miRTarBase - #MIRT023323 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol YKT6   
Synonyms -
Description YKT6 v-SNARE homolog
Transcript NM_006555   
Expression
Putative miRNA Targets on YKT6
3'UTR of YKT6
(miRNA target sites are highlighted)
>YKT6|NM_006555|3'UTR
   1 TGCAGCCTGCCAGAGGCCCAATGCTGGAATGGCACCATCATTCACATCAGAACTGCAGCCCCTGGAAAAGAAGAGACAGC
  81 CATAGACGAGGAGCCAGAGTGGGGGCAGACTGGCCATTTTTATTTTGAAGTTCCTGCGAGAAATGGATGGTGGAAGGGTG
 161 GCGAATGTTCAAATTCATATGTGTGGTAGTGATTCTTGGAAAGAATTTGAGGTCCCCAAAGGTGTATTTTTGGGCAAATG
 241 AAACCATAAACTCCGACTGGCTTCTGTAGATGCCAAAGGGCTCTTTTTCAGCTAACCCTGGGAAGGCTCTGTGGGAGGGA
 321 GGTCGGAGCCAGCTGTTTCTCGATCTTTGGTATATCTTTGGATCTTATTTGTACATTAATGATATTAACACTCCAGTGGG
 401 GGGTGGGGAGTCCCTGATGCTAGGGCTGGGGTGGGTGGAGTTTGAAGACTCTTGGGAAAGCCTCTCCTGGGGCCACTGTT
 481 GGGGGTGGGAGTGAGCCCACCACAGAGGCCACAGGCAGGCCCCCACTTCAGGCCCAAGGCCTGGGGCGGGGGGAACAGTC
 561 ACTGGGTCTCAGATTCTGAGACTGTTGTTTAGCTTACCTTTCTGCTAGGATTGGCTTCCCGCAGAGGGCAGGGCCCATCC
 641 TAAGCAGCTTCCAAGTCCCACAAAGGTGGCTTGTGGGAGGATTTGGAAGGAGCTGCATTGTGGGCGGGGAGTGTGTGGGT
 721 TGGGTTCGTACCAGCAAGTAGACTAGGAACTGAGCCCAGGAAAGGGGGATGTTTTCCTGGTGTTTGGATGGTCAGCTGGG
 801 AGTGTCCATCATCAGGGGAAGATCAAACACAGGTGCACTCAGCTGCCCAGGGCCTCTGGGACACTTGCCTTGACTTGCAA
 881 CTTGCCTTGAACATCACGATCAAAGCAGCAGGTGCTGTGGTCTCTCAAAATTGATTTTTATTTGACTCTGTGGCTCTAAG
 961 ACTGCCTTGAACCGCCTGAGGCCTATGCATCTGAACAAGTGGGTCTCTCCCTTGAGCACCAGGAGTGGGTGCCAGCCGGC
1041 CCCGAGGATTCCCAGCACCCCACCTATGGTCTTGCCAGCATAGGCTTGCTAGTTCCTTCTTGGTCAGAGGTAGCTGCAGA
1121 GGGGGGAGGCCAAGGGTTTGGTCTAAGCTGTGCCCTGCCACCTGGCAGGAGGCCCACTCACTGCCCAAGTCATGGCAACA
1201 GGCTGGAGCAGCCCAGGAGATGGGCCTAAAATGTTCTGGATCCCTTGGGTCCTAGTGTTATGTTCCAGTCTGCCCACCTG
1281 TGCTCAGGATGCAGCCCTGGGATCCAGCACCCATGGAAGCTTCTGCTGGGATGGTGTCACCTATGGGTTTTGAACCAGTG
1361 TGGTATGGTCCTTGGGAGCTCTGCTCTGAGCTTGCCACACTGCTGAGAGCACCCACTGTCCTGACCAGAGTCTCAGTGGT
1441 CCTGACCCCCAATGTGGGCAGGGGCTGGGCAGGAGGGTGGGGTCTGCTGTGGGTTCAGAGGACTCCACCTCCTGGCTGGT
1521 TTACCTGCTGCTGCCCATTTTCTCTGGGTACTGCTGGCCAGAGGACTTTAGCCTACCCCTGAAGAGCCTGTCCATGTCAT
1601 TTTCCTACTGCCATAGATACCCTAAGCCCAGGGCCCCTTGAGGCCCAGACTCAGCCTGCCCACTGGTGCCGGAGACGGAG
1681 TGGAGTGGGCCTGGATCCGAGGGATGCTACCTCTCCCTTTCCCACTTGAGGACCCTGGGGAGAGATGGGGGCGGGGAAAA
1761 TGGAGGTATGAATTTGGGGTAAGAGGAAGTGAGATCTCCGCTTGCAGGTCAGCCCCTGCCTTGCAGGGCGGGCTGGCTTG
1841 ACTCAGGCCCTGTGAGATAGAGGGCCCAGCCCAGCCCCACCCACAGATCCCCTGCTCCTGTTGTGTTCTGTTGTAAATCA
1921 TTTGGCGAGACTGTATTTTAGTAACTGCTGCCTAACTTCCCTGTGTTCTATTTGAGAGGCGCCTGTCTGGATAAAGTTGT
2001 CTTGAAATTTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAAC----AGUGUGAGGu 5'
             |||::| ||    | ||||||| 
Target 5' tgtACATTAATGATATTAACACTCCa 3'
370 - 395 157.00 -15.30
2
miRNA  3' guuugugguAACAGUGUGAGGu 5'
                   ||| |||||| | 
Target 5' gctctgagcTTGCCACACTGCt 3'
1383 - 1404 125.00 -10.10
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :| |||||    | ||||| 
Target 5' atGAAACCAT----AAACTCCg 3'
238 - 255 122.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30154672 48 COSMIC
COSN30490916 62 COSMIC
COSN31503687 73 COSMIC
COSN30682181 88 COSMIC
COSN31552651 115 COSMIC
COSN17652227 129 COSMIC
COSN26728523 138 COSMIC
COSN8023267 161 COSMIC
COSN30115322 173 COSMIC
COSN20104191 288 COSMIC
COSN20104193 313 COSMIC
COSN17477423 555 COSMIC
COSN21736420 957 COSMIC
COSN23521523 1039 COSMIC
COSN29332379 1069 COSMIC
COSN2224170 1137 COSMIC
COSN17132055 1479 COSMIC
COSN9989896 1641 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs538988906 7 dbSNP
rs201721301 12 dbSNP
rs1356554961 13 dbSNP
rs147371100 17 dbSNP
rs1017196377 18 dbSNP
rs766578793 22 dbSNP
rs1320505723 30 dbSNP
rs1375822929 36 dbSNP
rs768494178 40 dbSNP
rs776611788 45 dbSNP
rs761845497 49 dbSNP
rs765346179 52 dbSNP
rs1283130405 69 dbSNP
rs79546049 71 dbSNP
rs986839072 82 dbSNP
rs924655039 83 dbSNP
rs565542803 89 dbSNP
rs1223533792 91 dbSNP
rs1266624845 101 dbSNP
rs1165406645 102 dbSNP
rs976486557 102 dbSNP
rs1445112450 104 dbSNP
rs78455736 123 dbSNP
rs536306411 127 dbSNP
rs78352778 128 dbSNP
rs752321674 131 dbSNP
rs948620685 134 dbSNP
rs12670584 138 dbSNP
rs181872409 139 dbSNP
rs1267242223 148 dbSNP
rs938162137 157 dbSNP
rs1353566345 158 dbSNP
rs1284374995 163 dbSNP
rs1156990538 164 dbSNP
rs1337231476 167 dbSNP
rs1350835950 175 dbSNP
rs1047508344 177 dbSNP
rs1407540395 178 dbSNP
rs1055329918 180 dbSNP
rs886149889 184 dbSNP
rs765320888 187 dbSNP
rs1005900593 194 dbSNP
rs1359805445 194 dbSNP
rs1156679648 199 dbSNP
rs1037752073 209 dbSNP
rs898774893 213 dbSNP
rs1198443065 217 dbSNP
rs1431608371 229 dbSNP
rs1305367848 236 dbSNP
rs1364139604 239 dbSNP
rs558826473 240 dbSNP
rs1200195642 254 dbSNP
rs1488283142 256 dbSNP
rs1309227143 258 dbSNP
rs1336954428 269 dbSNP
rs368059901 284 dbSNP
rs1351863046 285 dbSNP
rs1232112765 290 dbSNP
rs1310039203 306 dbSNP
rs1014045774 307 dbSNP
rs3840675 307 dbSNP
rs3840674 310 dbSNP
rs113418097 312 dbSNP
rs79911862 313 dbSNP
rs1045386252 322 dbSNP
rs1296275740 325 dbSNP
rs902859786 326 dbSNP
rs998743008 331 dbSNP
rs1171741903 342 dbSNP
rs1032947796 343 dbSNP
rs1358549583 346 dbSNP
rs957338535 349 dbSNP
rs1177326407 350 dbSNP
rs577203698 353 dbSNP
rs1261046774 365 dbSNP
rs1195980451 368 dbSNP
rs541334282 374 dbSNP
rs1255948087 375 dbSNP
rs1199068173 383 dbSNP
rs980416133 385 dbSNP
rs1264615275 392 dbSNP
rs1223679013 398 dbSNP
rs1439572631 399 dbSNP
rs1316769512 400 dbSNP
rs1267850291 401 dbSNP
rs1179791989 404 dbSNP
rs1326921855 406 dbSNP
rs1333321323 414 dbSNP
rs1394063719 415 dbSNP
rs928489520 419 dbSNP
rs1337652376 420 dbSNP
rs1232470241 421 dbSNP
rs1421611425 427 dbSNP
rs201234587 427 dbSNP
rs1169690498 428 dbSNP
rs3840673 428 dbSNP
rs1368383762 436 dbSNP
rs1185958239 437 dbSNP
rs1462942874 440 dbSNP
rs1244068684 451 dbSNP
rs1203932634 454 dbSNP
rs1457011093 462 dbSNP
rs1017475621 465 dbSNP
rs1165774730 468 dbSNP
rs938496431 474 dbSNP
rs878877586 477 dbSNP
rs983255701 478 dbSNP
rs907645757 481 dbSNP
rs941759667 483 dbSNP
rs1037403163 486 dbSNP
rs1398346864 494 dbSNP
rs768417300 496 dbSNP
rs1399297477 497 dbSNP
rs1390027584 510 dbSNP
rs879198983 521 dbSNP
rs1348209978 522 dbSNP
rs932957397 524 dbSNP
rs966484333 525 dbSNP
rs879129239 526 dbSNP
rs1454244320 527 dbSNP
rs1178380691 528 dbSNP
rs976199481 540 dbSNP
rs1381699546 546 dbSNP
rs1008362201 548 dbSNP
rs866482712 548 dbSNP
rs560456450 549 dbSNP
rs1012058849 550 dbSNP
rs376447625 553 dbSNP
rs1021661617 554 dbSNP
rs970460158 557 dbSNP
rs1239136716 561 dbSNP
rs11540053 565 dbSNP
rs1371531407 583 dbSNP
rs1281498473 602 dbSNP
rs950735355 604 dbSNP
rs1035614503 605 dbSNP
rs1427155324 609 dbSNP
rs1337396759 610 dbSNP
rs1195213087 615 dbSNP
rs984777584 619 dbSNP
rs909457384 621 dbSNP
rs577942561 622 dbSNP
rs1470284649 623 dbSNP
rs907696632 625 dbSNP
rs991395447 634 dbSNP
rs1490836013 643 dbSNP
rs941824203 654 dbSNP
rs1215718559 658 dbSNP
rs1314927272 662 dbSNP
rs543079316 667 dbSNP
rs1224577023 668 dbSNP
rs949804566 674 dbSNP
rs561202375 689 dbSNP
rs1045520792 690 dbSNP
rs902828517 692 dbSNP
rs1051345614 699 dbSNP
rs1346769858 705 dbSNP
rs1298136267 706 dbSNP
rs1429179559 707 dbSNP
rs1347346588 708 dbSNP
rs1160247863 714 dbSNP
rs531867853 716 dbSNP
rs1424011321 721 dbSNP
rs549954150 724 dbSNP
rs139575583 726 dbSNP
rs893039025 728 dbSNP
rs1192888987 729 dbSNP
rs1053243585 737 dbSNP
rs891951047 742 dbSNP
rs1011701515 750 dbSNP
rs1043536299 759 dbSNP
rs1261492584 778 dbSNP
rs185204845 781 dbSNP
rs547697688 783 dbSNP
rs901688676 794 dbSNP
rs754346052 809 dbSNP
rs1289874728 812 dbSNP
rs1404276540 814 dbSNP
rs565639913 814 dbSNP
rs1334294531 819 dbSNP
rs1035675811 824 dbSNP
rs1429424055 827 dbSNP
rs1169102522 831 dbSNP
rs959975333 832 dbSNP
rs1004796291 840 dbSNP
rs1186961498 841 dbSNP
rs535892024 846 dbSNP
rs1472346960 847 dbSNP
rs755318474 848 dbSNP
rs1240985536 855 dbSNP
rs1014802175 862 dbSNP
rs1461919353 865 dbSNP
rs548198249 876 dbSNP
rs1202506818 877 dbSNP
rs1309847823 881 dbSNP
rs776184757 881 dbSNP
rs1296923666 886 dbSNP
rs569638463 894 dbSNP
rs750229593 896 dbSNP
rs973229042 898 dbSNP
rs537187821 899 dbSNP
rs11540052 913 dbSNP
rs1317567048 915 dbSNP
rs953107236 918 dbSNP
rs748308664 921 dbSNP
rs1324280322 930 dbSNP
rs558736302 951 dbSNP
rs1355708096 963 dbSNP
rs991095478 965 dbSNP
rs918051550 966 dbSNP
rs1423881931 969 dbSNP
rs1383194247 970 dbSNP
rs779820573 974 dbSNP
rs142380921 975 dbSNP
rs1261442604 978 dbSNP
rs748928497 980 dbSNP
rs1175628008 986 dbSNP
rs1205985588 988 dbSNP
rs1251911265 1004 dbSNP
rs1221522855 1010 dbSNP
rs1264293126 1018 dbSNP
rs190493439 1024 dbSNP
rs1247157628 1031 dbSNP
rs768070729 1032 dbSNP
rs1193026861 1033 dbSNP
rs1383158910 1035 dbSNP
rs778426669 1036 dbSNP
rs1378725223 1038 dbSNP
rs892810619 1039 dbSNP
rs1173668996 1040 dbSNP
rs1404787890 1044 dbSNP
rs748602511 1045 dbSNP
rs943250526 1051 dbSNP
rs1038968265 1057 dbSNP
rs1362947784 1058 dbSNP
rs772559927 1059 dbSNP
rs901779175 1075 dbSNP
rs1157220404 1084 dbSNP
rs1043200752 1087 dbSNP
rs1251390176 1090 dbSNP
rs905967087 1090 dbSNP
rs1490020391 1091 dbSNP
rs997289012 1096 dbSNP
rs1001607557 1097 dbSNP
rs1057188284 1099 dbSNP
rs1457418020 1108 dbSNP
rs1290321621 1122 dbSNP
rs11540054 1123 dbSNP
rs1307160446 1124 dbSNP
rs1381440477 1128 dbSNP
rs1199051172 1132 dbSNP
rs1324077650 1137 dbSNP
rs11540051 1141 dbSNP
rs1221662624 1156 dbSNP
rs1384010028 1157 dbSNP
rs1286872421 1164 dbSNP
rs1281416681 1165 dbSNP
rs1455586832 1172 dbSNP
rs1015265445 1175 dbSNP
rs1364590397 1180 dbSNP
rs1006266368 1190 dbSNP
rs1323005690 1195 dbSNP
rs963298663 1197 dbSNP
rs1479500360 1207 dbSNP
rs1016646560 1218 dbSNP
rs1431469179 1220 dbSNP
rs769428309 1225 dbSNP
rs1446897223 1237 dbSNP
rs771185370 1238 dbSNP
rs1207247537 1245 dbSNP
rs748324362 1250 dbSNP
rs779440393 1251 dbSNP
rs1025206906 1256 dbSNP
rs746418785 1258 dbSNP
rs978252831 1262 dbSNP
rs542638770 1266 dbSNP
rs766320807 1270 dbSNP
rs1284597809 1275 dbSNP
rs1224095006 1279 dbSNP
rs1325765338 1284 dbSNP
rs868846976 1286 dbSNP
rs955740546 1290 dbSNP
rs989927284 1298 dbSNP
rs1385318843 1328 dbSNP
rs1336337176 1330 dbSNP
rs987789628 1335 dbSNP
rs1468388075 1347 dbSNP
rs865787062 1357 dbSNP
rs1177213549 1360 dbSNP
rs913486452 1364 dbSNP
rs151300455 1366 dbSNP
rs1195870521 1371 dbSNP
rs1452719057 1378 dbSNP
rs1039136597 1387 dbSNP
rs923207114 1399 dbSNP
rs1242862165 1400 dbSNP
rs1043647362 1412 dbSNP
rs1163599367 1420 dbSNP
rs933280046 1426 dbSNP
rs1403023229 1436 dbSNP
rs576126861 1438 dbSNP
rs1302533632 1447 dbSNP
rs1047517022 1451 dbSNP
rs56734972 1453 dbSNP
rs1365691209 1454 dbSNP
rs565096959 1454 dbSNP
rs1314061225 1456 dbSNP
rs1006233784 1458 dbSNP
rs1450785626 1460 dbSNP
rs1337546977 1466 dbSNP
rs532585676 1466 dbSNP
rs1057242703 1470 dbSNP
rs1292926854 1471 dbSNP
rs1170167876 1475 dbSNP
rs1462907146 1478 dbSNP
rs1418967770 1490 dbSNP
rs895246217 1492 dbSNP
rs1244594955 1493 dbSNP
rs547659212 1504 dbSNP
rs1045776 1505 dbSNP
rs1036343115 1511 dbSNP
rs1268799594 1512 dbSNP
rs1480649281 1516 dbSNP
rs970929038 1517 dbSNP
rs1342750532 1520 dbSNP
rs1290834169 1527 dbSNP
rs899100072 1534 dbSNP
rs183399729 1537 dbSNP
rs1247863102 1538 dbSNP
rs1418117157 1542 dbSNP
rs1031146156 1547 dbSNP
rs1441679009 1564 dbSNP
rs1334086032 1568 dbSNP
rs1330937219 1574 dbSNP
rs1392527437 1578 dbSNP
rs12536934 1580 dbSNP
rs990075908 1588 dbSNP
rs182210474 1595 dbSNP
rs139407935 1599 dbSNP
rs974434691 1613 dbSNP
rs922944878 1619 dbSNP
rs1230720232 1622 dbSNP
rs34782860 1623 dbSNP
rs761899814 1635 dbSNP
rs1047652852 1645 dbSNP
rs907690476 1654 dbSNP
rs1483379008 1664 dbSNP
rs767539910 1671 dbSNP
rs941849493 1672 dbSNP
rs1037968451 1677 dbSNP
rs750281033 1678 dbSNP
rs1290274167 1681 dbSNP
rs1223467135 1690 dbSNP
rs58496753 1696 dbSNP
rs1046358313 1699 dbSNP
rs1021950232 1704 dbSNP
rs1344893826 1710 dbSNP
rs1301854731 1713 dbSNP
rs11540055 1718 dbSNP
rs114615647 1723 dbSNP
rs927490570 1730 dbSNP
rs36036737 1733 dbSNP
rs1031237561 1736 dbSNP
rs1405337071 1737 dbSNP
rs992969826 1739 dbSNP
rs1472640335 1742 dbSNP
rs1427928485 1743 dbSNP
rs1207288726 1744 dbSNP
rs917359185 1746 dbSNP
rs534787071 1747 dbSNP
rs553165686 1751 dbSNP
rs1247116353 1753 dbSNP
rs1214788025 1754 dbSNP
rs1036798749 1756 dbSNP
rs1286621677 1757 dbSNP
rs1209537788 1766 dbSNP
rs1322952492 1767 dbSNP
rs899156098 1779 dbSNP
rs1368891042 1782 dbSNP
rs1480058874 1783 dbSNP
rs930592842 1788 dbSNP
rs766145868 1790 dbSNP
rs1347258427 1795 dbSNP
rs753443893 1798 dbSNP
rs894089342 1800 dbSNP
rs1457402276 1801 dbSNP
rs568255196 1802 dbSNP
rs1404767181 1806 dbSNP
rs1011065521 1811 dbSNP
rs796986412 1815 dbSNP
rs1442504565 1824 dbSNP
rs1425783850 1826 dbSNP
rs150071781 1827 dbSNP
rs554620879 1828 dbSNP
rs1008697164 1829 dbSNP
rs964455872 1830 dbSNP
rs1168325795 1831 dbSNP
rs754588499 1833 dbSNP
rs778350512 1837 dbSNP
rs1337585030 1838 dbSNP
rs1312777844 1841 dbSNP
rs1272938499 1842 dbSNP
rs892245580 1845 dbSNP
rs747647210 1846 dbSNP
rs867869487 1851 dbSNP
rs954397320 1854 dbSNP
rs1009312117 1857 dbSNP
rs1298751288 1859 dbSNP
rs1450783987 1864 dbSNP
rs1381564539 1868 dbSNP
rs1334196141 1869 dbSNP
rs1467138738 1870 dbSNP
rs576038415 1874 dbSNP
rs1363174636 1875 dbSNP
rs1408103001 1875 dbSNP
rs1188947573 1876 dbSNP
rs1444304201 1877 dbSNP
rs1241528425 1878 dbSNP
rs1185587933 1879 dbSNP
rs907785395 1881 dbSNP
rs1483631094 1890 dbSNP
rs1232330115 1891 dbSNP
rs1203083691 1892 dbSNP
rs1216816990 1894 dbSNP
rs1309757204 1898 dbSNP
rs967742654 1899 dbSNP
rs941977290 1904 dbSNP
rs973220896 1911 dbSNP
rs916406318 1928 dbSNP
rs1264566878 1933 dbSNP
rs1297079247 1937 dbSNP
rs1439999838 1938 dbSNP
rs1372319498 1940 dbSNP
rs561509327 1943 dbSNP
rs958922209 1947 dbSNP
rs1383096645 1953 dbSNP
rs948133324 1960 dbSNP
rs1202687340 1961 dbSNP
rs1424578548 1962 dbSNP
rs1249968863 1963 dbSNP
rs1046534711 1964 dbSNP
rs1175541385 1967 dbSNP
rs1484360123 1970 dbSNP
rs543479190 1972 dbSNP
rs558651200 1981 dbSNP
rs1184652213 1982 dbSNP
rs1294353191 1984 dbSNP
rs1418747327 1990 dbSNP
rs1477506578 1991 dbSNP
rs1052468252 2002 dbSNP
rs1221393280 2003 dbSNP
rs1221573369 2005 dbSNP
rs894058205 2007 dbSNP
rs143512021 2011 dbSNP
rs940803636 2011 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*