miRTarBase - #MIRT023352 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CPNE4   
Synonyms COPN4, CPN4
Description copine 4
Transcript NM_130808   
Expression
Putative miRNA Targets on CPNE4
3'UTR of CPNE4
(miRNA target sites are highlighted)
>CPNE4|NM_130808|3'UTR
   1 ACTCCCCACACAGTTTTACAGAGTTCTGAAATACTATTCCTGCTAATATTTCATATTTAATACTTCTACTACTCCTGTAC
  81 TTTAAAAAACCAACAACATATACACATTTAAAAATAGCACGTTTTGGTGATTTTTAACTATCTGACAATTTTTTTTGCAT
 161 GTGTAGCCCTGAGGCCTGGATCTGTTAAGCCCTTGTATTGTTAACTTTTTACAAAGAAACACAGATAACAATAACTTACT
 241 ATTTACATTACAGCATGTCGCCTTGAAATAAAATGGTATCTGTATCCATTTTTTATACAGGTTTGTTGAAATTTTGCTAA
 321 ATTTCTTATCTTTACACTCTAAAGCATTTTGAAACATTTACTGAATGTTGATAGACGAAATATACTTGGTTTTATCTGCT
 401 ATAGGATGAGAGACTTTTTAAAATGGCAGATGCATGGACTGTATTTTGCATGTTTAAAATAAAAAAAGAAAAACCCACAT
 481 GGTTTTTGCAGTTGTTATCTCTAATTCCTCCCTGCTGAGAATGGTCTCTCTACTAAAGAAGAGGTTTATTTACTTCTTCT
 561 TTCTGAGGTGAGTCTTTTTGAGGTAAGTCTGGGTCATCTAGCCCAGCACCTCTCATACTTTATACTGTGTACACAAATCA
 641 CCTGAGAGTCTTATTAAAATTCAGATTGTGATACATAGGTCTGTGTGGGACCCAAGATTCTGCATCTTTAACTAGGTCCC
 721 AGGTGATGCTAATGCAGTCCCTGGACTATACCAAGAGGAGTGAGGATCTAGACTTTAGGGTGTCATGATGGAGACCATCA
 801 AAAACAGCGTGGCTTCTAGTCTGCTTGAGAATGGCACCTCTTCCTGACAGTAGCACAAAAGTCCTGCCTGTCTCCAGAGG
 881 TGACAGTAGAAAGTAATGAGACTGACTCCAGAAGCTGCACACCTCAAATCAGTCTCGCTGCTTTATACTCACACCTCTTC
 961 CTTAGATAAGACTAGAAAGTGCTCCTCCTGGCCAGTCCCTGCCCTCTTAAAAGTGGCATCACACACCACTGCATGGATGG
1041 TGTCAATCCCTAGAAGTGATCTCAAAGCGTCTTCACTGGAACCACAACAATAGAAACTTACACATGGCAAATGGCTATGC
1121 AGTACAGCTCCCGATATCTGGTCCACTAAATTGACCTTTGAGCTTAGTGTGGGAATTTCTTGCCTCCTTTCTATCACTTC
1201 TGAGAACAAATTCTATAAGCAGAAATGCCTGGAATTATTGTCTGGGGTCGAGGTGTTTTGTTTCAATATAAGCTGGCCAG
1281 TCTGGAACCAAAAGGACGAATGTTTAACTTGTATAATCTTCTTGCAGGGAAACAGGCAAGTGTTTTTGCAAGCATAAAAG
1361 GCACAAAGTGGAGTTTATTTTTGGTCAGAGAGATGAAGAAGTAAATCACAAGGCAAAATTTGTTGTTTGTTTGAAGAGGG
1441 GAGCAGTATTAACAAGCAAATAAAATGCCTTCTATGATTTCCACAGTTACAATTATAGATCCTAATCTTGCAAATACATG
1521 TCACCAAATGCACAACATTTTGGGAATGATGGTAAAATTGTATGACTGAAAAAATCATAAATATTTAAGCTATATTGTTT
1601 TATTAATAAATTGGGTACTTACAGAATTCTTCTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGG--UAACAGUGUGAGGu 5'
            ||: :|  ||  |:||||||: 
Target 5' taAATTTCTTATCTTTACACTCTa 3'
318 - 341 138.00 -11.60
2
miRNA  3' guUUGU--GGUA-ACAGUGUGAGGu 5'
            ||:|  :||| | | |:|||:| 
Target 5' ctAATATTTCATATTTAATACTTCt 3'
43 - 67 126.00 -6.90
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |::: ||   |||||| || 
Target 5' aaAGTGGCA---TCACACACCa 3'
1010 - 1028 121.00 -13.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5520367 9 COSMIC
COSN26971723 16 COSMIC
COSN30476067 21 COSMIC
COSN32052583 23 COSMIC
COSN30142451 26 COSMIC
COSN30112909 43 COSMIC
COSN30156225 57 COSMIC
COSN30119474 58 COSMIC
COSN30693225 63 COSMIC
COSN30179028 67 COSMIC
COSN28310472 84 COSMIC
COSN31580911 85 COSMIC
COSN14032750 94 COSMIC
COSN26440818 116 COSMIC
COSN1267608 148 COSMIC
COSN20099083 148 COSMIC
COSN32077547 171 COSMIC
COSN14938441 228 COSMIC
COSN23016221 253 COSMIC
COSN5520366 261 COSMIC
COSN31519820 301 COSMIC
COSN21940240 354 COSMIC
COSN23016220 370 COSMIC
COSN29427929 418 COSMIC
COSN32063082 872 COSMIC
COSN26148729 902 COSMIC
COSN20843793 1147 COSMIC
COSN28202189 1222 COSMIC
COSN9237101 1508 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1431019818 1 dbSNP
rs956241167 7 dbSNP
rs747869015 12 dbSNP
rs1477583787 13 dbSNP
rs778805293 15 dbSNP
rs754800672 20 dbSNP
rs1487982526 26 dbSNP
rs753750526 29 dbSNP
rs1177448093 31 dbSNP
rs774686399 32 dbSNP
rs1208220585 41 dbSNP
rs1324455871 44 dbSNP
rs1413109295 45 dbSNP
rs766403339 46 dbSNP
rs756087822 50 dbSNP
rs1033555100 55 dbSNP
rs1413651547 56 dbSNP
rs1411947740 68 dbSNP
rs1406020272 69 dbSNP
rs1052417512 71 dbSNP
rs1352952915 92 dbSNP
rs978923987 93 dbSNP
rs970333537 101 dbSNP
rs903932235 103 dbSNP
rs748529892 107 dbSNP
rs1050500165 115 dbSNP
rs557575739 120 dbSNP
rs1458590462 121 dbSNP
rs1412661815 126 dbSNP
rs1229517524 128 dbSNP
rs766898809 131 dbSNP
rs545582295 136 dbSNP
rs1026414353 147 dbSNP
rs1180552676 157 dbSNP
rs397761002 157 dbSNP
rs5852629 157 dbSNP
rs1474930337 159 dbSNP
rs575052239 163 dbSNP
rs907584476 167 dbSNP
rs1366728364 171 dbSNP
rs1248990374 173 dbSNP
rs1473438251 174 dbSNP
rs530909381 175 dbSNP
rs1165528456 176 dbSNP
rs1411638307 181 dbSNP
rs555049002 187 dbSNP
rs1189705600 190 dbSNP
rs1169455286 191 dbSNP
rs1443274694 198 dbSNP
rs1037534591 208 dbSNP
rs1407734965 212 dbSNP
rs951679744 216 dbSNP
rs535913028 218 dbSNP
rs889060319 223 dbSNP
rs979854177 226 dbSNP
rs36004259 228 dbSNP
rs568398708 231 dbSNP
rs753358858 234 dbSNP
rs1228574121 235 dbSNP
rs1276325887 246 dbSNP
rs1339680932 247 dbSNP
rs1024131211 253 dbSNP
rs933019357 259 dbSNP
rs1443363441 260 dbSNP
rs1190156266 274 dbSNP
rs913529117 279 dbSNP
rs1010595916 281 dbSNP
rs987910997 291 dbSNP
rs1236296887 296 dbSNP
rs553312567 298 dbSNP
rs535056594 319 dbSNP
rs1392233472 320 dbSNP
rs978955076 327 dbSNP
rs1168231898 333 dbSNP
rs189565315 353 dbSNP
rs1415974285 372 dbSNP
rs541493012 376 dbSNP
rs552864588 377 dbSNP
rs1435149096 382 dbSNP
rs1023242791 385 dbSNP
rs1299233666 389 dbSNP
rs903830914 393 dbSNP
rs1227155477 401 dbSNP
rs993461508 402 dbSNP
rs149876719 420 dbSNP
rs796244454 420 dbSNP
rs1202622903 424 dbSNP
rs1277086201 440 dbSNP
rs1437040869 441 dbSNP
rs960078498 449 dbSNP
rs531131808 461 dbSNP
rs1389033202 466 dbSNP
rs1026691234 479 dbSNP
rs993508697 482 dbSNP
rs868366456 488 dbSNP
rs902032686 497 dbSNP
rs899278275 503 dbSNP
rs1459874662 525 dbSNP
rs1040542314 529 dbSNP
rs1016287503 532 dbSNP
rs908140526 543 dbSNP
rs1405233002 544 dbSNP
rs1457654158 547 dbSNP
rs1473142153 562 dbSNP
rs375168469 562 dbSNP
rs1007370196 568 dbSNP
rs1394992261 569 dbSNP
rs1332505511 570 dbSNP
rs984967560 573 dbSNP
rs1273395029 582 dbSNP
rs930332309 593 dbSNP
rs888924979 596 dbSNP
rs926952245 599 dbSNP
rs775056341 601 dbSNP
rs1204696566 605 dbSNP
rs980290142 609 dbSNP
rs1051643944 617 dbSNP
rs1197050106 622 dbSNP
rs1186844802 632 dbSNP
rs1472796307 648 dbSNP
rs1451721788 649 dbSNP
rs933199066 652 dbSNP
rs75410428 668 dbSNP
rs1249105255 672 dbSNP
rs185050252 673 dbSNP
rs1213443645 684 dbSNP
rs1167819940 688 dbSNP
rs1450444154 690 dbSNP
rs892381464 702 dbSNP
rs1384676979 718 dbSNP
rs1322480657 720 dbSNP
rs1209946135 734 dbSNP
rs1410890140 735 dbSNP
rs1290748433 739 dbSNP
rs1327749649 743 dbSNP
rs1338121906 747 dbSNP
rs116546444 749 dbSNP
rs1189440007 757 dbSNP
rs936338847 758 dbSNP
rs528967547 760 dbSNP
rs1032932110 761 dbSNP
rs1302487231 762 dbSNP
rs1438419080 771 dbSNP
rs1249505551 773 dbSNP
rs191273236 779 dbSNP
rs1324068519 780 dbSNP
rs1406037280 785 dbSNP
rs1395778564 791 dbSNP
rs1369624145 801 dbSNP
rs968068910 804 dbSNP
rs1166791199 808 dbSNP
rs546571551 809 dbSNP
rs781474182 817 dbSNP
rs1193446540 835 dbSNP
rs1477222152 836 dbSNP
rs375484817 837 dbSNP
rs1248990779 848 dbSNP
rs1314068044 853 dbSNP
rs993095332 855 dbSNP
rs1342279441 858 dbSNP
rs1242790182 883 dbSNP
rs1291282801 893 dbSNP
rs960605957 898 dbSNP
rs1343204348 902 dbSNP
rs919507706 904 dbSNP
rs1207589550 916 dbSNP
rs901917673 917 dbSNP
rs1200129553 918 dbSNP
rs1480189940 923 dbSNP
rs972501162 932 dbSNP
rs963328841 935 dbSNP
rs1016320486 936 dbSNP
rs1005008034 937 dbSNP
rs1421538216 945 dbSNP
rs774218433 946 dbSNP
rs1182487404 948 dbSNP
rs953221356 952 dbSNP
rs886584360 955 dbSNP
rs1450888320 960 dbSNP
rs574289199 964 dbSNP
rs1353049860 968 dbSNP
rs138806459 972 dbSNP
rs1206668976 979 dbSNP
rs930884948 984 dbSNP
rs1303932932 986 dbSNP
rs572484878 992 dbSNP
rs997352172 997 dbSNP
rs1314413435 998 dbSNP
rs892407308 1001 dbSNP
rs1217283396 1003 dbSNP
rs1295696840 1013 dbSNP
rs755370638 1019 dbSNP
rs114815806 1032 dbSNP
rs370779650 1035 dbSNP
rs1210636852 1040 dbSNP
rs1275371113 1056 dbSNP
rs564047296 1061 dbSNP
rs1000959703 1062 dbSNP
rs542166530 1069 dbSNP
rs1044846626 1084 dbSNP
rs947749021 1085 dbSNP
rs1248056981 1091 dbSNP
rs917668317 1091 dbSNP
rs1450796298 1101 dbSNP
rs955870168 1104 dbSNP
rs925762871 1105 dbSNP
rs749371985 1112 dbSNP
rs1379757997 1118 dbSNP
rs1431672726 1120 dbSNP
rs1057491717 1124 dbSNP
rs1437443632 1132 dbSNP
rs778018434 1133 dbSNP
rs1361574858 1142 dbSNP
rs1219563283 1143 dbSNP
rs919524817 1151 dbSNP
rs1321188260 1152 dbSNP
rs1413135547 1166 dbSNP
rs1268702264 1169 dbSNP
rs1427621021 1174 dbSNP
rs1173525863 1181 dbSNP
rs1206329823 1187 dbSNP
rs1241138371 1191 dbSNP
rs972316754 1193 dbSNP
rs1192601452 1196 dbSNP
rs868495424 1197 dbSNP
rs1269832896 1214 dbSNP
rs1250226567 1215 dbSNP
rs1176320561 1238 dbSNP
rs769957673 1239 dbSNP
rs1318530895 1247 dbSNP
rs986181372 1249 dbSNP
rs1183770078 1250 dbSNP
rs146655727 1253 dbSNP
rs1437403967 1269 dbSNP
rs747166025 1276 dbSNP
rs1029439681 1280 dbSNP
rs1483066802 1290 dbSNP
rs545643788 1297 dbSNP
rs575115341 1298 dbSNP
rs77773840 1301 dbSNP
rs1282898147 1311 dbSNP
rs1321801261 1330 dbSNP
rs528481547 1333 dbSNP
rs1031351459 1336 dbSNP
rs1489961108 1338 dbSNP
rs1004896611 1346 dbSNP
rs1253136075 1348 dbSNP
rs1473829968 1355 dbSNP
rs1000752658 1370 dbSNP
rs1407259795 1375 dbSNP
rs903526380 1382 dbSNP
rs1044789094 1384 dbSNP
rs541989488 1388 dbSNP
rs1364017698 1390 dbSNP
rs1423743805 1422 dbSNP
rs1308360416 1431 dbSNP
rs1439852060 1434 dbSNP
rs751756850 1434 dbSNP
rs1290085646 1440 dbSNP
rs1229602929 1445 dbSNP
rs376337126 1449 dbSNP
rs1358346172 1456 dbSNP
rs1275745235 1468 dbSNP
rs906107949 1469 dbSNP
rs1045009271 1474 dbSNP
rs1351109875 1479 dbSNP
rs1202962927 1480 dbSNP
rs1232864489 1484 dbSNP
rs1473163237 1490 dbSNP
rs1302496572 1493 dbSNP
rs1383488374 1493 dbSNP
rs1444196164 1497 dbSNP
rs949751431 1504 dbSNP
rs1372118602 1505 dbSNP
rs1361106193 1507 dbSNP
rs1335316781 1509 dbSNP
rs755453996 1513 dbSNP
rs1056197227 1515 dbSNP
rs1359714999 1518 dbSNP
rs560368969 1519 dbSNP
rs1410445631 1520 dbSNP
rs1312219757 1547 dbSNP
rs1161923788 1550 dbSNP
rs934378928 1550 dbSNP
rs1228598323 1554 dbSNP
rs925815055 1557 dbSNP
rs540175420 1558 dbSNP
rs1341890020 1560 dbSNP
rs953977008 1576 dbSNP
rs938865436 1593 dbSNP
rs1443450893 1597 dbSNP
rs186811510 1602 dbSNP
rs758916033 1603 dbSNP
rs1241286886 1604 dbSNP
rs966082751 1614 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1