miRTarBase - #MIRT023319 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ANKRD13C   
Synonyms dJ677H15.3
Description ankyrin repeat domain 13C
Transcript NM_030816   
Expression
Putative miRNA Targets on ANKRD13C
3'UTR of ANKRD13C
(miRNA target sites are highlighted)
>ANKRD13C|NM_030816|3'UTR
   1 CTGACGTGGAAAAGGATGCCGTCTAACCAAGGAAAGAAAATACAGAGACCCTAGAAGTGGATCCAAATAGAAGGGACAAA
  81 TGCTTTCAGTGAAGAAAAGGGAATTACACATTGAATCGACACATCAGTAATACGATACAGTGAAATGGGCCTCTAATAAG
 161 AATTTCAGCGAGTTTTCTGATGTGCCATTTTTTGTCTTTTTAAAAATATACATATTATAAATGTAATAGTTTGACACATT
 241 AATGACCCTAAGACCTGCGTATGTGAAGCAGCTATGAGTGCTGTGATTTGTTTTTAAAAATTTTTACACTTCTTGTTGAA
 321 ATATATATGCATATAAATATATCTATATCTATATCTATATCTAAAACACTCCTGGACCATTAACGTAAATTAAATGTCTT
 401 AAGAGATATGGAGCCCTTTTAAACTTGTCATCTTTATGCAAGGTGACATTTATAAATATTCCTTCGAGCTTTGTTTTCAT
 481 AAAATGTAAACTATGTAACATTATGTATAGTTCAGTAATTTGAATGTTTGTTCAATATAATGAACTAGAAGGAATGCAAT
 561 TTTCTGTAGATGAATGAACCAAATGGTAACCATTAAACAATTGCATTTATATGTTGCAATACATTTCAGAAGGAGCGTTC
 641 ACTCTGCAGGGAATAAGGTACCTCCTTTAGCACCTTAGTGCAATTCATTGTGGTGCTATTTGTTTTTACCTGAATGTTTG
 721 TTACTAATCTTCCTTTCATAGAACCTCTATTTTTTTTTTTTCTAAACTTGAGTTTGAGTCCTTGTTATGGTCATCATAAG
 801 GTAATGGTTAGCATGTTTAAAGATATTCCTCTTCCAAATCTCAGCACTTTAAAAAAAAATCCAAATTTTTAAACTTGCTT
 881 CCTAATAAGTACACATCGGTCTGATTATTTTGTTTGTTTTTAGTAGAATATGGATGCATTGGTGTCAGTTTTAAAAAACA
 961 ATACACATATTTTGGACAACCCTACATATTTAATCCTTTCAAAATAAGATAAAAACATTTTATATGCTAACAGAATATAT
1041 TTGTTACAAGTTAAAGTCCAGAAGTATACACAAGATTGATTACTCCTATTATTTTTTTTAAATCACAGGAAAATATTGAT
1121 TTCATTGTCTCCAAAGTGATAAAATCATGTATTACTCATTTTTGCACTTAAAATTTTTCTTATTTATTCCAAGGTGGTTT
1201 GAAGGTCCAAGTATGAAAATAAATTAGGGGGATTAATGTATAACAGTTATAAAGTATCATGTTGTATTAAAGAGCTTACT
1281 TAGATTGATGTTTTTAAAATGTATCCTGATGAATGTCTCAAGAATGCATCTGTCAAGTTTTTTAGACTGACCAGTAGCTT
1361 AAACTTTTTTCAGGATTTTAGGTAATTTGAAAGGAGTTTAGAGACCCTTATTGAAAATATGATTTAAAAATCCAAAGCAT
1441 AAACCGTAAGAAAAATTTTAAATAAACATCTTTAAAGCTGCATCTTCCATACTGATACATGCATTGCGTATGTTGACATT
1521 AAATACATTTTATAATGAAGAAAAATAATCATAGTAAAAAATTGAAAGACCTAATTACTACGTTACATGGACCTATTGAA
1601 TTTTGGGGGAACGTGTTAGTAAACCCAGACTAGCTTTGTTGAATAGAAGTTGATCGCTGTTATTTAGGAAATGGGTAGAT
1681 CAAATGACTTAGAGACTGAATTATCCTATCAGTGGTTACATGGGGTTGGAGACACTGAAAGGCAGTGATCACTGTTGCTT
1761 CTAGGCTCCCTTACTTTGTAGGAATATGGTATACTTTCAGGAATATGCTATATATGTTTTCATAAGTACAGACACCTTAG
1841 GGAAGAAAAAAAGTGGGTAATTGAAGCTTATGGTTGATTAATTTCCTAACAGCACAGCTATGAATATTTTGCTGGGGTAC
1921 ACTGGAGGTAGGAAGACTACTGGAAATTTTTGCACTTGAATTTTGTTTTTAAAGCTTTTTTCTTTAAAGAATGGTAGAAA
2001 CAGATTATCCATTCCAAAATGTCTTTTCTCTGATCACAAAGAGCAAACAAATGTCAATATCTCTTATGATGGTGAAAAAA
2081 AGGAATTAATCGATGCAAATAAACTTTTCACAGTATTACTTTTAATGAAGATTTTTCGAAATGTGCCTTTTAATCCAGTT
2161 AATGAATGAAGCTATATGCAGTGTTTCAAATGAATAAGTCAAAACACCATATGTTTTCATAATACCACATGAAAAATCAA
2241 GATTTTGCAATGTAGGTACACAAAATTCTATATGTTCTTCTCCATTTGTGATTTTGAAACTGTTTAAATTGGTAGGGGGA
2321 CAATCGTATAGTCATCTTCAATAGCCATTTAGAAATGGTTAATATTCTTGCCCACTGGTATGGTATCCAGAGAAGATATG
2401 GTTTCCATCTTTGAGAAAATAATTCTCTGATGAGACAATTTGCCCTCTGTAGATATTCACATACAGAGAATTGCCAAACT
2481 TCATAAAAGGGTAGTATGAAGTAGATGCCCTGATTTTTGTGAGTATAAGAAGTACAGATGATGGTTTGGAAACTGTCACA
2561 TCTGTCTGCTGATACATGTTAGTAGATGAAAAACTGTTTCCTTCTGCTCAGAACTGGAATTAAGCCCCACTCATGCTAAT
2641 AAAAATGGGTTTTTATAGTAGTATTCACATACAGTTTATTATTCACACACTGGGGGAGGGTGATGAATAATGATTATTTA
2721 ATGAGCCCTCTTCCTAGTTTTCCCTAAGTCTGCAGAAGACAAAGATCCTGTTTCCAGGCCATGAAAGGACTGAAGTAAAT
2801 ATTGTAAATAAGTACAGCTGACCCTTGAACAACATGGAGGTTAGGGGTTCAGTTGAAAATCTGCATGTAAGTGGACCTGT
2881 GCAGTCCAAACCTGTGTTTAACTGCTGAATTAAAGGTGCTTCCTTCTGCTCATTGATATTACCCATATTTACAAACATGC
2961 TAGAGAAAAGCAACTGGTGTAAAACTTGCCCCCACTAGAGAAATGGACAGGAGGTATTAAGTCACTTGTAAAGATAGATA
3041 GCAGAACTAAGCTTGGTAAAAGCCCATGATTGTTTGTATACTATAAATTAGCCAAAACTACTCTTGCAAAGCATTTTATG
3121 TCAGAAATCTGGGGCAATAGTAACTAACTCTGGTTGCCACCTAAAAATTTCATAACATGTTAAGAATCACATTTTTTACA
3201 TCATGCAAACCATCCTTACAGAGTGAGCTTACCTTGTGATGAGCTTTTTAATTGTTACAGTTCATTTTAGAAGAGTAATA
3281 CTTTCAGTCATAATGGTACCTATGGTACATAGAATTACAATTTTGCTTTTTCCACACACTGAAAAATATTGAAGCAAAAT
3361 CTTAAGAACTTCTAAGAAAGGTGCTTGTTAATCATTCTTGGTTTTCATCATGTTTTGCGGTGAAAATGACTTTAATTAGA
3441 GTAGAAATATTGTCTAACATAAAACCAAAAAGATAAAACCCACCACTTATTTACCTGTACCTCCCATACATAGAGTTCTT
3521 GATGACTAAAGAAGGATGACAGTAATTGGGATGTTCTAAATACAGTTGTGTGTCACTTAATGATGGGTACATGTTCTGTG
3601 GAATGCATCAGGTGATTTTGTCATTGTGAGAACCATATTGGGTGTACTTACACAAACCTAGGTGGTATAGCATACCACTC
3681 ACCTAGACTATACAATAAAGCCTATTGCTCCGAGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAG----UGUGAGGu 5'
             |:|:|  | ||    ||||||| 
Target 5' tctATATCTATATCTAAAACACTCCt 3'
348 - 373 149.00 -12.70
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |  ||| |:|||||:| 
Target 5' ttAAAA--ATTTTTACACTTCt 3'
294 - 313 144.00 -9.60
3
miRNA  3' guuuGUGGUAACAGUGUGAggu 5'
              :|::|||  ||||||   
Target 5' agttTATTATTCACACACTggg 3'
2673 - 2694 122.00 -8.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30500439 5 COSMIC
COSN31511984 15 COSMIC
COSN30107106 28 COSMIC
COSN30503579 31 COSMIC
COSN30122934 47 COSMIC
COSN21066819 63 COSMIC
COSN30474273 63 COSMIC
COSN30162202 81 COSMIC
COSN30524029 89 COSMIC
COSN31501531 101 COSMIC
COSN1107758 106 COSMIC
COSN20884375 117 COSMIC
COSN30128522 133 COSMIC
COSN30181731 182 COSMIC
COSN21436324 311 COSMIC
COSN31594764 462 COSMIC
COSN31571318 502 COSMIC
COSN31524429 637 COSMIC
COSN27191672 749 COSMIC
COSN27450299 750 COSMIC
COSN24936527 782 COSMIC
COSN31515683 897 COSMIC
COSN8638648 903 COSMIC
COSN30159390 1000 COSMIC
COSN15949177 1290 COSMIC
COSN10052521 1554 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201846288 1 dbSNP
rs776272602 3 dbSNP
rs762387724 5 dbSNP
rs752185926 6 dbSNP
rs1018716021 8 dbSNP
rs1380677152 12 dbSNP
rs1302961950 14 dbSNP
rs373023045 20 dbSNP
rs144692308 21 dbSNP
rs770708322 29 dbSNP
rs1421908650 30 dbSNP
rs760579328 31 dbSNP
rs1163163163 42 dbSNP
rs1443067315 44 dbSNP
rs1405980124 45 dbSNP
rs1243763966 46 dbSNP
rs774649052 49 dbSNP
rs769013620 51 dbSNP
rs1322110993 59 dbSNP
rs1216403030 67 dbSNP
rs1273816010 74 dbSNP
rs1029471930 84 dbSNP
rs998021836 97 dbSNP
rs1202717928 101 dbSNP
rs1270724052 109 dbSNP
rs1490442811 117 dbSNP
rs1248003435 118 dbSNP
rs574444778 121 dbSNP
rs897896825 133 dbSNP
rs1036343686 134 dbSNP
rs182339214 135 dbSNP
rs994499380 151 dbSNP
rs887746068 152 dbSNP
rs535296489 154 dbSNP
rs1365864034 156 dbSNP
rs1425676930 165 dbSNP
rs948307020 169 dbSNP
rs572676210 170 dbSNP
rs1056624435 174 dbSNP
rs114495835 179 dbSNP
rs1331732959 185 dbSNP
rs1289367973 187 dbSNP
rs1212921334 189 dbSNP
rs1223481782 194 dbSNP
rs758242879 207 dbSNP
rs538884117 208 dbSNP
rs1289329336 214 dbSNP
rs1045834345 221 dbSNP
rs950202430 222 dbSNP
rs1474127315 238 dbSNP
rs913303723 253 dbSNP
rs910848828 258 dbSNP
rs569809782 259 dbSNP
rs1053564023 260 dbSNP
rs752489504 263 dbSNP
rs528032194 266 dbSNP
rs1364128327 268 dbSNP
rs116372318 275 dbSNP
rs974959627 286 dbSNP
rs1345171990 302 dbSNP
rs112507002 309 dbSNP
rs1014971518 313 dbSNP
rs536364845 321 dbSNP
rs912039251 333 dbSNP
rs987635774 336 dbSNP
rs950549025 337 dbSNP
rs192238287 341 dbSNP
rs1427220800 344 dbSNP
rs1205550609 351 dbSNP
rs1283456450 353 dbSNP
rs1445277307 359 dbSNP
rs887798237 359 dbSNP
rs1243229123 362 dbSNP
rs1181407436 364 dbSNP
rs552158813 364 dbSNP
rs748877595 364 dbSNP
rs1191635692 379 dbSNP
rs1471350571 381 dbSNP
rs760209069 384 dbSNP
rs547502874 385 dbSNP
rs1456117951 389 dbSNP
rs1210278436 390 dbSNP
rs962974386 395 dbSNP
rs1406964585 405 dbSNP
rs1452057347 410 dbSNP
rs1465042687 424 dbSNP
rs1334942607 427 dbSNP
rs1269215140 429 dbSNP
rs1203456925 435 dbSNP
rs1057075006 436 dbSNP
rs1278742394 438 dbSNP
rs1033565141 443 dbSNP
rs77435924 448 dbSNP
rs1304050298 452 dbSNP
rs1225293461 457 dbSNP
rs906441965 465 dbSNP
rs1201287315 466 dbSNP
rs1361428304 467 dbSNP
rs1252217595 475 dbSNP
rs1438114313 493 dbSNP
rs559429420 494 dbSNP
rs754816676 498 dbSNP
rs1471868909 500 dbSNP
rs1268463973 505 dbSNP
rs1046688450 507 dbSNP
rs370331975 526 dbSNP
rs1043497924 535 dbSNP
rs1170960224 538 dbSNP
rs1398820738 558 dbSNP
rs1009396190 559 dbSNP
rs1389693957 560 dbSNP
rs891915125 569 dbSNP
rs910901286 570 dbSNP
rs772605231 580 dbSNP
rs1468042898 583 dbSNP
rs985130141 586 dbSNP
rs1360626553 587 dbSNP
rs1176780686 588 dbSNP
rs1427847519 592 dbSNP
rs1416818770 595 dbSNP
rs1189912117 600 dbSNP
rs78850336 601 dbSNP
rs1339593076 603 dbSNP
rs922541006 609 dbSNP
rs1181296028 615 dbSNP
rs532298399 617 dbSNP
rs563483517 622 dbSNP
rs1039323854 626 dbSNP
rs1270225745 628 dbSNP
rs1016700572 632 dbSNP
rs1211491342 633 dbSNP
rs1374882704 636 dbSNP
rs1167529917 637 dbSNP
rs1369004668 670 dbSNP
rs984853421 678 dbSNP
rs767160513 682 dbSNP
rs912131737 701 dbSNP
rs1253204079 702 dbSNP
rs1273053176 714 dbSNP
rs1385022235 716 dbSNP
rs1297037263 718 dbSNP
rs1326536428 721 dbSNP
rs988077857 724 dbSNP
rs1249247044 731 dbSNP
rs1024082391 738 dbSNP
rs929486848 740 dbSNP
rs1450708410 742 dbSNP
rs1381161985 743 dbSNP
rs896766277 744 dbSNP
rs79544665 749 dbSNP
rs79336526 750 dbSNP
rs1352709279 755 dbSNP
rs1035287948 762 dbSNP
rs1196824917 762 dbSNP
rs1388547961 762 dbSNP
rs1446679566 763 dbSNP
rs1163920061 764 dbSNP
rs1000145240 766 dbSNP
rs1456293627 772 dbSNP
rs902699370 776 dbSNP
rs1385653510 805 dbSNP
rs1043886404 813 dbSNP
rs1294769605 823 dbSNP
rs1429827889 824 dbSNP
rs946477466 828 dbSNP
rs919003823 829 dbSNP
rs1316116355 838 dbSNP
rs1181428696 842 dbSNP
rs765839290 847 dbSNP
rs1219894243 851 dbSNP
rs1263010169 857 dbSNP
rs200510571 860 dbSNP
rs933662492 860 dbSNP
rs1425178570 863 dbSNP
rs973141817 864 dbSNP
rs963027819 866 dbSNP
rs1246279846 870 dbSNP
rs1182831836 878 dbSNP
rs543507260 879 dbSNP
rs574469596 881 dbSNP
rs1384891893 892 dbSNP
rs922223001 897 dbSNP
rs972695230 898 dbSNP
rs1207845306 905 dbSNP
rs1452982023 910 dbSNP
rs1343036610 920 dbSNP
rs1452776649 920 dbSNP
rs560914668 928 dbSNP
rs1291129150 942 dbSNP
rs1033329644 959 dbSNP
rs1335644392 971 dbSNP
rs1242935846 980 dbSNP
rs1323706559 981 dbSNP
rs1226965381 982 dbSNP
rs540703678 984 dbSNP
rs1313645049 985 dbSNP
rs1228344891 990 dbSNP
rs1390635574 993 dbSNP
rs980392173 995 dbSNP
rs1309785947 1000 dbSNP
rs970653704 1002 dbSNP
rs1024889987 1007 dbSNP
rs1204451561 1011 dbSNP
rs909748507 1017 dbSNP
rs1482400906 1022 dbSNP
rs879802871 1026 dbSNP
rs892266886 1032 dbSNP
rs1161111544 1035 dbSNP
rs1458952068 1038 dbSNP
rs1032188852 1043 dbSNP
rs1000260112 1047 dbSNP
rs1023713632 1051 dbSNP
rs1418879921 1056 dbSNP
rs187397681 1057 dbSNP
rs530810639 1060 dbSNP
rs559030923 1070 dbSNP
rs1185062143 1071 dbSNP
rs1039080147 1083 dbSNP
rs1300215585 1088 dbSNP
rs1374550570 1091 dbSNP
rs563468519 1092 dbSNP
rs1286979944 1093 dbSNP
rs538958449 1098 dbSNP
rs1035407918 1099 dbSNP
rs1208154145 1100 dbSNP
rs943342441 1106 dbSNP
rs1310612643 1108 dbSNP
rs999790326 1116 dbSNP
rs902751831 1124 dbSNP
rs890739660 1133 dbSNP
rs761390781 1149 dbSNP
rs1474974455 1156 dbSNP
rs1011076344 1157 dbSNP
rs1480728039 1179 dbSNP
rs1197998194 1190 dbSNP
rs1422476267 1192 dbSNP
rs1411258906 1213 dbSNP
rs1170672917 1214 dbSNP
rs889567103 1227 dbSNP
rs374459982 1230 dbSNP
rs1306566755 1233 dbSNP
rs1347873389 1238 dbSNP
rs775899278 1241 dbSNP
rs766242062 1249 dbSNP
rs1274287374 1250 dbSNP
rs376709483 1252 dbSNP
rs1216448672 1266 dbSNP
rs1273954339 1272 dbSNP
rs1341808105 1273 dbSNP
rs1202684096 1274 dbSNP
rs1037092595 1278 dbSNP
rs2068176 1280 dbSNP
rs973145500 1284 dbSNP
rs941813477 1292 dbSNP
rs909802643 1301 dbSNP
rs1476096454 1309 dbSNP
rs1390752463 1312 dbSNP
rs1287988712 1315 dbSNP
rs1451176159 1319 dbSNP
rs1410271120 1328 dbSNP
rs1447297861 1334 dbSNP
rs926367687 1354 dbSNP
rs181715535 1371 dbSNP
rs763305582 1373 dbSNP
rs1473093512 1376 dbSNP
rs1025321568 1380 dbSNP
rs1429236053 1383 dbSNP
rs1323448689 1386 dbSNP
rs1348701586 1398 dbSNP
rs1197286788 1403 dbSNP
rs988048003 1406 dbSNP
rs915692421 1410 dbSNP
rs956767315 1411 dbSNP
rs191721565 1412 dbSNP
rs1434990281 1417 dbSNP
rs777178664 1422 dbSNP
rs1364658398 1425 dbSNP
rs775648704 1437 dbSNP
rs1000684565 1439 dbSNP
rs1359849512 1442 dbSNP
rs1227581607 1444 dbSNP
rs1463686709 1445 dbSNP
rs529960358 1446 dbSNP
rs1017697817 1448 dbSNP
rs1270197911 1469 dbSNP
rs1246903958 1478 dbSNP
rs961044152 1481 dbSNP
rs1185016279 1482 dbSNP
rs1385528098 1484 dbSNP
rs567689392 1487 dbSNP
rs928014752 1489 dbSNP
rs1273020970 1492 dbSNP
rs1402969682 1494 dbSNP
rs1007566285 1506 dbSNP
rs1331252273 1507 dbSNP
rs890426646 1508 dbSNP
rs1338921797 1510 dbSNP
rs1383879465 1513 dbSNP
rs1045836 1514 dbSNP
rs1447011690 1515 dbSNP
rs1022546955 1518 dbSNP
rs1052459254 1527 dbSNP
rs1282226162 1532 dbSNP
rs1352690924 1534 dbSNP
rs1224301125 1535 dbSNP
rs1267469864 1536 dbSNP
rs1011128604 1538 dbSNP
rs1432516516 1553 dbSNP
rs761237110 1572 dbSNP
rs547761538 1577 dbSNP
rs954256270 1581 dbSNP
rs533985531 1582 dbSNP
rs1243370354 1584 dbSNP
rs1441487912 1589 dbSNP
rs1187215439 1595 dbSNP
rs156107 1603 dbSNP
rs1471421744 1605 dbSNP
rs770205508 1612 dbSNP
rs552459423 1613 dbSNP
rs1455700373 1618 dbSNP
rs997976689 1624 dbSNP
rs900901173 1634 dbSNP
rs1395692433 1639 dbSNP
rs1037868334 1643 dbSNP
rs1331906952 1650 dbSNP
rs1458096448 1655 dbSNP
rs1442716009 1659 dbSNP
rs746311039 1671 dbSNP
rs1284191337 1677 dbSNP
rs1287630935 1692 dbSNP
rs1401865482 1697 dbSNP
rs1348626390 1699 dbSNP
rs1224739719 1705 dbSNP
rs1171397926 1707 dbSNP
rs559835825 1708 dbSNP
rs1198407283 1711 dbSNP
rs1468024758 1712 dbSNP
rs926379164 1715 dbSNP
rs530764467 1722 dbSNP
rs532463539 1725 dbSNP
rs771440958 1726 dbSNP
rs139952550 1732 dbSNP
rs1471899920 1737 dbSNP
rs1201621614 1751 dbSNP
rs146031924 1759 dbSNP
rs1250141573 1760 dbSNP
rs988197040 1765 dbSNP
rs1465642331 1766 dbSNP
rs1171014726 1777 dbSNP
rs956676219 1778 dbSNP
rs1430157393 1782 dbSNP
rs185923282 1789 dbSNP
rs1189391488 1791 dbSNP
rs1368565318 1801 dbSNP
rs1460751634 1812 dbSNP
rs1057352764 1814 dbSNP
rs1276244786 1815 dbSNP
rs1329974381 1816 dbSNP
rs1230504565 1833 dbSNP
rs925180331 1837 dbSNP
rs181092313 1841 dbSNP
rs1339739694 1852 dbSNP
rs1206234049 1861 dbSNP
rs1183652930 1866 dbSNP
rs963830739 1868 dbSNP
rs1274389849 1871 dbSNP
rs541544995 1874 dbSNP
rs142561130 1886 dbSNP
rs188557539 1893 dbSNP
rs1432652703 1897 dbSNP
rs545271291 1900 dbSNP
rs750368739 1901 dbSNP
rs1450336703 1911 dbSNP
rs1451439881 1913 dbSNP
rs1340314760 1916 dbSNP
rs1167679365 1917 dbSNP
rs954428122 1926 dbSNP
rs1332572966 1938 dbSNP
rs576358087 1953 dbSNP
rs898116371 1958 dbSNP
rs1294020799 1959 dbSNP
rs138073712 1975 dbSNP
rs965193476 1976 dbSNP
rs1037879508 1977 dbSNP
rs1168433686 1982 dbSNP
rs1427919916 1991 dbSNP
rs1015306891 1994 dbSNP
rs1003881510 1996 dbSNP
rs1294996767 2013 dbSNP
rs1340450161 2018 dbSNP
rs1006354624 2019 dbSNP
rs747130972 2022 dbSNP
rs1488440699 2023 dbSNP
rs1208076999 2035 dbSNP
rs1263968300 2053 dbSNP
rs79679858 2057 dbSNP
rs1235575533 2059 dbSNP
rs1012862046 2063 dbSNP
rs1388607920 2067 dbSNP
rs949189522 2068 dbSNP
rs758757353 2073 dbSNP
rs1057003201 2075 dbSNP
rs374685278 2082 dbSNP
rs1456343119 2085 dbSNP
rs902984246 2091 dbSNP
rs1388686645 2092 dbSNP
rs917647606 2092 dbSNP
rs574076722 2094 dbSNP
rs1384622480 2098 dbSNP
rs915274503 2103 dbSNP
rs1343744913 2104 dbSNP
rs1274724238 2110 dbSNP
rs989464342 2113 dbSNP
rs934986735 2114 dbSNP
rs1329912627 2120 dbSNP
rs1208257234 2124 dbSNP
rs1246418330 2125 dbSNP
rs1462829484 2127 dbSNP
rs558933460 2137 dbSNP
rs553930082 2138 dbSNP
rs1421876185 2152 dbSNP
rs1161171788 2154 dbSNP
rs534310001 2156 dbSNP
rs1456244699 2166 dbSNP
rs1156317580 2174 dbSNP
rs1407765692 2175 dbSNP
rs1466248415 2179 dbSNP
rs1285539444 2181 dbSNP
rs1015693103 2194 dbSNP
rs979308363 2209 dbSNP
rs1290744477 2213 dbSNP
rs778526400 2217 dbSNP
rs543482214 2223 dbSNP
rs1341387498 2227 dbSNP
rs1308025255 2229 dbSNP
rs571515885 2250 dbSNP
rs911033690 2256 dbSNP
rs576660617 2270 dbSNP
rs1255677078 2274 dbSNP
rs987019488 2280 dbSNP
rs1308695430 2295 dbSNP
rs372275993 2304 dbSNP
rs1411941372 2305 dbSNP
rs1472230181 2313 dbSNP
rs78766562 2314 dbSNP
rs753690960 2318 dbSNP
rs150320192 2319 dbSNP
rs1174892021 2321 dbSNP
rs1180004103 2322 dbSNP
rs972094110 2325 dbSNP
rs1310243695 2326 dbSNP
rs538911534 2331 dbSNP
rs1371650554 2341 dbSNP
rs1036023347 2342 dbSNP
rs551617619 2343 dbSNP
rs549989794 2365 dbSNP
rs1016485632 2371 dbSNP
rs1369788074 2375 dbSNP
rs1219946259 2378 dbSNP
rs1006407145 2380 dbSNP
rs1300841567 2391 dbSNP
rs1041560375 2395 dbSNP
rs1206952397 2398 dbSNP
rs905436876 2399 dbSNP
rs529890821 2401 dbSNP
rs183593096 2404 dbSNP
rs1228522961 2414 dbSNP
rs547145422 2421 dbSNP
rs896273351 2422 dbSNP
rs1190201652 2424 dbSNP
rs527406493 2425 dbSNP
rs932653158 2430 dbSNP
rs921236999 2432 dbSNP
rs1391204716 2434 dbSNP
rs1352891415 2438 dbSNP
rs1429561178 2443 dbSNP
rs1309129932 2449 dbSNP
rs1352185137 2450 dbSNP
rs536444402 2456 dbSNP
rs903490568 2461 dbSNP
rs750004026 2464 dbSNP
rs1325839366 2467 dbSNP
rs1230925281 2477 dbSNP
rs1406163889 2486 dbSNP
rs942616631 2489 dbSNP
rs777853062 2492 dbSNP
rs1387684749 2496 dbSNP
rs1225979499 2502 dbSNP
rs1291935561 2519 dbSNP
rs544641174 2522 dbSNP
rs1220111691 2525 dbSNP
rs911128863 2527 dbSNP
rs1465944342 2533 dbSNP
rs1188771545 2538 dbSNP
rs1247090622 2540 dbSNP
rs1449236491 2542 dbSNP
rs531874986 2543 dbSNP
rs1166521040 2551 dbSNP
rs986690528 2554 dbSNP
rs1412658262 2557 dbSNP
rs1406479452 2558 dbSNP
rs1164119072 2564 dbSNP
rs1348168866 2570 dbSNP
rs562892554 2572 dbSNP
rs376003856 2576 dbSNP
rs908742058 2586 dbSNP
rs1484228469 2588 dbSNP
rs933779473 2591 dbSNP
rs78530747 2592 dbSNP
rs1231100153 2594 dbSNP
rs1265802396 2614 dbSNP
rs1026681730 2627 dbSNP
rs767020282 2647 dbSNP
rs761312902 2648 dbSNP
rs1330580170 2652 dbSNP
rs1208879023 2655 dbSNP
rs962039217 2655 dbSNP
rs991219562 2661 dbSNP
rs778846516 2668 dbSNP
rs1016244714 2670 dbSNP
rs543309772 2671 dbSNP
rs774074704 2672 dbSNP
rs1239612308 2686 dbSNP
rs548847372 2688 dbSNP
rs765478383 2690 dbSNP
rs34812754 2697 dbSNP
rs755507533 2701 dbSNP
rs1181767959 2702 dbSNP
rs1035338657 2705 dbSNP
rs759981702 2714 dbSNP
rs1458885157 2725 dbSNP
rs896610827 2730 dbSNP
rs375461765 2743 dbSNP
rs1365659704 2754 dbSNP
rs1276655554 2761 dbSNP
rs1437517754 2764 dbSNP
rs1282350236 2781 dbSNP
rs1352256291 2788 dbSNP
rs903084191 2790 dbSNP
rs1266959587 2808 dbSNP
rs540339741 2829 dbSNP
rs999251251 2830 dbSNP
rs1201785266 2838 dbSNP
rs1020169667 2845 dbSNP
rs903586915 2865 dbSNP
rs1209941473 2869 dbSNP
rs771620518 2887 dbSNP
rs942335665 2890 dbSNP
rs1473865959 2897 dbSNP
rs552610332 2900 dbSNP
rs760830356 2901 dbSNP
rs578162604 2904 dbSNP
rs1411371389 2911 dbSNP
rs1054284536 2916 dbSNP
rs143009859 2924 dbSNP
rs933853847 2928 dbSNP
rs899846046 2931 dbSNP
rs918393917 2936 dbSNP
rs944314320 2939 dbSNP
rs577277468 2940 dbSNP
rs1047251955 2942 dbSNP
rs181070333 2945 dbSNP
rs1348062278 2946 dbSNP
rs1234855783 2947 dbSNP
rs1426724923 2955 dbSNP
rs1191294508 2963 dbSNP
rs1343861904 2965 dbSNP
rs1448310967 2970 dbSNP
rs1245825215 2980 dbSNP
rs920065725 2989 dbSNP
rs1190038445 2991 dbSNP
rs909295418 2993 dbSNP
rs1206462191 2994 dbSNP
rs1251794400 3000 dbSNP
rs984792489 3002 dbSNP
rs1436142496 3004 dbSNP
rs958453405 3008 dbSNP
rs772303063 3020 dbSNP
rs780074296 3021 dbSNP
rs1378361452 3033 dbSNP
rs1477833541 3035 dbSNP
rs1171474914 3042 dbSNP
rs1261671049 3042 dbSNP
rs1210076724 3046 dbSNP
rs1310934226 3053 dbSNP
rs1391751394 3057 dbSNP
rs969319330 3058 dbSNP
rs1430221027 3059 dbSNP
rs1307321970 3063 dbSNP
rs748281602 3064 dbSNP
rs1281284206 3071 dbSNP
rs916845017 3078 dbSNP
rs928314220 3078 dbSNP
rs1341462768 3098 dbSNP
rs981127828 3099 dbSNP
rs1230648836 3100 dbSNP
rs1299422145 3101 dbSNP
rs1344735112 3112 dbSNP
rs992790153 3128 dbSNP
rs779239289 3131 dbSNP
rs1365713188 3132 dbSNP
rs1338029564 3141 dbSNP
rs1020221659 3143 dbSNP
rs1268181629 3146 dbSNP
rs149035868 3147 dbSNP
rs1445482801 3149 dbSNP
rs1360862015 3150 dbSNP
rs1449840989 3153 dbSNP
rs999681405 3161 dbSNP
rs1459401833 3169 dbSNP
rs957211920 3179 dbSNP
rs1389353758 3180 dbSNP
rs967823777 3202 dbSNP
rs1022014631 3207 dbSNP
rs1006569931 3208 dbSNP
rs1198578202 3226 dbSNP
rs1387767087 3236 dbSNP
rs1322125748 3244 dbSNP
rs1028799776 3246 dbSNP
rs1436196088 3247 dbSNP
rs889421347 3248 dbSNP
rs1325154460 3249 dbSNP
rs269277 3256 dbSNP
rs1262923585 3258 dbSNP
rs1266595829 3261 dbSNP
rs1355713170 3263 dbSNP
rs1211972778 3267 dbSNP
rs1270175882 3276 dbSNP
rs1181661708 3277 dbSNP
rs1482458235 3284 dbSNP
rs1259438302 3285 dbSNP
rs1425377847 3288 dbSNP
rs536554964 3288 dbSNP
rs998535710 3293 dbSNP
rs552133542 3296 dbSNP
rs1008173867 3305 dbSNP
rs1160753752 3306 dbSNP
rs1341631024 3310 dbSNP
rs1456404737 3318 dbSNP
rs1272536402 3319 dbSNP
rs1230952396 3320 dbSNP
rs887073221 3325 dbSNP
rs1308328988 3327 dbSNP
rs567323239 3335 dbSNP
rs941193150 3338 dbSNP
rs931541946 3350 dbSNP
rs761492501 3351 dbSNP
rs190553395 3357 dbSNP
rs1226406756 3360 dbSNP
rs139297238 3362 dbSNP
rs1303414084 3363 dbSNP
rs937126605 3365 dbSNP
rs1409127221 3367 dbSNP
rs928397085 3369 dbSNP
rs1368204591 3374 dbSNP
rs1309287998 3376 dbSNP
rs1429771834 3377 dbSNP
rs1367563070 3382 dbSNP
rs1472004651 3383 dbSNP
rs571051912 3384 dbSNP
rs1156476153 3392 dbSNP
rs1360606964 3394 dbSNP
rs1162176686 3395 dbSNP
rs981156079 3397 dbSNP
rs1375323784 3410 dbSNP
rs948070799 3418 dbSNP
rs1416407093 3419 dbSNP
rs1351158593 3426 dbSNP
rs530463052 3428 dbSNP
rs1223351254 3430 dbSNP
rs1305131712 3439 dbSNP
rs146916697 3451 dbSNP
rs1233632914 3452 dbSNP
rs990081833 3455 dbSNP
rs992156138 3457 dbSNP
rs1483002869 3459 dbSNP
rs1207179555 3460 dbSNP
rs1252518500 3461 dbSNP
rs1482439689 3472 dbSNP
rs957299798 3479 dbSNP
rs1029264702 3480 dbSNP
rs996019002 3482 dbSNP
rs1177194996 3483 dbSNP
rs1394827908 3489 dbSNP
rs961277396 3490 dbSNP
rs1207425829 3493 dbSNP
rs1310377989 3497 dbSNP
rs1371792214 3507 dbSNP
rs755980171 3509 dbSNP
rs577678830 3511 dbSNP
rs1296539756 3517 dbSNP
rs1480964753 3526 dbSNP
rs1019703113 3533 dbSNP
rs1265101182 3536 dbSNP
rs978295255 3537 dbSNP
rs1323351310 3540 dbSNP
rs968174523 3546 dbSNP
rs1227756571 3550 dbSNP
rs1008226304 3564 dbSNP
rs887126892 3566 dbSNP
rs1025570791 3568 dbSNP
rs1022066791 3570 dbSNP
rs185695186 3575 dbSNP
rs1247983837 3580 dbSNP
rs1348576876 3586 dbSNP
rs995743655 3587 dbSNP
rs1192593748 3595 dbSNP
rs796719951 3600 dbSNP
rs193270509 3601 dbSNP
rs1170887979 3602 dbSNP
rs549376186 3605 dbSNP
rs907326154 3611 dbSNP
rs1169001621 3612 dbSNP
rs997852446 3625 dbSNP
rs1459094078 3627 dbSNP
rs142529049 3636 dbSNP
rs1166132264 3642 dbSNP
rs751233396 3647 dbSNP
rs1472447898 3651 dbSNP
rs1436937487 3657 dbSNP
rs945751643 3665 dbSNP
rs1212707630 3677 dbSNP
rs960544656 3677 dbSNP
rs1292003194 3680 dbSNP
rs1321780478 3682 dbSNP
rs1212599918 3686 dbSNP
rs1270813181 3692 dbSNP
rs1036873038 3695 dbSNP
rs989798965 3699 dbSNP
rs147728210 3700 dbSNP
rs1419811373 3711 dbSNP
rs187427391 3712 dbSNP
rs1049154300 3713 dbSNP
rs1461967808 3716 dbSNP
rs948161266 3719 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*