miRTarBase - #MIRT023337 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BRI3BP   
Synonyms BNAS1, HCCR-1, HCCR-2, HCCRBP-1, HCCRBP-3, KG19
Description BRI3 binding protein
Transcript NM_080626   
Expression
Putative miRNA Targets on BRI3BP
3'UTR of BRI3BP
(miRNA target sites are highlighted)
>BRI3BP|NM_080626|3'UTR
   1 AGGTCAGCCGGCCGGGCGGGTCCACAGTTACCAGCACGCTGTCTCAGAAAACGAAAACGGAGGAAAAAAACCCCAAACCC
  81 CAAACAATCTTAATAAACACGACTGAGCAAGAAAGTGGCGCTGTGTAGGGCTATTTCCACCCACCCGGCAGCTCTTAGGA
 161 CACATTCCCAGAAGAGCGGAAAGATCATTGACGTGGAACTACACACGAAGTGTAATTAGTGGGGGAAAAAATATTTTTTA
 241 AACAAAGGATATAACCATATTTAGTTGTACAGTAAGAGAAATTTATCTGTGCATAGAGCATAAAGTTAATTTTTTCAAGC
 321 ATTTAAATACATCTTTTGTAAGGTTTTTTAATAAAGGCAGATTGAGTCAAGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGU-GGUAA--CAGUGUGAGGu 5'
            ::|| |: ||  | ||||:||| 
Target 5' ccGGCAGCTCTTAGGACACATTCCc 3'
145 - 169 138.00 -11.50
2
miRNA  3' guUUGUGGUAACAG--------UGUGAGgu 5'
            || |:||||| |        |||| |  
Target 5' gaAAGATCATTGACGTGGAACTACACACga 3'
179 - 208 106.00 -12.22
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||| |||     ||| ||: 
Target 5' caAACCCCA----AACAATCTt 3'
74 - 91 102.00 -7.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30146883 10 COSMIC
COSN30451063 19 COSMIC
COSN31487617 19 COSMIC
COSN28852757 39 COSMIC
COSN30162357 44 COSMIC
COSN22817414 886 COSMIC
COSN27260080 902 COSMIC
COSN7314404 973 COSMIC
COSN7314405 986 COSMIC
COSN1560991 1026 COSMIC
COSN30715208 1092 COSMIC
COSN32140020 1312 COSMIC
COSN25112619 1341 COSMIC
COSN27772880 1433 COSMIC
COSN14824322 1454 COSMIC
COSN17670089 1712 COSMIC
COSN17453961 2489 COSMIC
COSN1560992 2518 COSMIC
COSN27925600 2669 COSMIC
COSN5933476 2815 COSMIC
COSN19105412 3113 COSMIC
COSN30683222 3174 COSMIC
COSN30600907 3333 COSMIC
COSN29968063 3350 COSMIC
COSN19071632 3394 COSMIC
COSN30558239 3415 COSMIC
COSN30611752 3435 COSMIC
COSN28490257 3780 COSMIC
COSN15703819 3861 COSMIC
COSN7314406 4054 COSMIC
COSN26423004 4314 COSMIC
COSN5933477 4375 COSMIC
COSN5933478 4378 COSMIC
COSN27547259 4470 COSMIC
COSN21481820 4637 COSMIC
COSN28525171 4825 COSMIC
COSN1560993 5760 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1372566329 3 dbSNP
rs1413180908 4 dbSNP
rs752295404 5 dbSNP
rs1380020708 6 dbSNP
rs1007717212 8 dbSNP
rs779045302 10 dbSNP
rs757845729 11 dbSNP
rs1414928738 13 dbSNP
rs1227314201 14 dbSNP
rs1275108095 17 dbSNP
rs190444285 18 dbSNP
rs1208322097 19 dbSNP
rs1416362289 24 dbSNP
rs1255096628 25 dbSNP
rs181788991 26 dbSNP
rs1016367860 27 dbSNP
rs963458400 32 dbSNP
rs757222511 36 dbSNP
rs1449397012 38 dbSNP
rs780825307 39 dbSNP
rs745623091 46 dbSNP
rs1343446553 47 dbSNP
rs769503836 48 dbSNP
rs1218967541 54 dbSNP
rs986766732 60 dbSNP
rs1283994041 63 dbSNP
rs1416286767 64 dbSNP
rs543318386 65 dbSNP
rs561392594 72 dbSNP
rs966579958 74 dbSNP
rs572826997 88 dbSNP
rs1482181518 89 dbSNP
rs992806405 92 dbSNP
rs1213123212 96 dbSNP
rs1468011441 99 dbSNP
rs1408348540 101 dbSNP
rs1235010296 109 dbSNP
rs977430560 110 dbSNP
rs915846514 113 dbSNP
rs1294578244 120 dbSNP
rs1212502068 122 dbSNP
rs1420488850 123 dbSNP
rs1055472 129 dbSNP
rs936088744 132 dbSNP
rs150800149 134 dbSNP
rs75976243 139 dbSNP
rs1458802151 141 dbSNP
rs1354390783 143 dbSNP
rs1168764836 148 dbSNP
rs1430572062 149 dbSNP
rs948893568 154 dbSNP
rs1045858345 155 dbSNP
rs550650510 163 dbSNP
rs73419937 171 dbSNP
rs900881051 173 dbSNP
rs933659978 178 dbSNP
rs1488758438 184 dbSNP
rs1250597925 185 dbSNP
rs1374440676 189 dbSNP
rs529816108 194 dbSNP
rs1308994251 195 dbSNP
rs548486683 203 dbSNP
rs889389010 204 dbSNP
rs1233031491 205 dbSNP
rs898145987 206 dbSNP
rs566637366 207 dbSNP
rs1373223021 208 dbSNP
rs1296852818 223 dbSNP
rs1016441562 224 dbSNP
rs899358575 226 dbSNP
rs993584989 226 dbSNP
rs534736131 227 dbSNP
rs546584650 228 dbSNP
rs571259108 231 dbSNP
rs1433739519 244 dbSNP
rs1440625752 244 dbSNP
rs1175358210 246 dbSNP
rs1019411635 248 dbSNP
rs966632007 262 dbSNP
rs781772728 263 dbSNP
rs1209789377 275 dbSNP
rs538756221 277 dbSNP
rs1022949481 279 dbSNP
rs1281909127 281 dbSNP
rs747626261 284 dbSNP
rs1458870589 288 dbSNP
rs978691133 293 dbSNP
rs1393589535 297 dbSNP
rs1176425402 298 dbSNP
rs1312649776 310 dbSNP
rs1351491861 310 dbSNP
rs746186891 317 dbSNP
rs556999171 320 dbSNP
rs1237134793 327 dbSNP
rs1454369984 330 dbSNP
rs925839789 334 dbSNP
rs139807689 339 dbSNP
rs988628640 347 dbSNP
rs922380024 356 dbSNP
rs536420304 358 dbSNP
rs957345625 364 dbSNP
rs555281094 367 dbSNP
rs1186937440 369 dbSNP
rs1484510194 379 dbSNP
rs1049888458 383 dbSNP
rs1449399499 383 dbSNP
rs1200630210 393 dbSNP
rs1329619900 395 dbSNP
rs1258365612 396 dbSNP
rs1376400579 400 dbSNP
rs1293103168 417 dbSNP
rs1231875800 421 dbSNP
rs1357702372 431 dbSNP
rs915983568 435 dbSNP
rs910901521 437 dbSNP
rs948797480 440 dbSNP
rs573451397 442 dbSNP
rs1382962661 450 dbSNP
rs1290691700 451 dbSNP
rs67037258 452 dbSNP
rs1412587608 453 dbSNP
rs1342888490 461 dbSNP
rs1164083564 467 dbSNP
rs928782803 470 dbSNP
rs940298160 476 dbSNP
rs1369923359 480 dbSNP
rs1187823130 484 dbSNP
rs145293906 489 dbSNP
rs1259127998 500 dbSNP
rs993658572 503 dbSNP
rs1213883084 505 dbSNP
rs1273130534 510 dbSNP
rs375717291 513 dbSNP
rs1231934046 518 dbSNP
rs1358909773 524 dbSNP
rs1285147900 525 dbSNP
rs185088540 527 dbSNP
rs1319762104 535 dbSNP
rs895910224 540 dbSNP
rs1014329125 542 dbSNP
rs1435950034 547 dbSNP
rs930976177 549 dbSNP
rs1393771644 555 dbSNP
rs1325156872 560 dbSNP
rs1049366813 562 dbSNP
rs1392699045 568 dbSNP
rs1196500300 574 dbSNP
rs1474900242 575 dbSNP
rs889544194 582 dbSNP
rs1007950800 583 dbSNP
rs1200483014 585 dbSNP
rs1251758424 591 dbSNP
rs1019886289 593 dbSNP
rs1212436334 603 dbSNP
rs1453818451 609 dbSNP
rs1291097057 610 dbSNP
rs1195562678 611 dbSNP
rs1337813009 627 dbSNP
rs902329373 627 dbSNP
rs1277069265 633 dbSNP
rs1229343981 636 dbSNP
rs999472235 640 dbSNP
rs1032253571 642 dbSNP
rs1370346856 644 dbSNP
rs1477386770 646 dbSNP
rs1434293571 660 dbSNP
rs1191148813 666 dbSNP
rs957399329 670 dbSNP
rs970067152 672 dbSNP
rs1409176504 678 dbSNP
rs1393991097 683 dbSNP
rs1170097917 686 dbSNP
rs990562861 688 dbSNP
rs1424943856 699 dbSNP
rs1394009525 701 dbSNP
rs1191178071 712 dbSNP
rs147252198 741 dbSNP
rs73231614 743 dbSNP
rs1032937054 747 dbSNP
rs1399914558 753 dbSNP
rs1462175719 761 dbSNP
rs1325697472 769 dbSNP
rs1329446675 770 dbSNP
rs771601274 785 dbSNP
rs1270744173 788 dbSNP
rs989091014 790 dbSNP
rs1221044962 798 dbSNP
rs1345747154 804 dbSNP
rs1275381317 807 dbSNP
rs1441306950 826 dbSNP
rs1486181522 827 dbSNP
rs140681143 828 dbSNP
rs970564957 836 dbSNP
rs1374440965 840 dbSNP
rs1173473026 854 dbSNP
rs1335166887 855 dbSNP
rs1211302020 861 dbSNP
rs1287247501 864 dbSNP
rs981530654 867 dbSNP
rs112759273 886 dbSNP
rs1485491697 886 dbSNP
rs1255697246 887 dbSNP
rs1264617291 888 dbSNP
rs11313217 889 dbSNP
rs1228808384 889 dbSNP
rs1443079467 889 dbSNP
rs398044850 889 dbSNP
rs868619381 889 dbSNP
rs201766514 890 dbSNP
rs1300733215 902 dbSNP
rs368670998 902 dbSNP
rs368406630 903 dbSNP
rs1473307076 907 dbSNP
rs1435633908 908 dbSNP
rs1388818650 912 dbSNP
rs149804945 913 dbSNP
rs1414796212 914 dbSNP
rs560442914 916 dbSNP
rs1298874911 921 dbSNP
rs955354787 924 dbSNP
rs985245151 934 dbSNP
rs1473239226 935 dbSNP
rs1241642428 956 dbSNP
rs1362479557 957 dbSNP
rs910931573 963 dbSNP
rs1398080462 971 dbSNP
rs1277444366 972 dbSNP
rs66836373 979 dbSNP
rs1333899268 984 dbSNP
rs1229734095 993 dbSNP
rs1379417325 1003 dbSNP
rs1246689826 1004 dbSNP
rs145738187 1013 dbSNP
rs1355205239 1023 dbSNP
rs1223911961 1033 dbSNP
rs920179551 1041 dbSNP
rs931549252 1052 dbSNP
rs920883820 1053 dbSNP
rs1321811256 1060 dbSNP
rs1215122829 1061 dbSNP
rs929540469 1062 dbSNP
rs1167315763 1071 dbSNP
rs1424652529 1075 dbSNP
rs1419110647 1080 dbSNP
rs1186854739 1082 dbSNP
rs1048391904 1089 dbSNP
rs1189217677 1090 dbSNP
rs1467967579 1097 dbSNP
rs1263508782 1098 dbSNP
rs1049876706 1100 dbSNP
rs910867335 1112 dbSNP
rs760261591 1117 dbSNP
rs1322061043 1118 dbSNP
rs1271867279 1121 dbSNP
rs896000523 1122 dbSNP
rs10083110 1130 dbSNP
rs1440881066 1131 dbSNP
rs187987910 1134 dbSNP
rs1044491437 1135 dbSNP
rs538617852 1139 dbSNP
rs201022683 1140 dbSNP
rs753806631 1151 dbSNP
rs1458754025 1152 dbSNP
rs1159410075 1155 dbSNP
rs753783476 1159 dbSNP
rs905913579 1169 dbSNP
rs551079178 1188 dbSNP
rs369119908 1192 dbSNP
rs1173063864 1201 dbSNP
rs569239346 1207 dbSNP
rs536894688 1208 dbSNP
rs67625612 1209 dbSNP
rs1265223224 1212 dbSNP
rs1192803321 1216 dbSNP
rs1488686454 1222 dbSNP
rs1033009799 1225 dbSNP
rs567025858 1226 dbSNP
rs558448016 1227 dbSNP
rs118116501 1231 dbSNP
rs7304738 1232 dbSNP
rs1023410640 1245 dbSNP
rs1309881230 1247 dbSNP
rs1331935474 1248 dbSNP
rs576936783 1249 dbSNP
rs1387788858 1251 dbSNP
rs1339591675 1258 dbSNP
rs1003401458 1261 dbSNP
rs1239321480 1262 dbSNP
rs1035732470 1263 dbSNP
rs544007315 1265 dbSNP
rs1371366018 1270 dbSNP
rs1350890037 1272 dbSNP
rs777876088 1275 dbSNP
rs972884388 1276 dbSNP
rs962431507 1279 dbSNP
rs920066882 1288 dbSNP
rs953096625 1289 dbSNP
rs1252113260 1297 dbSNP
rs1483889235 1297 dbSNP
rs973730948 1303 dbSNP
rs751554550 1308 dbSNP
rs1285975000 1311 dbSNP
rs1481993609 1313 dbSNP
rs544206134 1337 dbSNP
rs918237511 1339 dbSNP
rs929603657 1345 dbSNP
rs1346319780 1349 dbSNP
rs1286889302 1350 dbSNP
rs1230658146 1352 dbSNP
rs562638580 1353 dbSNP
rs1254519807 1369 dbSNP
rs372044430 1376 dbSNP
rs1466525253 1380 dbSNP
rs1387851808 1383 dbSNP
rs1156794881 1384 dbSNP
rs1473456563 1385 dbSNP
rs574445156 1395 dbSNP
rs1044576124 1396 dbSNP
rs550836627 1397 dbSNP
rs1257723916 1405 dbSNP
rs148983924 1407 dbSNP
rs1464018372 1408 dbSNP
rs923690362 1412 dbSNP
rs1266809767 1415 dbSNP
rs1378192109 1416 dbSNP
rs1467535651 1417 dbSNP
rs1170673906 1421 dbSNP
rs1242945721 1436 dbSNP
rs1342454689 1440 dbSNP
rs935038013 1441 dbSNP
rs936054070 1446 dbSNP
rs527447586 1451 dbSNP
rs1381740556 1455 dbSNP
rs1386465427 1458 dbSNP
rs1053636055 1463 dbSNP
rs563583103 1464 dbSNP
rs1389183948 1466 dbSNP
rs893621742 1471 dbSNP
rs1162415033 1472 dbSNP
rs569331330 1479 dbSNP
rs1374156903 1480 dbSNP
rs1187754346 1483 dbSNP
rs1044978931 1487 dbSNP
rs1245597216 1488 dbSNP
rs1301340250 1498 dbSNP
rs1465724987 1512 dbSNP
rs1289667253 1517 dbSNP
rs1208462521 1519 dbSNP
rs1358846696 1520 dbSNP
rs1227860081 1522 dbSNP
rs1266273182 1522 dbSNP
rs1365804478 1522 dbSNP
rs1437254104 1522 dbSNP
rs34513244 1522 dbSNP
rs397712123 1522 dbSNP
rs891819915 1522 dbSNP
rs1384888435 1523 dbSNP
rs1392549063 1524 dbSNP
rs1163488973 1529 dbSNP
rs1332259927 1535 dbSNP
rs1428687795 1536 dbSNP
rs1169900959 1537 dbSNP
rs1387832969 1537 dbSNP
rs1236114832 1538 dbSNP
rs1010614025 1544 dbSNP
rs1246660119 1550 dbSNP
rs1197301628 1553 dbSNP
rs1453689159 1561 dbSNP
rs1268487594 1567 dbSNP
rs11058000 1568 dbSNP
rs1340275084 1571 dbSNP
rs1276911811 1575 dbSNP
rs1229270640 1576 dbSNP
rs1002830652 1577 dbSNP
rs1274200478 1587 dbSNP
rs1035619854 1590 dbSNP
rs961456668 1604 dbSNP
rs564014816 1613 dbSNP
rs891026542 1614 dbSNP
rs1027135610 1624 dbSNP
rs746382799 1625 dbSNP
rs1006762076 1627 dbSNP
rs986150962 1637 dbSNP
rs911476505 1640 dbSNP
rs770283346 1641 dbSNP
rs1479281160 1644 dbSNP
rs532402988 1645 dbSNP
rs973807823 1648 dbSNP
rs1482255885 1649 dbSNP
rs1254272569 1655 dbSNP
rs1206072231 1664 dbSNP
rs1025325921 1665 dbSNP
rs1434939929 1669 dbSNP
rs550693802 1670 dbSNP
rs1312202882 1676 dbSNP
rs1217451533 1682 dbSNP
rs1196694919 1686 dbSNP
rs1283799626 1687 dbSNP
rs531560368 1691 dbSNP
rs1348332636 1692 dbSNP
rs1289839861 1705 dbSNP
rs1442474592 1710 dbSNP
rs1358128271 1717 dbSNP
rs935091682 1720 dbSNP
rs1416693517 1731 dbSNP
rs989215400 1738 dbSNP
rs530142134 1740 dbSNP
rs780626736 1745 dbSNP
rs548625359 1767 dbSNP
rs1403581898 1772 dbSNP
rs992202699 1775 dbSNP
rs1397741467 1789 dbSNP
rs1464787561 1790 dbSNP
rs1414566934 1806 dbSNP
rs1045260093 1809 dbSNP
rs906456861 1812 dbSNP
rs747817811 1820 dbSNP
rs1057080201 1823 dbSNP
rs950347418 1833 dbSNP
rs1369137609 1841 dbSNP
rs897146382 1843 dbSNP
rs1443023101 1849 dbSNP
rs994243802 1851 dbSNP
rs1207958252 1856 dbSNP
rs1326892025 1856 dbSNP
rs1289968105 1867 dbSNP
rs980290788 1870 dbSNP
rs567086905 1871 dbSNP
rs1282025838 1874 dbSNP
rs1449615122 1886 dbSNP
rs1345431680 1889 dbSNP
rs1320485475 1895 dbSNP
rs534364215 1895 dbSNP
rs936129557 1896 dbSNP
rs1007063242 1897 dbSNP
rs1160245888 1900 dbSNP
rs559320671 1902 dbSNP
rs1411921985 1903 dbSNP
rs1183753758 1904 dbSNP
rs1054547064 1909 dbSNP
rs1280505542 1912 dbSNP
rs558098259 1916 dbSNP
rs1247484701 1917 dbSNP
rs1187912994 1925 dbSNP
rs542340365 1926 dbSNP
rs1051529781 1928 dbSNP
rs1320838940 1934 dbSNP
rs965673766 1940 dbSNP
rs891066353 1950 dbSNP
rs1266210192 1960 dbSNP
rs537892879 1961 dbSNP
rs12820208 1965 dbSNP
rs111457986 1967 dbSNP
rs1208104420 1970 dbSNP
rs956349384 1972 dbSNP
rs1025358395 1973 dbSNP
rs1195677304 1979 dbSNP
rs1421209837 1983 dbSNP
rs1425521094 1988 dbSNP
rs1477346984 1992 dbSNP
rs989267719 1997 dbSNP
rs914999293 1999 dbSNP
rs947759536 2003 dbSNP
rs1165108806 2007 dbSNP
rs1013292641 2010 dbSNP
rs1351230401 2012 dbSNP
rs1455995180 2021 dbSNP
rs376942689 2022 dbSNP
rs772936841 2028 dbSNP
rs980367317 2030 dbSNP
rs927489042 2031 dbSNP
rs1401149153 2036 dbSNP
rs1300544082 2038 dbSNP
rs1223395326 2039 dbSNP
rs534107102 2042 dbSNP
rs1338929774 2046 dbSNP
rs948452885 2049 dbSNP
rs1313751409 2050 dbSNP
rs1323725746 2053 dbSNP
rs957533600 2054 dbSNP
rs1242770242 2058 dbSNP
rs990308871 2059 dbSNP
rs1296922174 2068 dbSNP
rs1036224201 2069 dbSNP
rs1366003147 2070 dbSNP
rs897196698 2072 dbSNP
rs1295627970 2074 dbSNP
rs913352688 2075 dbSNP
rs1370223018 2079 dbSNP
rs929978852 2084 dbSNP
rs868232969 2086 dbSNP
rs1306357456 2095 dbSNP
rs1431720554 2096 dbSNP
rs866169505 2098 dbSNP
rs1048837847 2100 dbSNP
rs888548117 2102 dbSNP
rs1432517365 2103 dbSNP
rs1218739904 2114 dbSNP
rs1201281400 2120 dbSNP
rs1007361141 2123 dbSNP
rs1260912839 2125 dbSNP
rs1051129866 2128 dbSNP
rs542099534 2133 dbSNP
rs1251368792 2134 dbSNP
rs1210092471 2142 dbSNP
rs1310925139 2147 dbSNP
rs1303998414 2151 dbSNP
rs75394392 2155 dbSNP
rs1415586296 2156 dbSNP
rs1286689191 2157 dbSNP
rs571935106 2172 dbSNP
rs1163553466 2173 dbSNP
rs1397380305 2182 dbSNP
rs1380412803 2183 dbSNP
rs1420931929 2192 dbSNP
rs180798686 2195 dbSNP
rs1031255549 2197 dbSNP
rs956902468 2202 dbSNP
rs989168277 2203 dbSNP
rs1359152681 2206 dbSNP
rs1430545472 2210 dbSNP
rs1464192657 2219 dbSNP
rs1480640780 2219 dbSNP
rs1303774552 2220 dbSNP
rs1381718728 2221 dbSNP
rs1410943251 2225 dbSNP
rs1179641752 2228 dbSNP
rs868322240 2235 dbSNP
rs969184922 2236 dbSNP
rs1180804626 2240 dbSNP
rs1314578679 2240 dbSNP
rs980913178 2240 dbSNP
rs1265559337 2246 dbSNP
rs79988895 2248 dbSNP
rs79659029 2250 dbSNP
rs1204793318 2262 dbSNP
rs1328988912 2267 dbSNP
rs942682343 2267 dbSNP
rs1230522881 2271 dbSNP
rs1336548019 2277 dbSNP
rs77217266 2278 dbSNP
rs77353332 2279 dbSNP
rs927848528 2281 dbSNP
rs1394374848 2292 dbSNP
rs564082319 2297 dbSNP
rs1381341216 2299 dbSNP
rs960520976 2301 dbSNP
rs185646048 2305 dbSNP
rs919180287 2311 dbSNP
rs930530190 2318 dbSNP
rs1283884684 2319 dbSNP
rs1316259735 2321 dbSNP
rs1156646405 2324 dbSNP
rs1210659117 2327 dbSNP
rs1364040355 2328 dbSNP
rs1238993255 2329 dbSNP
rs1186331958 2335 dbSNP
rs1421550792 2338 dbSNP
rs1244441292 2344 dbSNP
rs1048405152 2345 dbSNP
rs1464827564 2351 dbSNP
rs867136148 2352 dbSNP
rs909854392 2359 dbSNP
rs942826370 2360 dbSNP
rs1351792612 2361 dbSNP
rs543656909 2363 dbSNP
rs1265086042 2369 dbSNP
rs7309091 2371 dbSNP
rs1361749527 2386 dbSNP
rs998356870 2391 dbSNP
rs1024698981 2392 dbSNP
rs1364410829 2395 dbSNP
rs1052570312 2403 dbSNP
rs1400647794 2404 dbSNP
rs969461373 2408 dbSNP
rs1162354386 2409 dbSNP
rs1001834842 2411 dbSNP
rs1034632303 2412 dbSNP
rs957603988 2415 dbSNP
rs1448310889 2416 dbSNP
rs1388888442 2419 dbSNP
rs990339993 2433 dbSNP
rs913376905 2434 dbSNP
rs868342764 2435 dbSNP
rs1490892867 2441 dbSNP
rs191328159 2448 dbSNP
rs1021985928 2449 dbSNP
rs912609953 2452 dbSNP
rs1336369811 2456 dbSNP
rs969448130 2457 dbSNP
rs1001994064 2460 dbSNP
rs1449172222 2464 dbSNP
rs1367090010 2467 dbSNP
rs1307195531 2474 dbSNP
rs1428560014 2477 dbSNP
rs1034729591 2479 dbSNP
rs960408799 2480 dbSNP
rs1280591020 2483 dbSNP
rs971882453 2485 dbSNP
rs939611572 2489 dbSNP
rs919065492 2493 dbSNP
rs1052611926 2498 dbSNP
rs866918418 2500 dbSNP
rs985098466 2501 dbSNP
rs931214592 2502 dbSNP
rs551061229 2503 dbSNP
rs566950151 2504 dbSNP
rs749814621 2505 dbSNP
rs1274140393 2509 dbSNP
rs1221491298 2510 dbSNP
rs922689608 2512 dbSNP
rs1347101653 2517 dbSNP
rs934033822 2521 dbSNP
rs1231815318 2523 dbSNP
rs527922833 2524 dbSNP
rs1143424 2532 dbSNP
rs1192305645 2533 dbSNP
rs892621266 2537 dbSNP
rs1427835074 2538 dbSNP
rs1011186791 2547 dbSNP
rs1471163114 2547 dbSNP
rs1044361174 2548 dbSNP
rs115092463 2549 dbSNP
rs769348771 2550 dbSNP
rs1182665842 2551 dbSNP
rs1467384576 2559 dbSNP
rs1277852745 2560 dbSNP
rs1201622280 2563 dbSNP
rs1329514233 2566 dbSNP
rs571009854 2568 dbSNP
rs1227441835 2579 dbSNP
rs1034616572 2580 dbSNP
rs538164483 2585 dbSNP
rs1370762533 2586 dbSNP
rs1031992542 2587 dbSNP
rs993185755 2599 dbSNP
rs1280875612 2609 dbSNP
rs7137850 2623 dbSNP
rs1276585886 2629 dbSNP
rs951962593 2644 dbSNP
rs530676854 2647 dbSNP
rs1365397815 2648 dbSNP
rs1471235324 2650 dbSNP
rs762280787 2663 dbSNP
rs1278623842 2669 dbSNP
rs141457185 2675 dbSNP
rs1319648364 2676 dbSNP
rs1159309979 2680 dbSNP
rs1472513910 2681 dbSNP
rs183571698 2690 dbSNP
rs186861598 2698 dbSNP
rs975423381 2704 dbSNP
rs1271788426 2715 dbSNP
rs1243633575 2717 dbSNP
rs922572455 2723 dbSNP
rs776542068 2724 dbSNP
rs967953811 2747 dbSNP
rs1223987686 2749 dbSNP
rs1285919366 2749 dbSNP
rs1451722146 2752 dbSNP
rs986954559 2756 dbSNP
rs1312253752 2758 dbSNP
rs1020151353 2763 dbSNP
rs964095059 2767 dbSNP
rs934086460 2768 dbSNP
rs1347254120 2770 dbSNP
rs988212348 2774 dbSNP
rs931286930 2778 dbSNP
rs914107286 2782 dbSNP
rs544390051 2783 dbSNP
rs879397865 2793 dbSNP
rs1445259327 2795 dbSNP
rs1385799180 2797 dbSNP
rs553482830 2801 dbSNP
rs1199244936 2809 dbSNP
rs946872384 2811 dbSNP
rs983124157 2813 dbSNP
rs1243620080 2815 dbSNP
rs908420067 2816 dbSNP
rs1043861715 2817 dbSNP
rs905453652 2821 dbSNP
rs759527246 2831 dbSNP
rs1359466229 2833 dbSNP
rs1297522889 2844 dbSNP
rs1213322975 2845 dbSNP
rs1056077021 2847 dbSNP
rs896139724 2850 dbSNP
rs1436156200 2867 dbSNP
rs1406090004 2871 dbSNP
rs1305124301 2873 dbSNP
rs1425385273 2878 dbSNP
rs1325593610 2879 dbSNP
rs1348140088 2886 dbSNP
rs1370023781 2888 dbSNP
rs993239766 2891 dbSNP
rs1404258835 2898 dbSNP
rs866926343 2899 dbSNP
rs1421441093 2902 dbSNP
rs1186921594 2909 dbSNP
rs1479961227 2913 dbSNP
rs1266349864 2917 dbSNP
rs904964471 2918 dbSNP
rs937730045 2919 dbSNP
rs571796552 2920 dbSNP
rs1203078019 2931 dbSNP
rs1309811756 2937 dbSNP
rs1296856972 2939 dbSNP
rs764992736 2943 dbSNP
rs1006473948 2944 dbSNP
rs1269302234 2947 dbSNP
rs66754239 2950 dbSNP
rs762839303 2954 dbSNP
rs145154624 2955 dbSNP
rs1029698770 2958 dbSNP
rs955351972 2969 dbSNP
rs1463556981 2974 dbSNP
rs1356231283 2976 dbSNP
rs576147861 2984 dbSNP
rs1426941662 2987 dbSNP
rs913978679 2993 dbSNP
rs946790122 3000 dbSNP
rs1249329781 3010 dbSNP
rs567496656 3033 dbSNP
rs964127959 3035 dbSNP
rs1489499303 3036 dbSNP
rs975484572 3039 dbSNP
rs1027004812 3045 dbSNP
rs543370202 3047 dbSNP
rs561989221 3054 dbSNP
rs1328788069 3061 dbSNP
rs1241802234 3062 dbSNP
rs1305075643 3065 dbSNP
rs1374067448 3068 dbSNP
rs202113349 3068 dbSNP
rs952720745 3068 dbSNP
rs1451812909 3070 dbSNP
rs1403705101 3074 dbSNP
rs938292502 3080 dbSNP
rs1056631676 3081 dbSNP
rs1473256510 3084 dbSNP
rs908492215 3092 dbSNP
rs866216247 3094 dbSNP
rs1420424116 3096 dbSNP
rs928974152 3098 dbSNP
rs191981385 3105 dbSNP
rs1183565494 3106 dbSNP
rs887535953 3115 dbSNP
rs1245467483 3116 dbSNP
rs1204736494 3118 dbSNP
rs1005946482 3125 dbSNP
rs926455507 3126 dbSNP
rs1017878181 3130 dbSNP
rs937803399 3134 dbSNP
rs1053534610 3137 dbSNP
rs1243814361 3138 dbSNP
rs1380517082 3139 dbSNP
rs1159228447 3141 dbSNP
rs1453103929 3142 dbSNP
rs542190981 3152 dbSNP
rs1383964484 3154 dbSNP
rs1286814589 3158 dbSNP
rs900319844 3161 dbSNP
rs997469549 3174 dbSNP
rs560614982 3177 dbSNP
rs1317395592 3183 dbSNP
rs1442189750 3190 dbSNP
rs1387648813 3191 dbSNP
rs1340782672 3198 dbSNP
rs945071378 3200 dbSNP
rs11549743 3204 dbSNP
rs1358168798 3210 dbSNP
rs1207173221 3215 dbSNP
rs1240206771 3225 dbSNP
rs137891643 3231 dbSNP
rs1220363861 3242 dbSNP
rs1361592883 3247 dbSNP
rs1317154812 3255 dbSNP
rs1246605110 3257 dbSNP
rs11549742 3263 dbSNP
rs531903862 3295 dbSNP
rs550233174 3299 dbSNP
rs750957006 3304 dbSNP
rs1203842830 3312 dbSNP
rs1293136549 3313 dbSNP
rs1383665099 3326 dbSNP
rs550773006 3326 dbSNP
rs1261476606 3327 dbSNP
rs1302080418 3334 dbSNP
rs1422221065 3340 dbSNP
rs926815175 3343 dbSNP
rs1041255438 3356 dbSNP
rs959527595 3360 dbSNP
rs996931998 3362 dbSNP
rs992244801 3367 dbSNP
rs1027058949 3373 dbSNP
rs1444125037 3380 dbSNP
rs996882711 3381 dbSNP
rs1179324673 3383 dbSNP
rs918175115 3385 dbSNP
rs1451555132 3387 dbSNP
rs183255805 3388 dbSNP
rs1030066447 3391 dbSNP
rs756736879 3392 dbSNP
rs1004643801 3395 dbSNP
rs1415941326 3399 dbSNP
rs1015580386 3400 dbSNP
rs929530716 3401 dbSNP
rs1381581841 3404 dbSNP
rs1446955319 3407 dbSNP
rs982043648 3415 dbSNP
rs926486206 3416 dbSNP
rs1310828855 3418 dbSNP
rs1047869053 3422 dbSNP
rs1303202339 3433 dbSNP
rs959199980 3438 dbSNP
rs989306766 3439 dbSNP
rs1237563958 3441 dbSNP
rs1170094297 3442 dbSNP
rs908858868 3451 dbSNP
rs1260593976 3455 dbSNP
rs1429026282 3461 dbSNP
rs915033759 3463 dbSNP
rs1202510412 3466 dbSNP
rs941803862 3468 dbSNP
rs1269810732 3470 dbSNP
rs1038776178 3474 dbSNP
rs11549744 3484 dbSNP
rs1436083714 3485 dbSNP
rs1461050470 3490 dbSNP
rs1042476274 3492 dbSNP
rs1197468556 3493 dbSNP
rs1199436227 3503 dbSNP
rs1262242040 3505 dbSNP
rs546988737 3509 dbSNP
rs535018581 3510 dbSNP
rs765285816 3511 dbSNP
rs749563877 3528 dbSNP
rs755380805 3532 dbSNP
rs891732545 3533 dbSNP
rs561970410 3542 dbSNP
rs140770124 3543 dbSNP
rs1378103951 3544 dbSNP
rs1478926569 3557 dbSNP
rs1021399289 3578 dbSNP
rs1174756977 3588 dbSNP
rs557400114 3600 dbSNP
rs1471138018 3601 dbSNP
rs1173969547 3611 dbSNP
rs900085050 3614 dbSNP
rs968066055 3635 dbSNP
rs1048523893 3646 dbSNP
rs1001395953 3652 dbSNP
rs1458138221 3659 dbSNP
rs1033770554 3686 dbSNP
rs959412334 3687 dbSNP
rs992297106 3694 dbSNP
rs1278969108 3698 dbSNP
rs1222848563 3700 dbSNP
rs1347977171 3704 dbSNP
rs540560749 3709 dbSNP
rs918060845 3713 dbSNP
rs1240182690 3717 dbSNP
rs1382739782 3718 dbSNP
rs1335236780 3720 dbSNP
rs950991296 3732 dbSNP
rs970754996 3738 dbSNP
rs983706793 3740 dbSNP
rs1399142493 3746 dbSNP
rs1332172176 3750 dbSNP
rs1444037318 3754 dbSNP
rs1384552072 3756 dbSNP
rs1225831000 3764 dbSNP
rs1181668042 3768 dbSNP
rs1446294248 3769 dbSNP
rs1003510828 3779 dbSNP
rs1214696224 3793 dbSNP
rs1444948099 3794 dbSNP
rs908904342 3797 dbSNP
rs941703058 3804 dbSNP
rs1281779989 3805 dbSNP
rs576181373 3806 dbSNP
rs1039072581 3809 dbSNP
rs537230892 3813 dbSNP
rs1260212385 3818 dbSNP
rs921687431 3822 dbSNP
rs933028527 3825 dbSNP
rs959274720 3834 dbSNP
rs1051617900 3839 dbSNP
rs11549745 3841 dbSNP
rs1479722412 3851 dbSNP
rs891618447 3855 dbSNP
rs1195298872 3856 dbSNP
rs1268047369 3869 dbSNP
rs1363788493 3870 dbSNP
rs1425466629 3871 dbSNP
rs555409042 3874 dbSNP
rs562036881 3875 dbSNP
rs1197107298 3882 dbSNP
rs1243503325 3883 dbSNP
rs773569378 3885 dbSNP
rs1490062597 3888 dbSNP
rs573870860 3889 dbSNP
rs1477997585 3894 dbSNP
rs1134368 3895 dbSNP
rs1272868475 3899 dbSNP
rs1370950134 3902 dbSNP
rs1034065541 3903 dbSNP
rs1461101632 3911 dbSNP
rs1293588411 3914 dbSNP
rs868762860 3916 dbSNP
rs1343775517 3920 dbSNP
rs895252374 3923 dbSNP
rs1458440567 3927 dbSNP
rs1350404393 3928 dbSNP
rs369787015 3928 dbSNP
rs1015481693 3929 dbSNP
rs1170996164 3929 dbSNP
rs1425500683 3929 dbSNP
rs1407336900 3930 dbSNP
rs1479892811 3930 dbSNP
rs10572574 3931 dbSNP
rs1203034912 3931 dbSNP
rs1223232644 3931 dbSNP
rs1297606605 3931 dbSNP
rs1309678193 3931 dbSNP
rs1321712852 3931 dbSNP
rs1372686327 3931 dbSNP
rs1387439652 3931 dbSNP
rs1393014869 3931 dbSNP
rs1439894170 3931 dbSNP
rs1488481372 3931 dbSNP
rs36019402 3931 dbSNP
rs571590192 3931 dbSNP
rs74548623 3931 dbSNP
rs745669748 3931 dbSNP
rs749648819 3931 dbSNP
rs755895344 3931 dbSNP
rs756485098 3931 dbSNP
rs1301788006 3932 dbSNP
rs1345334981 3934 dbSNP
rs1219600454 3935 dbSNP
rs1298086702 3937 dbSNP
rs1305973637 3938 dbSNP
rs1226895212 3939 dbSNP
rs1013605540 3940 dbSNP
rs1361627726 3944 dbSNP
rs966919093 3945 dbSNP
rs1220190538 3946 dbSNP
rs1176038068 3948 dbSNP
rs79492261 3951 dbSNP
rs977888927 3951 dbSNP
rs1268063860 3952 dbSNP
rs1239279608 3953 dbSNP
rs1203441384 3954 dbSNP
rs1488515375 3954 dbSNP
rs1265297421 3955 dbSNP
rs1195565286 3957 dbSNP
rs1304930495 3960 dbSNP
rs1259299469 3961 dbSNP
rs1225490108 3968 dbSNP
rs911593930 3969 dbSNP
rs1427563889 3971 dbSNP
rs1451658429 3975 dbSNP
rs796213291 3988 dbSNP
rs1431595307 3992 dbSNP
rs974376501 3996 dbSNP
rs1344190854 4007 dbSNP
rs1156359052 4008 dbSNP
rs1440931459 4011 dbSNP
rs950876150 4021 dbSNP
rs984149647 4025 dbSNP
rs1016520791 4026 dbSNP
rs577958666 4066 dbSNP
rs974449328 4068 dbSNP
rs1048596650 4074 dbSNP
rs1201294166 4076 dbSNP
rs921576542 4081 dbSNP
rs1259142057 4082 dbSNP
rs1218891641 4084 dbSNP
rs1354426933 4092 dbSNP
rs1309957197 4094 dbSNP
rs933082504 4095 dbSNP
rs1162267541 4097 dbSNP
rs1365503632 4100 dbSNP
rs1401054226 4101 dbSNP
rs1286700102 4102 dbSNP
rs1360602269 4102 dbSNP
rs1360844443 4102 dbSNP
rs1380376727 4102 dbSNP
rs545402158 4102 dbSNP
rs552904611 4102 dbSNP
rs940145037 4102 dbSNP
rs1163551881 4104 dbSNP
rs1423265057 4105 dbSNP
rs1291015988 4108 dbSNP
rs1188716988 4113 dbSNP
rs1196095299 4113 dbSNP
rs1259928168 4113 dbSNP
rs1428216134 4113 dbSNP
rs1291109086 4114 dbSNP
rs1360225283 4114 dbSNP
rs1220293331 4115 dbSNP
rs1245264126 4116 dbSNP
rs1267077671 4116 dbSNP
rs1325628759 4116 dbSNP
rs1354205347 4116 dbSNP
rs1273294270 4117 dbSNP
rs1401429848 4119 dbSNP
rs1302011401 4121 dbSNP
rs1340649522 4121 dbSNP
rs1402507913 4123 dbSNP
rs1393520959 4125 dbSNP
rs1313646370 4127 dbSNP
rs559153122 4129 dbSNP
rs572434455 4129 dbSNP
rs1197372444 4131 dbSNP
rs1453343468 4131 dbSNP
rs1269447091 4132 dbSNP
rs187868895 4133 dbSNP
rs906602756 4133 dbSNP
rs1255892561 4135 dbSNP
rs1220185208 4137 dbSNP
rs1361744727 4137 dbSNP
rs913105000 4138 dbSNP
rs1394910652 4139 dbSNP
rs564580810 4139 dbSNP
rs565592167 4139 dbSNP
rs1333829233 4140 dbSNP
rs531843150 4141 dbSNP
rs1174530515 4142 dbSNP
rs550337228 4142 dbSNP
rs1199557489 4144 dbSNP
rs1437186292 4145 dbSNP
rs1200310919 4148 dbSNP
rs1236244054 4148 dbSNP
rs112007715 4150 dbSNP
rs149881846 4150 dbSNP
rs73419951 4150 dbSNP
rs562290359 4152 dbSNP
rs1312030861 4167 dbSNP
rs1405804058 4173 dbSNP
rs1055071933 4179 dbSNP
rs895138062 4180 dbSNP
rs1403119329 4181 dbSNP
rs1158100368 4185 dbSNP
rs865812963 4189 dbSNP
rs191607114 4190 dbSNP
rs1025010688 4196 dbSNP
rs1258778591 4197 dbSNP
rs886484323 4198 dbSNP
rs1440150859 4202 dbSNP
rs1005061013 4207 dbSNP
rs1182136360 4223 dbSNP
rs1257796645 4231 dbSNP
rs966573979 4242 dbSNP
rs1182434674 4243 dbSNP
rs1204055694 4254 dbSNP
rs1380319105 4264 dbSNP
rs551107753 4267 dbSNP
rs978296552 4268 dbSNP
rs1241468037 4271 dbSNP
rs1016815967 4280 dbSNP
rs1282817646 4281 dbSNP
rs1161860364 4283 dbSNP
rs557211964 4285 dbSNP
rs1341299831 4286 dbSNP
rs965748651 4293 dbSNP
rs569267461 4294 dbSNP
rs1418001710 4310 dbSNP
rs963680951 4311 dbSNP
rs1160421577 4316 dbSNP
rs867754880 4323 dbSNP
rs777238393 4324 dbSNP
rs921615202 4339 dbSNP
rs1453466072 4343 dbSNP
rs1237756227 4348 dbSNP
rs1028694465 4349 dbSNP
rs1385257736 4351 dbSNP
rs954354608 4352 dbSNP
rs1450613336 4356 dbSNP
rs746739187 4363 dbSNP
rs149268415 4365 dbSNP
rs867272698 4371 dbSNP
rs940236033 4377 dbSNP
rs945755896 4381 dbSNP
rs1037604498 4382 dbSNP
rs978633688 4384 dbSNP
rs1304758015 4387 dbSNP
rs925758456 4390 dbSNP
rs1316163654 4391 dbSNP
rs565354070 4392 dbSNP
rs1298904579 4400 dbSNP
rs937303134 4402 dbSNP
rs1055629014 4406 dbSNP
rs1404342658 4407 dbSNP
rs895189108 4408 dbSNP
rs1162588912 4418 dbSNP
rs1406946351 4424 dbSNP
rs1414213673 4429 dbSNP
rs143574336 4445 dbSNP
rs138089997 4446 dbSNP
rs939404949 4447 dbSNP
rs1055186365 4450 dbSNP
rs1193758747 4451 dbSNP
rs1459714773 4452 dbSNP
rs1245540249 4466 dbSNP
rs1046349268 4470 dbSNP
rs182192711 4476 dbSNP
rs1452585811 4477 dbSNP
rs1010875181 4484 dbSNP
rs76370822 4492 dbSNP
rs1279012572 4493 dbSNP
rs1238284468 4494 dbSNP
rs1365581661 4514 dbSNP
rs1291756521 4515 dbSNP
rs1438497478 4518 dbSNP
rs1350351230 4522 dbSNP
rs1470850070 4523 dbSNP
rs1463802697 4525 dbSNP
rs1005354631 4528 dbSNP
rs1037898942 4531 dbSNP
rs143763372 4532 dbSNP
rs375579804 4533 dbSNP
rs573933107 4546 dbSNP
rs1197162252 4547 dbSNP
rs1459361802 4557 dbSNP
rs1259026889 4563 dbSNP
rs996466912 4571 dbSNP
rs567307277 4572 dbSNP
rs1468433524 4575 dbSNP
rs1368222952 4578 dbSNP
rs770413008 4585 dbSNP
rs1336268521 4586 dbSNP
rs1029248810 4589 dbSNP
rs368578312 4604 dbSNP
rs147212266 4605 dbSNP
rs553275358 4606 dbSNP
rs745771518 4609 dbSNP
rs769677504 4613 dbSNP
rs978904747 4615 dbSNP
rs867341369 4621 dbSNP
rs1433191588 4626 dbSNP
rs1372515306 4634 dbSNP
rs756755513 4635 dbSNP
rs1177313205 4646 dbSNP
rs1441976517 4650 dbSNP
rs775521272 4653 dbSNP
rs780859583 4670 dbSNP
rs1239147335 4676 dbSNP
rs984855091 4681 dbSNP
rs925842110 4684 dbSNP
rs958782083 4686 dbSNP
rs910174080 4689 dbSNP
rs1316397894 4694 dbSNP
rs572498431 4700 dbSNP
rs1237831694 4702 dbSNP
rs972955599 4717 dbSNP
rs917173126 4725 dbSNP
rs1395194669 4727 dbSNP
rs949942225 4736 dbSNP
rs1304212630 4738 dbSNP
rs1321103942 4744 dbSNP
rs1046400790 4745 dbSNP
rs745442112 4753 dbSNP
rs907849935 4756 dbSNP
rs940816304 4764 dbSNP
rs762599982 4765 dbSNP
rs1422085907 4768 dbSNP
rs1258273860 4771 dbSNP
rs1439080778 4775 dbSNP
rs114526279 4776 dbSNP
rs996350306 4790 dbSNP
rs1258599243 4804 dbSNP
rs1182659546 4816 dbSNP
rs1488026479 4836 dbSNP
rs1261094948 4839 dbSNP
rs138066648 4846 dbSNP
rs1218815786 4850 dbSNP
rs1355801872 4853 dbSNP
rs1261167599 4857 dbSNP
rs1243808736 4858 dbSNP
rs58815341 4864 dbSNP
rs542780475 4883 dbSNP
rs1339391416 4887 dbSNP
rs763955103 4894 dbSNP
rs1401227062 4898 dbSNP
rs527279999 4901 dbSNP
rs1431935040 4923 dbSNP
rs140719350 4924 dbSNP
rs141394033 4955 dbSNP
rs999860526 4958 dbSNP
rs999987900 4959 dbSNP
rs1326952672 4961 dbSNP
rs1165811433 4962 dbSNP
rs1033177853 4963 dbSNP
rs958414676 4968 dbSNP
rs1421699449 4969 dbSNP
rs77771283 4970 dbSNP
rs1488623826 4971 dbSNP
rs150822635 4972 dbSNP
rs1209136785 4977 dbSNP
rs971311799 4989 dbSNP
rs1267020917 4993 dbSNP
rs762188007 4999 dbSNP
rs907905512 5010 dbSNP
rs940687382 5017 dbSNP
rs1220003463 5026 dbSNP
rs14143 5026 dbSNP
rs1404072806 5027 dbSNP
rs750573322 5034 dbSNP
rs1323525577 5039 dbSNP
rs920687704 5040 dbSNP
rs932028362 5045 dbSNP
rs1278513574 5058 dbSNP
rs1294516721 5065 dbSNP
rs951794670 5072 dbSNP
rs1050605759 5076 dbSNP
rs1212376838 5077 dbSNP
rs1271684096 5078 dbSNP
rs34136429 5092 dbSNP
rs377042579 5099 dbSNP
rs1377118734 5101 dbSNP
rs944974370 5107 dbSNP
rs1431400157 5111 dbSNP
rs961706755 5112 dbSNP
rs1223952666 5114 dbSNP
rs1271646275 5128 dbSNP
rs1457146932 5131 dbSNP
rs534174161 5131 dbSNP
rs111686176 5132 dbSNP
rs1000276396 5142 dbSNP
rs1339538267 5147 dbSNP
rs76718908 5148 dbSNP
rs188120654 5149 dbSNP
rs1333336379 5159 dbSNP
rs756297211 5165 dbSNP
rs766734731 5167 dbSNP
rs1398520872 5173 dbSNP
rs1333676219 5190 dbSNP
rs1166333026 5191 dbSNP
rs1401720006 5202 dbSNP
rs1418925968 5209 dbSNP
rs754372321 5218 dbSNP
rs1024122214 5219 dbSNP
rs79816012 5222 dbSNP
rs982760127 5229 dbSNP
rs368320969 5232 dbSNP
rs779388546 5234 dbSNP
rs1433026932 5245 dbSNP
rs1043788303 5257 dbSNP
rs1423834669 5265 dbSNP
rs746641512 5271 dbSNP
rs537650811 5291 dbSNP
rs1277394871 5292 dbSNP
rs1198245007 5296 dbSNP
rs1346489068 5306 dbSNP
rs1281747375 5315 dbSNP
rs1240031661 5322 dbSNP
rs1040275280 5325 dbSNP
rs1327909132 5326 dbSNP
rs1428248928 5328 dbSNP
rs901760061 5333 dbSNP
rs1332425244 5339 dbSNP
rs756942540 5340 dbSNP
rs1402959081 5349 dbSNP
rs920585839 5353 dbSNP
rs1050197993 5364 dbSNP
rs887557498 5370 dbSNP
rs1294661203 5372 dbSNP
rs772518805 5373 dbSNP
rs1160240230 5380 dbSNP
rs932082269 5397 dbSNP
rs773242770 5401 dbSNP
rs962017998 5405 dbSNP
rs1002511087 5407 dbSNP
rs1257631931 5408 dbSNP
rs1215212775 5410 dbSNP
rs1352158610 5413 dbSNP
rs1285434149 5414 dbSNP
rs986205280 5421 dbSNP
rs1288713685 5430 dbSNP
rs912103170 5433 dbSNP
rs530638787 5435 dbSNP
rs1282686067 5437 dbSNP
rs1450436633 5441 dbSNP
rs1035308228 5450 dbSNP
rs1297689465 5463 dbSNP
rs960947474 5467 dbSNP
rs1358563639 5469 dbSNP
rs1241709505 5478 dbSNP
rs1320190231 5486 dbSNP
rs1041854478 5502 dbSNP
rs192847728 5512 dbSNP
rs1161193198 5516 dbSNP
rs760900970 5516 dbSNP
rs936243831 5516 dbSNP
rs1473593834 5525 dbSNP
rs1023820426 5528 dbSNP
rs1192317756 5531 dbSNP
rs540235698 5531 dbSNP
rs35790825 5532 dbSNP
rs1288190817 5533 dbSNP
rs532475414 5533 dbSNP
rs67757795 5533 dbSNP
rs779264801 5533 dbSNP
rs35702301 5534 dbSNP
rs1230344265 5535 dbSNP
rs1335726937 5535 dbSNP
rs1277738893 5536 dbSNP
rs1054554561 5538 dbSNP
rs1216935724 5540 dbSNP
rs548769452 5549 dbSNP
rs976050830 5550 dbSNP
rs1423934596 5552 dbSNP
rs1321346338 5553 dbSNP
rs1349191114 5553 dbSNP
rs923214707 5556 dbSNP
rs1394841666 5560 dbSNP
rs116102034 5562 dbSNP
rs1476579614 5563 dbSNP
rs1024007275 5565 dbSNP
rs1386895076 5576 dbSNP
rs1186541162 5589 dbSNP
rs1478004234 5590 dbSNP
rs201147845 5590 dbSNP
rs1224249384 5605 dbSNP
rs1317284125 5616 dbSNP
rs906924732 5616 dbSNP
rs1004463614 5618 dbSNP
rs1454197594 5631 dbSNP
rs550927580 5634 dbSNP
rs1366836125 5635 dbSNP
rs1381356200 5640 dbSNP
rs111608506 5650 dbSNP
rs1330324235 5650 dbSNP
rs1371427540 5650 dbSNP
rs1463753156 5659 dbSNP
rs962971585 5664 dbSNP
rs1355878377 5665 dbSNP
rs1036530548 5673 dbSNP
rs534787199 5675 dbSNP
rs780852991 5681 dbSNP
rs1280628373 5684 dbSNP
rs1196048854 5685 dbSNP
rs1455010284 5687 dbSNP
rs1027689427 5688 dbSNP
rs1203747960 5689 dbSNP
rs953355117 5695 dbSNP
rs986089347 5696 dbSNP
rs1177118693 5709 dbSNP
rs911988466 5743 dbSNP
rs1035339240 5746 dbSNP
rs1283892767 5748 dbSNP
rs1461949523 5760 dbSNP
rs894115472 5780 dbSNP
rs866479137 5791 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1