNP
rs1390387370 1734 dbSNP
rs1457634615 1737 dbSNP
rs939528331 1739 dbSNP
rs1206071909 1742 dbSNP
rs1322071679 1749 dbSNP
rs1253676649 1751 dbSNP
rs543094363 1752 dbSNP
rs1317124427 1753 dbSNP
rs574475135 1759 dbSNP
rs749853808 1766 dbSNP
rs1021829831 1776 dbSNP
rs1007300575 1777 dbSNP
rs1375938185 1787 dbSNP
rs554398067 1788 dbSNP
rs928214256 1794 dbSNP
rs1249297976 1796 dbSNP
rs1454470419 1799 dbSNP
rs978754161 1802 dbSNP
rs775596774 1803 dbSNP
rs1051459676 1805 dbSNP
rs1454436089 1807 dbSNP
rs200930587 1810 dbSNP
rs1157136931 1812 dbSNP
rs1365379428 1814 dbSNP
rs932946244 1815 dbSNP
rs1164129517 1816 dbSNP
rs1439345615 1817 dbSNP
rs1189842677 1818 dbSNP
rs534802709 1819 dbSNP
rs45539741 1820 dbSNP
rs1441133320 1825 dbSNP
rs1256141512 1830 dbSNP
rs989228248 1831 dbSNP
rs942214759 1833 dbSNP
rs1262098935 1838 dbSNP
rs1472981308 1840 dbSNP
rs117471801 1842 dbSNP
rs1352565571 1845 dbSNP
rs140564832 1846 dbSNP
rs1292979605 1847 dbSNP
rs1247911017 1858 dbSNP
rs771416025 1866 dbSNP
rs1288879795 1867 dbSNP
rs1333477883 1870 dbSNP
rs1210274702 1874 dbSNP
rs1228686208 1884 dbSNP
rs1382830905 1886 dbSNP
rs1358199893 1887 dbSNP
rs749726877 1890 dbSNP
rs1296459818 1894 dbSNP
rs1299494372 1895 dbSNP
rs1345495958 1902 dbSNP
rs948164016 1904 dbSNP
rs1256558432 1906 dbSNP
rs1386111015 1912 dbSNP
rs1165849294 1916 dbSNP
rs1238217949 1918 dbSNP
rs1472053353 1919 dbSNP
rs890301752 1922 dbSNP
rs1194579567 1924 dbSNP
rs917969849 1925 dbSNP
rs778015180 1935 dbSNP
rs992132950 1937 dbSNP
rs755726700 1938 dbSNP
rs1292121591 1939 dbSNP
rs747788272 1942 dbSNP
rs956690911 1945 dbSNP
rs1354061397 1951 dbSNP
rs1283408198 1952 dbSNP
rs1453005824 1961 dbSNP
rs7934994 1962 dbSNP
rs993828336 1964 dbSNP
rs1276323730 1969 dbSNP
rs767751401 1970 dbSNP
rs1399540420 1972 dbSNP
rs1286540612 1977 dbSNP
rs569623571 1989 dbSNP
rs1366423682 1990 dbSNP
rs886047721 1994 dbSNP
rs1305229996 1996 dbSNP
rs1038372472 1999 dbSNP
rs151305385 2000 dbSNP
rs1390404282 2007 dbSNP
rs1168885078 2009 dbSNP
rs1383218977 2013 dbSNP
rs751471452 2026 dbSNP
rs1476635215 2027 dbSNP
rs968989665 2028 dbSNP
rs1190856564 2033 dbSNP
rs755268093 2034 dbSNP
rs1269132217 2035 dbSNP
rs766373736 2042 dbSNP
rs1414317321 2044 dbSNP
rs758178827 2046 dbSNP
rs536296339 2051 dbSNP
rs1055636601 2055 dbSNP
rs567725647 2056 dbSNP
rs1319898946 2057 dbSNP
rs1256153790 2060 dbSNP
rs939496227 2060 dbSNP
rs928131232 2062 dbSNP
rs1007783120 2069 dbSNP
rs1042639069 2070 dbSNP
rs1346284234 2071 dbSNP
rs866475702 2073 dbSNP
rs1250204193 2074 dbSNP
rs945651773 2076 dbSNP
rs375933863 2080 dbSNP
rs1435376396 2084 dbSNP
rs764970069 2088 dbSNP
rs1412049236 2090 dbSNP
rs1362678624 2103 dbSNP
rs1398729114 2107 dbSNP
rs760898543 2109 dbSNP
rs997210626 2111 dbSNP
rs1160907489 2112 dbSNP
rs752906618 2117 dbSNP
rs45460396 2120 dbSNP
rs1192436863 2126 dbSNP
rs1476805026 2128 dbSNP
rs1036649844 2132 dbSNP
rs565447765 2137 dbSNP
rs1208066838 2148 dbSNP
rs1328564002 2150 dbSNP
rs774984267 2166 dbSNP
rs376898310 2172 dbSNP
rs552004994 2173 dbSNP
rs1324226804 2178 dbSNP
rs1280743526 2179 dbSNP
rs1217557618 2180 dbSNP
rs1344560255 2182 dbSNP
rs1343669086 2188 dbSNP
rs1221141523 2191 dbSNP
rs1266363919 2193 dbSNP
rs769472607 2196 dbSNP
rs1444772191 2200 dbSNP
rs1375088121 2201 dbSNP
rs1175966975 2209 dbSNP
rs1331140287 2219 dbSNP
rs190737124 2220 dbSNP
rs1472630172 2221 dbSNP
rs1183627220 2224 dbSNP
rs992185587 2229 dbSNP
rs186022982 2231 dbSNP
rs1436468286 2236 dbSNP
rs1165074495 2239 dbSNP
rs1177588065 2241 dbSNP
rs773587298 2242 dbSNP
rs1026599421 2251 dbSNP
rs923933800 2252 dbSNP
rs1412326720 2253 dbSNP
rs1423993532 2256 dbSNP
rs1158836963 2260 dbSNP
rs886047720 2268 dbSNP
rs1350965019 2273 dbSNP
rs1378206313 2277 dbSNP
rs770078081 2278 dbSNP
rs1461666120 2280 dbSNP
rs763066417 2286 dbSNP
rs1208102588 2288 dbSNP
rs1441954225 2297 dbSNP
rs1285076403 2299 dbSNP
rs1323865264 2302 dbSNP
rs1202945123 2310 dbSNP
rs1242535394 2312 dbSNP
rs1351793299 2315 dbSNP
rs1308915358 2316 dbSNP
rs1254719832 2317 dbSNP
rs1247247260 2318 dbSNP
rs1174561507 2321 dbSNP
rs1472198947 2322 dbSNP
rs886047719 2324 dbSNP
rs1016877089 2325 dbSNP
rs1381964936 2326 dbSNP
rs1182077088 2328 dbSNP
rs773289768 2329 dbSNP
rs1445145488 2330 dbSNP
rs758935995 2330 dbSNP
rs1358022272 2331 dbSNP
rs895153117 2332 dbSNP
rs1421069738 2333 dbSNP
rs1187633796 2337 dbSNP
rs1311036413 2341 dbSNP
rs1431508481 2341 dbSNP
rs774339465 2341 dbSNP
rs1373686388 2348 dbSNP
rs1447467253 2350 dbSNP
rs1378111574 2355 dbSNP
rs768153373 2356 dbSNP
rs1445081880 2357 dbSNP
rs144786807 2358 dbSNP
rs953318556 2359 dbSNP
rs1180092715 2361 dbSNP
rs1297258011 2368 dbSNP
rs1472446004 2370 dbSNP
rs1242710503 2371 dbSNP
rs1055182475 2379 dbSNP
rs1487425399 2385 dbSNP
rs1465171942 2389 dbSNP
rs1004070247 2390 dbSNP
rs1030126489 2394 dbSNP
rs1223646440 2404 dbSNP
rs997260131 2405 dbSNP
rs1201654267 2407 dbSNP
rs1323931721 2408 dbSNP
rs1238718974 2410 dbSNP
rs1311059348 2411 dbSNP
rs1228211182 2420 dbSNP
rs1363272652 2440 dbSNP
rs1484662430 2447 dbSNP
rs906700814 2451 dbSNP
rs746582462 2452 dbSNP
rs1401366862 2453 dbSNP
rs1358222449 2454 dbSNP
rs1297239262 2461 dbSNP
rs1390526501 2463 dbSNP
rs1458197310 2466 dbSNP
rs1351368510 2470 dbSNP
rs1162441978 2471 dbSNP
rs1404642589 2474 dbSNP
rs1420215412 2475 dbSNP
rs1278650969 2476 dbSNP
rs770889913 2476 dbSNP
rs886047718 2487 dbSNP
rs1334848711 2488 dbSNP
rs1360988768 2493 dbSNP
rs1195929820 2494 dbSNP
rs114345754 2496 dbSNP
rs181429015 2497 dbSNP
rs1006275852 2500 dbSNP
rs540741879 2501 dbSNP
rs1344856293 2506 dbSNP
rs1489605887 2511 dbSNP
rs1220340042 2514 dbSNP
rs761726411 2526 dbSNP
rs1263975597 2527 dbSNP
rs1221313897 2530 dbSNP
rs1308585531 2533 dbSNP
rs1313620033 2534 dbSNP
rs1207687868 2536 dbSNP
rs1260617908 2539 dbSNP
rs1219896518 2543 dbSNP
rs1337836232 2556 dbSNP
rs1191442079 2557 dbSNP
rs1245924606 2562 dbSNP
rs191400980 2564 dbSNP
rs776052223 2575 dbSNP
rs1054056812 2577 dbSNP
rs942974483 2583 dbSNP
rs886047717 2591 dbSNP
rs910217073 2600 dbSNP
rs532303617 2604 dbSNP
rs776541325 2605 dbSNP
rs11604911 2609 dbSNP
rs768305843 2611 dbSNP
rs778743583 2613 dbSNP
rs1422962469 2620 dbSNP
rs1177250372 2621 dbSNP
rs868344 2623 dbSNP
rs1277169659 2625 dbSNP
rs1265605043 2628 dbSNP
rs1190973210 2629 dbSNP
rs919077805 2630 dbSNP
rs35881574 2632 dbSNP
rs1481185099 2634 dbSNP
rs186000715 2635 dbSNP
rs575927238 2639 dbSNP
rs774993881 2640 dbSNP
rs1012793825 2647 dbSNP
rs767908234 2649 dbSNP
rs1313588433 2652 dbSNP
rs946696184 2658 dbSNP
rs1298792204 2661 dbSNP
rs914520798 2663 dbSNP
rs1377301818 2664 dbSNP
rs771586041 2665 dbSNP
rs1333159718 2670 dbSNP
rs1003614312 2672 dbSNP
rs1435550175 2680 dbSNP
rs906642060 2681 dbSNP
rs1303486843 2685 dbSNP
rs1467706914 2688 dbSNP
rs1376098232 2693 dbSNP
rs1175677484 2698 dbSNP
rs1021065616 2704 dbSNP
rs556066397 2705 dbSNP
rs180746143 2709 dbSNP
rs567517333 2710 dbSNP
rs1390440353 2711 dbSNP
rs1406376979 2720 dbSNP
rs1177177508 2723 dbSNP
rs759849406 2725 dbSNP
rs923108090 2729 dbSNP
rs1313324843 2731 dbSNP
rs1244370032 2738 dbSNP
rs1200504124 2740 dbSNP
rs1369174864 2745 dbSNP
rs1483975588 2749 dbSNP
rs1253763602 2756 dbSNP
rs1232026663 2757 dbSNP
rs1353980820 2758 dbSNP
rs893978516 2761 dbSNP
rs1286455337 2763 dbSNP
rs1242119826 2783 dbSNP
rs77548426 2785 dbSNP
rs961809817 2790 dbSNP
rs1356766971 2791 dbSNP
rs1014651431 2794 dbSNP
rs1376055826 2795 dbSNP
rs1313399472 2796 dbSNP
rs1349913830 2807 dbSNP
rs1308917384 2813 dbSNP
rs1270643543 2814 dbSNP
rs1397832499 2816 dbSNP
rs766598745 2817 dbSNP
rs943633874 2818 dbSNP
rs1205826186 2821 dbSNP
rs1302366251 2825 dbSNP
rs1252593433 2826 dbSNP
rs1420479152 2829 dbSNP
rs1473642625 2834 dbSNP
rs1431806011 2835 dbSNP
rs36103812 2835 dbSNP
rs888784654 2838 dbSNP
rs746424733 2839 dbSNP
rs1005913807 2840 dbSNP
rs1439518740 2842 dbSNP
rs1051889476 2844 dbSNP
rs745340521 2854 dbSNP
rs1369120450 2856 dbSNP
rs1422615338 2857 dbSNP
rs1253380417 2859 dbSNP
rs189421608 2861 dbSNP
rs184808494 2862 dbSNP
rs147681157 2867 dbSNP
rs1012903143 2869 dbSNP
rs1287797502 2870 dbSNP
rs770168408 2873 dbSNP
rs886047716 2876 dbSNP
rs1352772308 2877 dbSNP
rs45584835 2879 dbSNP
rs1380096357 2881 dbSNP
rs1246846049 2884 dbSNP
rs749087787 2886 dbSNP
rs1056559031 2893 dbSNP
rs941834570 2898 dbSNP
rs776255559 2899 dbSNP
rs1342581207 2901 dbSNP
rs909085223 2902 dbSNP
rs1198736592 2903 dbSNP
rs768242897 2905 dbSNP
rs1255575415 2906 dbSNP
rs991364733 2912 dbSNP
rs902636331 2915 dbSNP
rs570654511 2918 dbSNP
rs1456789320 2919 dbSNP
rs1449292471 2921 dbSNP
rs1368451875 2922 dbSNP
rs1044182885 2923 dbSNP
rs1477884621 2925 dbSNP
rs1033674005 2929 dbSNP
rs779486807 2931 dbSNP
rs1190988215 2932 dbSNP
rs757631990 2939 dbSNP
rs1402341270 2943 dbSNP
rs76776242 2952 dbSNP
rs931889454 2954 dbSNP
rs1211480003 2955 dbSNP
rs1354165410 2956 dbSNP
rs923160677 2959 dbSNP
rs1219307028 2960 dbSNP
rs778782137 2962 dbSNP
rs757060082 2964 dbSNP
rs753517628 2966 dbSNP
rs777713017 2967 dbSNP
rs1325924394 2969 dbSNP
rs1385518199 2974 dbSNP
rs369720674 2977 dbSNP
rs1172076513 2981 dbSNP
rs1467661046 2990 dbSNP
rs1425095684 2991 dbSNP
rs1167919337 3001 dbSNP
rs961859002 3002 dbSNP
rs751855090 3004 dbSNP
rs1246995814 3005 dbSNP
rs773018303 3006 dbSNP
rs766545392 3007 dbSNP
rs1252175554 3012 dbSNP
rs907648994 3013 dbSNP
rs1319920957 3014 dbSNP
rs796130915 3015 dbSNP
rs1214121245 3018 dbSNP
rs71482130 3021 dbSNP
rs751817814 3028 dbSNP
rs1276870848 3033 dbSNP
rs1231496927 3036 dbSNP
rs1330836706 3037 dbSNP
rs1332496124 3040 dbSNP
rs758448339 3041 dbSNP
rs181830786 3042 dbSNP
rs1250301907 3045 dbSNP
rs1328685754 3051 dbSNP
rs765726311 3052 dbSNP
rs3741315 3054 dbSNP
rs1173923898 3055 dbSNP
rs1476855035 3058 dbSNP
rs1394180632 3059 dbSNP
rs776916884 3061 dbSNP
rs960961583 3062 dbSNP
rs1459026068 3067 dbSNP
rs373096657 3068 dbSNP
rs1236351623 3073 dbSNP
rs1203868582 3075 dbSNP
rs764462049 3076 dbSNP
rs1280853313 3078 dbSNP
rs1198901474 3081 dbSNP
rs1347430984 3084 dbSNP
rs1289023010 3086 dbSNP
rs527376189 3088 dbSNP
rs1242838090 3090 dbSNP
rs1375291380 3099 dbSNP
rs999673828 3103 dbSNP
rs1457454791 3109 dbSNP
rs1309239088 3110 dbSNP
rs889393963 3115 dbSNP
rs564684785 3116 dbSNP
rs555338665 3117 dbSNP
rs1335633406 3122 dbSNP
rs1412347177 3127 dbSNP
rs775158632 3129 dbSNP
rs1159024340 3132 dbSNP
rs771603355 3140 dbSNP
rs745426856 3141 dbSNP
rs1225499369 3142 dbSNP
rs1176499365 3152 dbSNP
rs1473100965 3160 dbSNP
rs1328676173 3166 dbSNP
rs1239213927 3170 dbSNP
rs1208126862 3172 dbSNP
rs1262837069 3183 dbSNP
rs773924190 3190 dbSNP
rs1036062851 3191 dbSNP
rs1287092305 3196 dbSNP
rs1166861888 3199 dbSNP
rs1455542485 3204 dbSNP
rs765388822 3205 dbSNP
rs1219222022 3206 dbSNP
rs1351902482 3209 dbSNP
rs1159185004 3211 dbSNP
rs909032861 3214 dbSNP
rs544783074 3222 dbSNP
rs552403681 3226 dbSNP
rs1285438938 3230 dbSNP
rs1412460385 3238 dbSNP
rs556337578 3239 dbSNP
rs1354394083 3244 dbSNP
rs752850883 3246 dbSNP
rs928521384 3249 dbSNP
rs1392705225 3254 dbSNP
rs1421157275 3257 dbSNP
rs1358342644 3259 dbSNP
rs907692985 3278 dbSNP
rs145392070 3279 dbSNP
rs1349997195 3281 dbSNP
rs573880907 3289 dbSNP
rs756022607 3290 dbSNP
rs1474950633 3298 dbSNP
rs1264026606 3301 dbSNP
rs1196066036 3303 dbSNP
rs930389846 3313 dbSNP
rs878872603 3323 dbSNP
rs1487433650 3328 dbSNP
rs1320290700 3333 dbSNP
rs1241837224 3334 dbSNP
rs1222850484 3335 dbSNP
rs1324028231 3338 dbSNP
rs3741314 3345 dbSNP
rs1230898882 3349 dbSNP
rs1490970385 3354 dbSNP
rs1333458462 3368 dbSNP
rs1278308762 3377 dbSNP
rs1268861171 3378 dbSNP
rs1230370777 3385 dbSNP
rs1401385295 3387 dbSNP
rs1359444850 3409 dbSNP
rs144175127 3418 dbSNP
rs1178562643 3419 dbSNP
rs1437011290 3421 dbSNP
rs916307243 3424 dbSNP
rs1165143697 3425 dbSNP
rs144581767 3427 dbSNP
rs747204590 3427 dbSNP
rs958131328 3434 dbSNP
rs764008407 3435 dbSNP
rs1370018872 3438 dbSNP
rs1008111788 3450 dbSNP
rs1424341237 3451 dbSNP
rs960346613 3456 dbSNP
rs1172930073 3465 dbSNP
rs1377176212 3473 dbSNP
rs571751141 3475 dbSNP
rs1362088648 3481 dbSNP
rs865908705 3483 dbSNP
rs558321409 3487 dbSNP
rs1489698404 3493 dbSNP
rs760330337 3497 dbSNP
rs538359069 3499 dbSNP
rs1368081398 3502 dbSNP
rs1458607345 3511 dbSNP
rs780493934 3513 dbSNP
rs1219998899 3514 dbSNP
rs1030966393 3517 dbSNP
rs1305397664 3521 dbSNP
rs189095430 3529 dbSNP
rs1244726785 3530 dbSNP
rs569447551 3534 dbSNP
rs997813165 3544 dbSNP
rs758495836 3546 dbSNP
rs750414730 3548 dbSNP
rs149963368 3549 dbSNP
rs1323653820 3550 dbSNP
rs1440006122 3551 dbSNP
rs775214233 3559 dbSNP
rs1333445561 3560 dbSNP
rs1005915079 3566 dbSNP
rs1460567272 3567 dbSNP
rs757652773 3573 dbSNP
rs1447531865 3576 dbSNP
rs1375405863 3578 dbSNP
rs1241485506 3579 dbSNP
rs887501791 3580 dbSNP
rs1176993447 3583 dbSNP
rs1435159429 3584 dbSNP
rs1055568607 3585 dbSNP
rs1193415584 3588 dbSNP
rs1385418348 3589 dbSNP
rs1433433217 3603 dbSNP
rs1440833115 3606 dbSNP
rs1240643877 3609 dbSNP
rs569520041 3612 dbSNP
rs1479399319 3613 dbSNP
rs937133222 3620 dbSNP
rs1250302514 3627 dbSNP
rs886047715 3633 dbSNP
rs1210303103 3640 dbSNP
rs1313603301 3650 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PG