miRTarBase - #MIRT023335 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol OSMR   
Synonyms IL-31R-beta, IL-31RB, OSMRB, PLCA1
Description oncostatin M receptor
Transcript NM_003999   
Other Transcripts NM_001168355   
Expression
Putative miRNA Targets on OSMR
3'UTR of OSMR
(miRNA target sites are highlighted)
>OSMR|NM_003999|3'UTR
   1 CCAGCATGCCGATTTCATACCTTATGCTACACAGACATTAAGAAGAGCAGAGCTGGCACCCTGTCATCACCAGTGGCCTT
  81 GGTCCTTAATCCCAGTACGATTTGCAGGTCTGGTTTATATAAGACCACTACAGTCTGGCTAGGTTAAAGGCCAGAGGCTA
 161 TGGAACTTAACACTCCCCATTGGAGCAAGCTTGCCCTAGAGACGGCAGGATCATGGGAGCATGCTTACCTTCTGCTGTTT
 241 GTTCCAGGCTCACCTTTAGAACAGGAGACTTGAGCTTGACCTAAGGATATGCATTAACCACTCTACAGACTCCCACTCAG
 321 TACTGTACAGGGTGGCTGTGGTCCTAGAAGTTCAGTTTTTACTGAGGAAATATTTCCATTAACAGCAATTATTATATTGA
 401 AGGCTTTAATAAAGGCCACAGGAGACATTACTATAGCATAGATTGTCAAATGTAAATTTACTGAGCGTGTTTTATAAAAA
 481 ACTCACAGGTGTTTGAGGCCAAAACAGATTTTAGACTTACCTTGAACGGATAAGAATCTATAGTTCACTGACACAGTAAA
 561 ATTAACTCTGTGGGTGGGGGCGGGGGGCATAGCTCTAATCTAATATATAAAATGTGTGATGAATCAACAAGATTTCCACA
 641 ATTCTTCTGTCAAGCTTACTACAGTGAAAGAATGGGATTGGCAAGTAACTTCTGACTTACTGTCAGTTGTACTTCTGCTC
 721 CATAGACATCAGTATTCTGCCATCATTTTTGATGACTACCTCAGAACATAAAAAGGAACGTATATCACATAATTCCAGTC
 801 ACAGTTTTTGGTTCCTCTTTTCTTTCAAGAACTATATATAAATGACCTGTTTTCACTTAGCATCCTTTGGACTCTGCAGT
 881 AGGTTGTCTGGGTCAAGATAACTCTCAGTCACATTTATATTCATATTATGCTAAAATAGTAAAATGAAACCTCATTGTTG
 961 GACATAATTTAGATATAACTAAAAAGTTCTATGAAGTGGGAAATTCCGTGTTGGCTCTGGAGCAGCTTTGTCTCCTCTGA
1041 ACCAATATATCCCAAACCAATATATGCAAAGCACCTGGTACACAACTGGTATTTTAGTACATGTTGGTTCTTTTGGTGCA
1121 ATCTCAGCTCACTGCAGCTTCCGCCTCCTAGATTCAAACAAACAGTTCTCCTGCCCCAGCCTCCAGAGCACCTAGGACTC
1201 CAGGTGCATGCTACCACACCTGACTAGTTTTTATATTTTTAGTAGAGATTGGGTTTTACCATATTGGCCAGGCTGGTCTC
1281 AAACTCCTGACCGCAGGTGATCCACCTGCCTCAGCTTCCCCAAGGGCTGGGATTACAGGTGTGAGCCACCATGCCCAGCC
1361 TATTTGTCACATTATTTGTCACATTTATTTTACTTTTATTTATTTTTTGAGATGAAATTTCGCTCTTGTTGCCCAGGCTG
1441 GAGTGCAATGGTGCAGCCTTGGCTCACTGCAACCTCCGCCTCCCAGGGTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGT
1521 AGCTGGGATTACAGGCATGCACCACCACACCCAGGTAATTTTGTATCTTTAGTAGAGATGGGGTTTCACCATGTTGGTCA
1601 GGCTGTTCTCGAACTCCTGACCTCAGGTGATCTGCCTGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGCGTGAGCCACT
1681 GCGCCTAGCCGTCACATTTCTAAACAAGCATGAAAGGGGTTCATTTTTGTCTTCTTCTTGCCTGCCGTCAGCATGGTGGA
1761 AATGGCTCTGCCTATGCTCATGCTTCTGGTGCCCAATGCCTTGCACTGTGCCATTCAACACTATGAAGAGAAACAAGTAG
1841 CCACACCTCAAAATAATGTGGCTGTCAACAACTGGCCTAAATAAACCTACACAAACCAGTACTTGCCTTTTGCTGGAAAC
1921 ATTGATTATGTGCTCCTCACGTAGTAGAAAGCGGTATCCTGATTAGTCTAACAGTTGTGTTAGACTTTAGGGCCAGTATT
2001 GTCAGCATTTATTTATTTATGTACCTTTGTTATGATGGGATATTTTTCATTTGAAACTTGTTCATAAAAATGTCAATGAC
2081 ATTGATGACTGATTTGTACATATTTTTCATATAGTTTTGTTTAAAAAATAATTCACGCAAAATCTTGAAGTCATTTTTGC
2161 TATTGAAATAAACCTTAATTAAAATATTTCATCATCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC----AGUGUGAGGu 5'
            :| :|:|| |    | ||||||| 
Target 5' caGAGGCTATGGAACTTAACACTCCc 3'
152 - 177 150.00 -15.00
2
miRNA  3' guuugUGGUAACA-GUGUGAGGu 5'
               |||| | | || ||||| 
Target 5' cattaACCACTCTACAGACTCCc 3'
292 - 314 129.00 -11.70
3
miRNA  3' guuUGUGGU-AACAGUGUGAGgu 5'
             |||::| ||||||||:|:  
Target 5' gtcACATTATTTGTCACATTTat 3'
1366 - 1388 127.00 -15.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26987652 12 COSMIC
COSN31513352 19 COSMIC
COSN30499943 69 COSMIC
COSN20075329 106 COSMIC
COSN16616760 255 COSMIC
COSN2105160 440 COSMIC
COSN6296432 474 COSMIC
COSN20223050 534 COSMIC
COSN1315871 648 COSMIC
COSN28690949 855 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs769825460 8 dbSNP
rs1341437066 9 dbSNP
rs1003033582 10 dbSNP
rs111889069 11 dbSNP
rs749514687 12 dbSNP
rs995085834 19 dbSNP
rs768960449 21 dbSNP
rs186349017 22 dbSNP
rs1426352714 24 dbSNP
rs1474460013 26 dbSNP
rs745476625 31 dbSNP
rs1012446289 38 dbSNP
rs950674645 40 dbSNP
rs1458083226 42 dbSNP
rs762212692 50 dbSNP
rs1382142430 51 dbSNP
rs1156728668 72 dbSNP
rs775575505 90 dbSNP
rs767424089 92 dbSNP
rs28364756 99 dbSNP
rs1051977 100 dbSNP
rs1026070883 102 dbSNP
rs955433311 106 dbSNP
rs1446499567 107 dbSNP
rs1282843059 108 dbSNP
rs550679979 121 dbSNP
rs911331499 123 dbSNP
rs1357545790 127 dbSNP
rs1293096220 130 dbSNP
rs921357582 130 dbSNP
rs1353186008 132 dbSNP
rs942511884 140 dbSNP
rs879115284 151 dbSNP
rs1259438347 160 dbSNP
rs989953837 162 dbSNP
rs914455201 163 dbSNP
rs1427801364 164 dbSNP
rs1193829093 168 dbSNP
rs1316179525 175 dbSNP
rs1374800776 177 dbSNP
rs552935803 178 dbSNP
rs115702064 179 dbSNP
rs1391299682 184 dbSNP
rs924767752 194 dbSNP
rs1164467162 197 dbSNP
rs1474067840 203 dbSNP
rs1239344 204 dbSNP
rs1194642863 206 dbSNP
rs1475156062 212 dbSNP
rs1240402091 214 dbSNP
rs1201039796 218 dbSNP
rs993063220 220 dbSNP
rs906855055 221 dbSNP
rs1212282402 229 dbSNP
rs938390020 242 dbSNP
rs1055934071 263 dbSNP
rs140757328 299 dbSNP
rs1214762437 301 dbSNP
rs1360787384 309 dbSNP
rs1044031851 313 dbSNP
rs548372381 317 dbSNP
rs1327665032 320 dbSNP
rs1459735656 322 dbSNP
rs1230977666 326 dbSNP
rs1012393960 329 dbSNP
rs1171710388 332 dbSNP
rs1017123836 338 dbSNP
rs1335032576 339 dbSNP
rs834011 341 dbSNP
rs1478394214 342 dbSNP
rs141516133 356 dbSNP
rs1192281451 374 dbSNP
rs1025921859 376 dbSNP
rs1485425112 381 dbSNP
rs190672964 384 dbSNP
rs756926856 387 dbSNP
rs1306571503 389 dbSNP
rs150863392 395 dbSNP
rs1018831227 407 dbSNP
rs1008245249 420 dbSNP
rs1302644557 423 dbSNP
rs1438588421 427 dbSNP
rs1378973955 434 dbSNP
rs778729828 435 dbSNP
rs1018744638 444 dbSNP
rs997257563 453 dbSNP
rs1415159363 455 dbSNP
rs1394524682 463 dbSNP
rs964103530 464 dbSNP
rs989901715 467 dbSNP
rs747340615 468 dbSNP
rs768904849 472 dbSNP
rs767751666 475 dbSNP
rs1418688079 476 dbSNP
rs1476274466 487 dbSNP
rs1157198981 499 dbSNP
rs978830129 503 dbSNP
rs967218425 528 dbSNP
rs1454685089 529 dbSNP
rs777118785 531 dbSNP
rs992965090 532 dbSNP
rs1245347103 535 dbSNP
rs748582024 542 dbSNP
rs537832784 553 dbSNP
rs948958124 566 dbSNP
rs1355558083 569 dbSNP
rs1234676764 570 dbSNP
rs1375019851 572 dbSNP
rs1311155263 576 dbSNP
rs1421515577 576 dbSNP
rs980213137 577 dbSNP
rs1304508459 582 dbSNP
rs1417758491 582 dbSNP
rs920265230 583 dbSNP
rs938324244 588 dbSNP
rs1047451532 590 dbSNP
rs1055479580 591 dbSNP
rs1208108067 603 dbSNP
rs886165573 604 dbSNP
rs139285755 606 dbSNP
rs915632303 609 dbSNP
rs1261292433 616 dbSNP
rs1214944815 618 dbSNP
rs1315013673 622 dbSNP
rs1262392030 624 dbSNP
rs556656151 628 dbSNP
rs1314635957 629 dbSNP
rs1037497608 631 dbSNP
rs1233611655 645 dbSNP
rs1355062017 667 dbSNP
rs574981215 671 dbSNP
rs898649788 685 dbSNP
rs1286725899 689 dbSNP
rs112205722 693 dbSNP
rs994368578 695 dbSNP
rs1385739258 700 dbSNP
rs1288840405 701 dbSNP
rs1047737293 709 dbSNP
rs891388739 711 dbSNP
rs76797509 716 dbSNP
rs1018278154 724 dbSNP
rs1461191376 727 dbSNP
rs1175685633 740 dbSNP
rs1407590677 741 dbSNP
rs554762238 750 dbSNP
rs1161681131 752 dbSNP
rs1261855475 761 dbSNP
rs573189802 765 dbSNP
rs1185379824 770 dbSNP
rs1484859292 777 dbSNP
rs964052509 780 dbSNP
rs540491852 781 dbSNP
rs1333867063 783 dbSNP
rs904507514 800 dbSNP
rs565011265 804 dbSNP
rs1021692881 811 dbSNP
rs1000175351 839 dbSNP
rs1031771001 847 dbSNP
rs1370371021 848 dbSNP
rs967165790 848 dbSNP
rs977301004 863 dbSNP
rs113447304 867 dbSNP
rs1392699950 870 dbSNP
rs1440707936 870 dbSNP
rs773235731 883 dbSNP
rs182864005 887 dbSNP
rs1024472980 899 dbSNP
rs959994088 905 dbSNP
rs529274827 906 dbSNP
rs1254872456 907 dbSNP
rs980366360 911 dbSNP
rs187503522 916 dbSNP
rs1250944398 923 dbSNP
rs991524613 925 dbSNP
rs1233464931 947 dbSNP
rs1281021828 952 dbSNP
rs1250905463 954 dbSNP
rs915579977 972 dbSNP
rs1350116498 976 dbSNP
rs1225424347 977 dbSNP
rs1202570023 987 dbSNP
rs1232405423 991 dbSNP
rs1481053738 992 dbSNP
rs1179184884 996 dbSNP
rs941713577 997 dbSNP
rs1333806402 998 dbSNP
rs1037435419 1000 dbSNP
rs983045129 1006 dbSNP
rs1297235674 1008 dbSNP
rs919026938 1009 dbSNP
rs1396334619 1012 dbSNP
rs1173675375 1017 dbSNP
rs1454162565 1027 dbSNP
rs763043301 1029 dbSNP
rs944458065 1045 dbSNP
rs1040645463 1047 dbSNP
rs543855737 1049 dbSNP
rs921776407 1050 dbSNP
rs1047233862 1052 dbSNP
rs1194276824 1064 dbSNP
rs149987785 1066 dbSNP
rs375120602 1075 dbSNP
rs1039966766 1078 dbSNP
rs899831840 1079 dbSNP
rs1011557171 1087 dbSNP
rs1213584414 1088 dbSNP
rs1335520751 1097 dbSNP
rs192991465 1098 dbSNP
rs903745655 1099 dbSNP
rs1000203057 1101 dbSNP
rs1053066719 1108 dbSNP
rs138837247 1111 dbSNP
rs1353424777 1120 dbSNP
rs1462114964 1124 dbSNP
rs1021642186 1143 dbSNP
rs891923479 1144 dbSNP
rs1470419133 1145 dbSNP
rs1014332162 1146 dbSNP
rs903290875 1149 dbSNP
rs1024922766 1152 dbSNP
rs1258408205 1155 dbSNP
rs970232006 1155 dbSNP
rs1439957304 1156 dbSNP
rs560281512 1164 dbSNP
rs1035532542 1169 dbSNP
rs146051707 1171 dbSNP
rs952258508 1172 dbSNP
rs1308156891 1178 dbSNP
rs1206885614 1181 dbSNP
rs532430040 1189 dbSNP
rs983118752 1193 dbSNP
rs1235467468 1207 dbSNP
rs766533967 1213 dbSNP
rs1022909437 1215 dbSNP
rs1468303349 1219 dbSNP
rs1352999968 1220 dbSNP
rs1194700813 1222 dbSNP
rs1255325031 1234 dbSNP
rs1384082403 1238 dbSNP
rs1156598055 1245 dbSNP
rs963014127 1246 dbSNP
rs1462811575 1252 dbSNP
rs369595386 1253 dbSNP
rs975840815 1254 dbSNP
rs973077564 1261 dbSNP
rs918974654 1262 dbSNP
rs1193933960 1265 dbSNP
rs1474687649 1275 dbSNP
rs1446949093 1291 dbSNP
rs182911527 1293 dbSNP
rs987665373 1294 dbSNP
rs1335894058 1298 dbSNP
rs912722723 1301 dbSNP
rs1273481569 1304 dbSNP
rs571043701 1313 dbSNP
rs878977322 1321 dbSNP
rs538282785 1322 dbSNP
rs1043914296 1323 dbSNP
rs187967413 1325 dbSNP
rs568577163 1331 dbSNP
rs1391884643 1340 dbSNP
rs1394903412 1341 dbSNP
rs1460623037 1344 dbSNP
rs1326278388 1350 dbSNP
rs1163888636 1351 dbSNP
rs935231610 1353 dbSNP
rs1351418341 1355 dbSNP
rs1000623280 1361 dbSNP
rs1053143384 1361 dbSNP
rs1269593013 1365 dbSNP
rs1196027420 1372 dbSNP
rs552942813 1372 dbSNP
rs947365984 1374 dbSNP
rs1220599507 1383 dbSNP
rs1252798979 1393 dbSNP
rs761860844 1394 dbSNP
rs750424948 1395 dbSNP
rs1274670868 1396 dbSNP
rs1045832874 1404 dbSNP
rs1295364978 1411 dbSNP
rs1236441590 1416 dbSNP
rs1043039735 1422 dbSNP
rs1275364767 1423 dbSNP
rs1433952036 1424 dbSNP
rs1027777362 1426 dbSNP
rs1329776905 1429 dbSNP
rs140013159 1440 dbSNP
rs1005080240 1441 dbSNP
rs998940339 1446 dbSNP
rs1175556351 1448 dbSNP
rs112368307 1449 dbSNP
rs759871525 1463 dbSNP
rs1192224021 1469 dbSNP
rs767205911 1478 dbSNP
rs752583898 1479 dbSNP
rs1204736604 1486 dbSNP
rs1485889936 1488 dbSNP
rs1271884904 1493 dbSNP
rs1022866909 1497 dbSNP
rs965759673 1502 dbSNP
rs1348514478 1506 dbSNP
rs1302585037 1507 dbSNP
rs963295468 1510 dbSNP
rs554825320 1516 dbSNP
rs973032031 1535 dbSNP
rs1217325498 1548 dbSNP
rs1375228294 1549 dbSNP
rs1025978667 1551 dbSNP
rs950475120 1552 dbSNP
rs357252 1556 dbSNP
rs376818089 1558 dbSNP
rs1421288279 1564 dbSNP
rs373328070 1565 dbSNP
rs541742835 1565 dbSNP
rs766803531 1565 dbSNP
rs1469324249 1566 dbSNP
rs1249084585 1580 dbSNP
rs944191158 1612 dbSNP
rs1398796344 1614 dbSNP
rs1317531960 1617 dbSNP
rs764154142 1626 dbSNP
rs1279582731 1630 dbSNP
rs168567 1640 dbSNP
rs1318612399 1641 dbSNP
rs1284723488 1647 dbSNP
rs1160535420 1651 dbSNP
rs1222926142 1651 dbSNP
rs1348935158 1652 dbSNP
rs921476519 1661 dbSNP
rs756840973 1683 dbSNP
rs778639835 1684 dbSNP
rs558853565 1691 dbSNP
rs950092982 1692 dbSNP
rs1051942 1699 dbSNP
rs934679465 1700 dbSNP
rs905987023 1702 dbSNP
rs1057191122 1719 dbSNP
rs937415061 1724 dbSNP
rs1049249326 1730 dbSNP
rs887929365 1731 dbSNP
rs148889745 1733 dbSNP
rs142592579 1734 dbSNP
rs1179562235 1737 dbSNP
rs1489528439 1738 dbSNP
rs1044259423 1740 dbSNP
rs902062079 1745 dbSNP
rs1254687631 1747 dbSNP
rs574210824 1748 dbSNP
rs1234160444 1756 dbSNP
rs879374636 1759 dbSNP
rs1026673252 1760 dbSNP
rs1029071748 1777 dbSNP
rs1238895006 1784 dbSNP
rs1383930747 1786 dbSNP
rs1363357746 1788 dbSNP
rs1288787423 1797 dbSNP
rs1433416874 1800 dbSNP
rs1397102664 1809 dbSNP
rs1468384039 1819 dbSNP
rs541498595 1819 dbSNP
rs1461661533 1820 dbSNP
rs1157742865 1831 dbSNP
rs1408473757 1850 dbSNP
rs200342008 1851 dbSNP
rs1420198026 1864 dbSNP
rs199839159 1864 dbSNP
rs953188470 1864 dbSNP
rs10592151 1866 dbSNP
rs1463453782 1866 dbSNP
rs16351 1866 dbSNP
rs1032199580 1868 dbSNP
rs956542805 1869 dbSNP
rs201287518 1870 dbSNP
rs950400321 1882 dbSNP
rs1229784825 1887 dbSNP
rs1308133893 1891 dbSNP
rs1295554658 1897 dbSNP
rs1226881838 1900 dbSNP
rs1336364906 1906 dbSNP
rs1327013343 1915 dbSNP
rs1334162551 1915 dbSNP
rs1389637406 1918 dbSNP
rs1291407772 1920 dbSNP
rs1463105123 1921 dbSNP
rs531816170 1921 dbSNP
rs1441777890 1923 dbSNP
rs1447594399 1926 dbSNP
rs764254237 1933 dbSNP
rs1008992178 1941 dbSNP
rs376362416 1942 dbSNP
rs1356299300 1944 dbSNP
rs1432375383 1948 dbSNP
rs748578913 1951 dbSNP
rs1197745175 1953 dbSNP
rs73751812 1954 dbSNP
rs1203043007 1960 dbSNP
rs981499536 1966 dbSNP
rs34747631 1970 dbSNP
rs192205678 1973 dbSNP
rs1396698833 1974 dbSNP
rs1306875887 1975 dbSNP
rs1200576442 1978 dbSNP
rs377072612 1989 dbSNP
rs1377265230 1991 dbSNP
rs976069931 1992 dbSNP
rs140757977 1994 dbSNP
rs1435669450 1996 dbSNP
rs937466784 1997 dbSNP
rs1251276033 1998 dbSNP
rs1180195376 2006 dbSNP
rs1049154337 2007 dbSNP
rs564802177 2007 dbSNP
rs887836063 2007 dbSNP
rs940872659 2016 dbSNP
rs968895977 2022 dbSNP
rs145787865 2025 dbSNP
rs1240121201 2027 dbSNP
rs1441372205 2039 dbSNP
rs1336049045 2041 dbSNP
rs1287311589 2058 dbSNP
rs1407510599 2063 dbSNP
rs751421267 2065 dbSNP
rs1394443136 2073 dbSNP
rs924883577 2077 dbSNP
rs998167244 2080 dbSNP
rs542518266 2086 dbSNP
rs1160093547 2095 dbSNP
rs1028685335 2097 dbSNP
rs1411564913 2100 dbSNP
rs934658172 2101 dbSNP
rs1476285156 2102 dbSNP
rs1057442909 2110 dbSNP
rs1394436259 2113 dbSNP
rs1441196974 2114 dbSNP
rs770745452 2114 dbSNP
rs917307409 2120 dbSNP
rs1328884378 2127 dbSNP
rs766228210 2129 dbSNP
rs7318 2137 dbSNP
rs956408260 2138 dbSNP
rs1293392515 2147 dbSNP
rs1446567701 2148 dbSNP
rs1044540046 2161 dbSNP
rs898981473 2169 dbSNP
rs1439225602 2170 dbSNP
rs1025221135 2173 dbSNP
rs1382608559 2174 dbSNP
rs1303276670 2175 dbSNP
rs1372314247 2180 dbSNP
rs1387670565 2185 dbSNP
rs773724744 2190 dbSNP
rs994701745 2193 dbSNP
rs1318236705 2194 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.71 5.1e-5 -0.727 2.9e-5 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.712 6.9e-5 -0.556 2.9e-3 23 Click to see details
GSE21687 Ependynoma primary tumors -0.304 7.3e-3 -0.276 1.4e-2 64 Click to see details
GSE27834 Pluripotent stem cells -0.346 9.5e-2 -0.229 2.0e-1 16 Click to see details
GSE32688 Pancreatic cancer -0.229 1.0e-1 -0.327 3.4e-2 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.246 1.2e-1 -0.232 1.3e-1 25 Click to see details
GSE28260 Renal cortex and medulla 0.347 1.2e-1 0.165 3.0e-1 13 Click to see details
GSE38226 Liver fibrosis -0.214 1.8e-1 -0.312 8.4e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.155 2.6e-1 0.427 3.0e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.125 2.8e-1 0.113 3.0e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.123 2.8e-1 -0.068 3.8e-1 24 Click to see details
GSE17498 Multiple myeloma 0.084 3.0e-1 -0.149 1.8e-1 40 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.191 3.6e-1 -0.257 3.1e-1 6 Click to see details
GSE14794 Lymphoblastoid cells -0.013 4.5e-1 0.004 4.9e-1 90 Click to see details
GSE19350 CNS germ cell tumors -0.033 4.6e-1 -0.003 5.0e-1 12 Click to see details
GSE17306 Multiple myeloma -0.004 4.9e-1 0.099 2.5e-1 49 Click to see details
GSE17306 Multiple myeloma -0.004 4.9e-1 0.099 2.5e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.346 0.01 -0.304 0.02 49 Click to see details
STAD -0.599 0.06 -0.452 0.13 8 Click to see details
ESCA -0.774 0.06 -0.700 0.09 5 Click to see details
KIRC 0.279 0.07 0.377 0.02 29 Click to see details
KICH 0.54 0.08 0.619 0.05 8 Click to see details
THCA 0.278 0.33 0.500 0.2 5 Click to see details
CHOL 0.154 0.35 0.183 0.32 9 Click to see details
KIRP -0.103 0.4 -0.083 0.42 9 Click to see details
HNSC 0.187 0.44 0.500 0.33 3 Click to see details
HNSC 0.187 0.44 0.500 0.33 3 Click to see details
HNSC 0.187 0.44 0.500 0.33 3 Click to see details
HNSC 0.187 0.44 0.500 0.33 3 Click to see details
HNSC 0.187 0.44 0.500 0.33 3 Click to see details
HNSC 0.187 0.44 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*