miRTarBase - #MIRT023325 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM118A   
Synonyms C22orf8
Description family with sequence similarity 118 member A
Transcript NM_001104595   
Other Transcripts NM_017911   
Expression
Putative miRNA Targets on FAM118A
3'UTR of FAM118A
(miRNA target sites are highlighted)		 
>FAM118A|NM_001104595|3'UTR
   1 AATCTTTACAGTAAAACCTGCAACTTGAAAACTAGCCTTCTGTAACCACAGTGCCCAAACGAAGAGGAATGTATGGAGAA
  81 CTCCACGTGGATCTCTGATTGCGAAACCGTCACATACACCAAGAGAGCCACATGGGCATGTGGCCCTCAAGGCTGGGTGA
 161 GAGGGCTCCCCTGTGTGTTGAACTATGCAGGAGGGTGACGCGGACACATTTCAGGTGGACTTTGCAAGGACTGATGGATA
 241 GCTACCTCAGGGACCAGAATCCGTGGGAAGGGATGGACCTGGTGTTCCCGTTCCCATCTGACAGGCTCTCTTTTGTCAAG
 321 GTGGTATTTTTCGTAATAAAAGGGGAAGAGTAAAGACTGTCCAAGCAACAGTAGCTGCCAAAGAGAAAATACGAAATAGA
 401 CACTTTTTTTTTTTGAGTCAGAGTCTCACTCTGTCACCCAGGACAGAGTGCAGTGGTACGATCTCAAGCTCACTGCAGCC
 481 ACCACCGCCTGGGCTCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCGTCCACCACCATGCCCAG
 561 CTAATTTTTTTATTTTTAGTAGAGTTGGAGTTTCACCATGTTGGCCAGGATGGTCTCGAACTCTTGACCTCAGGTGATCC
 641 ACCCGCCTTGGCCTCCCAAAGTGCTAGGATTACAGGCATGAGCCACTGCGCCCAGCAAAATAAACACATTTTATAATTTG
 721 TATGTGGAAACATGTTACTATAGAAAGCATTTTAAAGGTACGTTTTAAAGGTCCACTGTTAAATAGTAAAGAATGAATCC
 801 GCTAGCGAAAATGTTTTTAGGGAGAACAGCTGGATCAAAAGGGCTTCTTTGGAATTAGGTTGTTTTAGTAACTTCTGTTC
 881 CAAAGAAACACAGGTCTGATATTGCTAAGAACTGAAATCGGAGGAGCCAGAGGCCCTTTTCAGTCCAGGCCAACATTGTG
 961 CACGGCCACTGTGGGACTGACAACCGGGATAGCTCAAGTTCGAGAGACCAGGTTTCAAACATTATAAGTTCCAGGCTTTG
1041 CAAGTCTTTATTCTCTGGGGTAATATCCAGTCTTTCTGTTATTGTCTCTTAAAATTCTCTTCCATGGCCCACATTAAGGG
1121 AGTTTGCAGAGAGTGAGGGAGGCAAAACTTGAAAAGGGCCTGCAACACTTTAAACCTTCTCAGGTTCACCCACATGAAAC
1201 GGCTGTGCTGAGTGTGCTGCCGGTGCCCGGGGAGCTTCTCTGACTGTGACCCGGCAGAGGCTTCTGTGGCGGTGCATGAG
1281 CGGCCCTACAGTGGAGGGTTCTCTTTGGAAACAAACAGCCCTGCTTGGTTTCAGTTTGAGGCCACTTATCTTCAATGTGA
1361 CATTTCTTGCCAAGCCCTGTGACACTCCCCATTGATGACTCCCATAGGTACAGATAAAGTTAAGAACAGGAAACAGAAGG
1441 GTAGGATGCATAGGGAGGGAGAGAAGCCCTGAAAACTTTTTTTTTCTTTTTGAAGCATGGAAAACAAATCTTTTATGCCA
1521 CTCCAGCCATAAATAAAATTTTAACTTCAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1 
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||  ||  ||| ||||||| 
Target 5' ccAAGCCC--TGTGACACTCCc 3'
 		1370 - 1389 156.00 -19.60
2 
miRNA  3' guUUGU---GGUAACAGUGUGAGGu 5'
            ||||   |: || |  |||||| 
Target 5' aaAACAAATCTTTTATGCCACTCCa 3'
 		1501 - 1525 128.00 -13.90
3 
miRNA  3' guUUGUG--GUAACAGUGUGAGGu 5'
            ||:||   || |  |||||:: 
Target 5' aaAATACGAAATAG--ACACTTTt 3'
 		386 - 407 118.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26975641 21 COSMIC
COSN26958320 32 COSMIC
COSN26958321 33 COSMIC
COSN31610831 34 COSMIC
COSN30457247 57 COSMIC
COSN30102737 67 COSMIC
COSN26439220 103 COSMIC
COSN26636682 103 COSMIC
COSN30155081 109 COSMIC
COSN30141108 110 COSMIC
COSN30154884 116 COSMIC
COSN31594045 120 COSMIC
COSN23015794 149 COSMIC
COSN31508096 172 COSMIC
COSN28737550 200 COSMIC
COSN30124954 201 COSMIC
COSN30138155 203 COSMIC
COSN21458855 210 COSMIC
COSN24383600 215 COSMIC
COSN21250067 236 COSMIC
COSN30166488 343 COSMIC
COSN4908911 667 COSMIC
COSN31779360 812 COSMIC
COSN16268474 816 COSMIC
COSN17916402 1025 COSMIC
COSN24960268 1356 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779518939 2 dbSNP
rs751243050 5 dbSNP
rs371436250 10 dbSNP
rs1308281023 12 dbSNP
rs781502525 18 dbSNP
rs748558827 24 dbSNP
rs770269926 36 dbSNP
rs778317540 38 dbSNP
rs749258607 40 dbSNP
rs765560219 41 dbSNP
rs144465524 42 dbSNP
rs1384074540 43 dbSNP
rs774396192 43 dbSNP
rs746072385 44 dbSNP
rs772473159 46 dbSNP
rs1206245482 52 dbSNP
rs1197810892 53 dbSNP
rs978647783 55 dbSNP
rs534944811 61 dbSNP
rs375088388 62 dbSNP
rs1479764826 68 dbSNP
rs1257905895 71 dbSNP
rs1293300625 79 dbSNP
rs1311606063 81 dbSNP
rs934606246 87 dbSNP
rs1053473921 88 dbSNP
rs1352146270 90 dbSNP
rs901089911 93 dbSNP
rs1390526927 98 dbSNP
rs190701899 103 dbSNP
rs1049684871 104 dbSNP
rs565076088 109 dbSNP
rs1404668391 110 dbSNP
rs1174939373 115 dbSNP
rs1217877788 117 dbSNP
rs1473846206 118 dbSNP
rs1413215290 122 dbSNP
rs1181907252 124 dbSNP
rs1288616401 124 dbSNP
rs1005569599 133 dbSNP
rs1258551533 135 dbSNP
rs1017117452 136 dbSNP
rs989733292 139 dbSNP
rs897343689 142 dbSNP
rs1056322 149 dbSNP
rs1201733739 160 dbSNP
rs1238073718 170 dbSNP
rs1473844337 171 dbSNP
rs1331125978 173 dbSNP
rs148794256 187 dbSNP
rs1238079116 193 dbSNP
rs1333697544 199 dbSNP
rs2064068 200 dbSNP
rs535819326 202 dbSNP
rs540363783 203 dbSNP
rs928019267 208 dbSNP
rs1459348487 217 dbSNP
rs1160175653 221 dbSNP
rs1390004305 224 dbSNP
rs560089896 230 dbSNP
rs1036594305 231 dbSNP
rs532050285 236 dbSNP
rs978888352 243 dbSNP
rs899036828 246 dbSNP
rs1313436247 255 dbSNP
rs1444200658 261 dbSNP
rs552794370 263 dbSNP
rs1050299134 264 dbSNP
rs768720102 278 dbSNP
rs1465356384 282 dbSNP
rs1248574907 287 dbSNP
rs889049377 290 dbSNP
rs144958916 291 dbSNP
rs1266967563 294 dbSNP
rs1008545705 295 dbSNP
rs1358283773 303 dbSNP
rs922531822 306 dbSNP
rs531903968 307 dbSNP
rs774349250 313 dbSNP
rs1365208863 321 dbSNP
rs1318268338 322 dbSNP
rs1380996971 326 dbSNP
rs933873107 328 dbSNP
rs967519049 330 dbSNP
rs548388550 333 dbSNP
rs1031587099 334 dbSNP
rs958195497 340 dbSNP
rs1170645249 348 dbSNP
rs1450202063 349 dbSNP
rs1241543330 360 dbSNP
rs557406042 363 dbSNP
rs772160655 372 dbSNP
rs575742638 381 dbSNP
rs1444197794 386 dbSNP
rs1202593711 393 dbSNP
rs1210201546 394 dbSNP
rs568347146 394 dbSNP
rs1038885868 400 dbSNP
rs916805516 403 dbSNP
rs1269045122 404 dbSNP
rs35399563 404 dbSNP
rs879698756 404 dbSNP
rs969634087 404 dbSNP
rs1225960054 405 dbSNP
rs896743405 408 dbSNP
rs79932993 415 dbSNP
rs1180783490 416 dbSNP
rs1392988593 417 dbSNP
rs1453628182 418 dbSNP
rs1173083652 420 dbSNP
rs34991516 425 dbSNP
rs1364061833 439 dbSNP
rs534004348 440 dbSNP
rs764973862 443 dbSNP
rs982062984 445 dbSNP
rs1166227936 450 dbSNP
rs553897946 451 dbSNP
rs112465798 460 dbSNP
rs772461515 461 dbSNP
rs570818200 467 dbSNP
rs1448469280 472 dbSNP
rs1036408700 481 dbSNP
rs2350630 482 dbSNP
rs999844080 487 dbSNP
rs1346421454 488 dbSNP
rs1440719608 488 dbSNP
rs761072148 501 dbSNP
rs1275994289 503 dbSNP
rs1223381367 519 dbSNP
rs1275949158 523 dbSNP
rs1347685537 524 dbSNP
rs375823918 543 dbSNP
rs1050269576 544 dbSNP
rs1327035156 565 dbSNP
rs1416249296 566 dbSNP
rs889018560 572 dbSNP
rs1008848240 576 dbSNP
rs1177101166 578 dbSNP
rs1480049560 579 dbSNP
rs558771717 580 dbSNP
rs5766662 586 dbSNP
rs998931620 600 dbSNP
rs1032730203 601 dbSNP
rs1251419112 609 dbSNP
rs1443664438 616 dbSNP
rs573179180 618 dbSNP
rs554788716 619 dbSNP
rs1199229273 624 dbSNP
rs1224702182 628 dbSNP
rs574732029 630 dbSNP
rs1450413736 632 dbSNP
rs955305696 632 dbSNP
rs763647872 633 dbSNP
rs182994431 639 dbSNP
rs756874828 641 dbSNP
rs1377118218 642 dbSNP
rs559998967 645 dbSNP
rs911121082 646 dbSNP
rs1469277722 652 dbSNP
rs1035683079 659 dbSNP
rs1403832103 660 dbSNP
rs941398673 667 dbSNP
rs1401105427 674 dbSNP
rs962036472 677 dbSNP
rs1156495757 681 dbSNP
rs532082830 690 dbSNP
rs918674390 691 dbSNP
rs930037183 705 dbSNP
rs1459534729 714 dbSNP
rs1250457565 715 dbSNP
rs1217065803 720 dbSNP
rs1316725583 724 dbSNP
rs920666044 733 dbSNP
rs1360436683 738 dbSNP
rs1387007366 739 dbSNP
rs896625694 740 dbSNP
rs1314551833 756 dbSNP
rs545502045 762 dbSNP
rs780875615 763 dbSNP
rs1367384820 768 dbSNP
rs1012405552 777 dbSNP
rs1431349044 778 dbSNP
rs1344439975 779 dbSNP
rs1429184944 789 dbSNP
rs985949799 792 dbSNP
rs563161105 801 dbSNP
rs140054264 802 dbSNP
rs1032641219 806 dbSNP
rs548497403 807 dbSNP
rs1009961114 808 dbSNP
rs1187653966 812 dbSNP
rs1485822471 828 dbSNP
rs568316137 828 dbSNP
rs563998510 832 dbSNP
rs750102464 843 dbSNP
rs1490599742 850 dbSNP
rs1291349070 852 dbSNP
rs1244004043 882 dbSNP
rs955231178 890 dbSNP
rs1344460621 895 dbSNP
rs1210689852 899 dbSNP
rs1296360579 903 dbSNP
rs527923316 908 dbSNP
rs1215147343 913 dbSNP
rs1361178076 919 dbSNP
rs903109914 920 dbSNP
rs1297559225 921 dbSNP
rs1365908923 924 dbSNP
rs1291697334 929 dbSNP
rs1445114715 933 dbSNP
rs1422324253 934 dbSNP
rs1018182183 937 dbSNP
rs1170534118 942 dbSNP
rs934316887 943 dbSNP
rs1418012048 950 dbSNP
rs1193380576 959 dbSNP
rs1480987102 964 dbSNP
rs1054551326 965 dbSNP
rs962623581 971 dbSNP
rs755836555 976 dbSNP
rs541953061 979 dbSNP
rs1341075305 986 dbSNP
rs918571545 991 dbSNP
rs1185083161 1002 dbSNP
rs1203917698 1002 dbSNP
rs892873130 1003 dbSNP
rs1044742 1005 dbSNP
rs1293374681 1007 dbSNP
rs1164664011 1013 dbSNP
rs1044744 1025 dbSNP
rs905330377 1027 dbSNP
rs1298340257 1029 dbSNP
rs1461066545 1037 dbSNP
rs1352222635 1042 dbSNP
rs1179260198 1050 dbSNP
rs539793892 1051 dbSNP
rs556299209 1057 dbSNP
rs1470576955 1059 dbSNP
rs1004127203 1060 dbSNP
rs1429099106 1061 dbSNP
rs1197708219 1063 dbSNP
rs1329810805 1067 dbSNP
rs1298122872 1068 dbSNP
rs1176782127 1071 dbSNP
rs1361665831 1073 dbSNP
rs1257801256 1075 dbSNP
rs917987479 1076 dbSNP
rs1324163155 1077 dbSNP
rs1262364722 1079 dbSNP
rs6007599 1080 dbSNP
rs948239875 1083 dbSNP
rs1310603362 1085 dbSNP
rs1045225629 1087 dbSNP
rs1390432150 1095 dbSNP
rs4823462 1103 dbSNP
rs1291467257 1111 dbSNP
rs541392379 1123 dbSNP
rs1405998953 1128 dbSNP
rs1454045633 1128 dbSNP
rs1054544751 1130 dbSNP
rs1286215465 1138 dbSNP
rs1348266399 1142 dbSNP
rs1455693418 1150 dbSNP
rs35900846 1152 dbSNP
rs1364696725 1158 dbSNP
rs972072754 1165 dbSNP
rs1158699460 1172 dbSNP
rs751805745 1177 dbSNP
rs1184296122 1185 dbSNP
rs1204393073 1189 dbSNP
rs1027686206 1194 dbSNP
rs1201648526 1195 dbSNP
rs6007600 1196 dbSNP
rs1208678534 1197 dbSNP
rs1256135937 1201 dbSNP
rs10343 1202 dbSNP
rs1189159582 1204 dbSNP
rs1381337942 1205 dbSNP
rs910644248 1206 dbSNP
rs1468913827 1210 dbSNP
rs890868454 1215 dbSNP
rs1361602790 1218 dbSNP
rs1288637043 1219 dbSNP
rs1422002750 1222 dbSNP
rs944489581 1223 dbSNP
rs1401546728 1229 dbSNP
rs574644431 1230 dbSNP
rs1018021953 1235 dbSNP
rs1396743314 1240 dbSNP
rs924530364 1249 dbSNP
rs1204335865 1251 dbSNP
rs1293519243 1252 dbSNP
rs1484737651 1252 dbSNP
rs1334148278 1253 dbSNP
rs1239704181 1254 dbSNP
rs115164814 1255 dbSNP
rs1054117096 1256 dbSNP
rs866025546 1260 dbSNP
rs867956143 1261 dbSNP
rs1231969039 1262 dbSNP
rs973988193 1271 dbSNP
rs1025967923 1272 dbSNP
rs1483289842 1273 dbSNP
rs1367807893 1275 dbSNP
rs1304026157 1277 dbSNP
rs1424238116 1278 dbSNP
rs1363854648 1281 dbSNP
rs892842000 1282 dbSNP
rs760982456 1283 dbSNP
rs553800946 1290 dbSNP
rs1192319297 1291 dbSNP
rs551843670 1292 dbSNP
rs1270736797 1296 dbSNP
rs1222830480 1298 dbSNP
rs753800675 1307 dbSNP
rs1490079818 1312 dbSNP
rs1436822070 1317 dbSNP
rs951434965 1320 dbSNP
rs1197037003 1321 dbSNP
rs1339421224 1328 dbSNP
rs906973809 1345 dbSNP
rs576879479 1349 dbSNP
rs564033868 1351 dbSNP
rs1215054369 1356 dbSNP
rs1035620761 1361 dbSNP
rs1377612559 1365 dbSNP
rs1284313431 1367 dbSNP
rs1404639753 1379 dbSNP
rs1343878991 1382 dbSNP
rs1467014914 1385 dbSNP
rs1410625330 1386 dbSNP
rs1395809051 1393 dbSNP
rs1167301815 1399 dbSNP
rs1174324042 1405 dbSNP
rs1394463097 1406 dbSNP
rs1431233318 1415 dbSNP
rs545916478 1415 dbSNP
rs1199870480 1422 dbSNP
rs948082044 1425 dbSNP
rs1244648231 1431 dbSNP
rs1183492859 1440 dbSNP
rs1437949552 1441 dbSNP
rs771364624 1442 dbSNP
rs1197367166 1450 dbSNP
rs1027655147 1451 dbSNP
rs9626147 1452 dbSNP
rs575677047 1454 dbSNP
rs1321793893 1466 dbSNP
rs754857117 1467 dbSNP
rs1443164359 1469 dbSNP
rs1335297552 1472 dbSNP
rs1017674889 1475 dbSNP
rs1176994519 1477 dbSNP
rs1422768947 1477 dbSNP
rs1444557292 1477 dbSNP
rs1469134508 1477 dbSNP
rs925448122 1477 dbSNP
rs776919477 1478 dbSNP
rs1470302807 1479 dbSNP
rs975924450 1480 dbSNP
rs1300489591 1487 dbSNP
rs924472359 1488 dbSNP
rs1312646858 1493 dbSNP
rs1235364180 1494 dbSNP
rs778691304 1498 dbSNP
rs1044758 1502 dbSNP
rs1203544555 1514 dbSNP
rs1441086250 1516 dbSNP
rs1224597627 1521 dbSNP
rs928230532 1521 dbSNP
rs959677967 1523 dbSNP
rs1350220645 1529 dbSNP
rs145571832 1532 dbSNP
rs914497414 1533 dbSNP
rs1248274567 1539 dbSNP
rs1383569550 1551 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.768 5.9e-6 0.872 1.4e-8 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.742 2.5e-5 0.654 3.6e-4 23 Click to see details
GSE17306 Multiple myeloma -0.193 9.2e-2 -0.056 3.5e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.128 1.6e-1 -0.209 4.9e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.205 1.7e-1 0.158 2.3e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.167 1.8e-1 -0.283 5.8e-2 32 Click to see details
GSE19350 CNS germ cell tumors -0.279 1.9e-1 -0.217 2.5e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.2 2.0e-1 -0.349 6.6e-2 20 Click to see details
GSE27834 Pluripotent stem cells 0.214 2.1e-1 0.171 2.6e-1 16 Click to see details
GSE14794 Lymphoblastoid cells 0.084 2.2e-1 0.081 2.2e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.112 3.0e-1 0.082 3.5e-1 25 Click to see details
GSE17498 Multiple myeloma -0.085 3.0e-1 -0.073 3.3e-1 40 Click to see details
GSE21849 B cell lymphoma -0.099 3.0e-1 -0.011 4.8e-1 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.1 3.2e-1 0.028 4.5e-1 25 Click to see details
GSE38226 Liver fibrosis 0.092 3.5e-1 0.089 3.5e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.165 3.8e-1 0.257 3.1e-1 6 Click to see details
GSE28260 Renal cortex and medulla -0.072 4.1e-1 -0.082 3.9e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.363 0.03 -0.283 0.07 29 Click to see details
LIHC -0.24 0.05 -0.359 0.01 49 Click to see details
CHOL -0.469 0.1 -0.467 0.1 9 Click to see details
STAD -0.484 0.11 -0.429 0.14 8 Click to see details
HNSC 0.805 0.2 0.500 0.33 3 Click to see details
KIRP 0.273 0.24 -0.067 0.43 9 Click to see details
KICH 0.108 0.4 -0.048 0.46 8 Click to see details
THCA -0.15 0.4 0.300 0.31 5 Click to see details
ESCA -0.045 0.47 -0.200 0.37 5 Click to see details
ESCA -0.045 0.47 -0.200 0.37 5 Click to see details
ESCA -0.045 0.47 -0.200 0.37 5 Click to see details
ESCA -0.045 0.47 -0.200 0.37 5 Click to see details
ESCA -0.045 0.47 -0.200 0.37 5 Click to see details
ESCA -0.045 0.47 -0.200 0.37 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
Error report submission
MIRT ID*
Your e-Mail*
Memo*