miRTarBase - #MIRT023355 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DYNC1H1   
Synonyms CMT2O, DHC1, DHC1a, DNCH1, DNCL, DNECL, DYHC, Dnchc1, HL-3, SMALED1, p22
Description dynein cytoplasmic 1 heavy chain 1
Transcript NM_001376   
Expression
Putative miRNA Targets on DYNC1H1
3'UTR of DYNC1H1
(miRNA target sites are highlighted)
>DYNC1H1|NM_001376|3'UTR
   1 ACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTG
  81 AGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGA
 161 AGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCAAAAA
 241 AAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGgu 5'
            :|:||||  |  ::|:|:  
Target 5' agGATACCA-GGAGGTATTTgg 3'
161 - 181 71.00 -7.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
880971 71 ClinVar
312669 109 ClinVar
312670 191 ClinVar
312671 195 ClinVar
880972 195 ClinVar
312672 233 ClinVar
1195419 254 ClinVar
COSN28201498 24 COSMIC
COSN31584312 35 COSMIC
COSN30625755 48 COSMIC
COSN24404026 58 COSMIC
COSN30115301 70 COSMIC
COSN31506622 87 COSMIC
COSN30516832 116 COSMIC
COSN31488456 125 COSMIC
COSN31488633 129 COSMIC
COSN1164407 139 COSMIC
COSN31560723 150 COSMIC
COSN21966453 790 COSMIC
COSN29315423 1035 COSMIC
COSN24997208 1782 COSMIC
COSN16907207 1922 COSMIC
COSN1164408 2479 COSMIC
COSN29903722 2902 COSMIC
COSN23744315 3192 COSMIC
COSN7429119 3333 COSMIC
COSN4754090 3601 COSMIC
COSN26115686 3982 COSMIC
COSN7429120 4827 COSMIC
COSN23777321 4828 COSMIC
COSN17241295 5001 COSMIC
COSN21205892 5122 COSMIC
COSN29145584 5572 COSMIC
COSN16449425 5768 COSMIC
COSN23667299 5847 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752993216 3 dbSNP
rs369843891 4 dbSNP
rs201172648 7 dbSNP
rs373958856 8 dbSNP
rs750346749 14 dbSNP
rs756094783 15 dbSNP
rs377622586 16 dbSNP
rs1331271953 17 dbSNP
rs1370958664 22 dbSNP
rs192484803 27 dbSNP
rs778001864 33 dbSNP
rs747226477 36 dbSNP
rs920437953 37 dbSNP
rs757608391 40 dbSNP
rs781457785 41 dbSNP
rs1212822529 48 dbSNP
rs1344488580 48 dbSNP
rs746366475 51 dbSNP
rs1278419172 56 dbSNP
rs986662396 57 dbSNP
rs924321640 59 dbSNP
rs558207531 63 dbSNP
rs1368521468 69 dbSNP
rs1047475161 71 dbSNP
rs989801166 76 dbSNP
rs1307417294 77 dbSNP
rs1429792032 87 dbSNP
rs1043826 94 dbSNP
rs1371921773 95 dbSNP
rs1457384371 97 dbSNP
rs895520233 100 dbSNP
rs914312002 101 dbSNP
rs1425438104 103 dbSNP
rs948467092 106 dbSNP
rs886050378 109 dbSNP
rs1291676660 111 dbSNP
rs1044610372 113 dbSNP
rs553637804 124 dbSNP
rs369981722 127 dbSNP
rs555252614 128 dbSNP
rs745359136 129 dbSNP
rs1210262936 138 dbSNP
rs905484310 139 dbSNP
rs35480752 142 dbSNP
rs771670829 152 dbSNP
rs1397989434 158 dbSNP
rs574984154 167 dbSNP
rs1006636666 170 dbSNP
rs1348327118 171 dbSNP
rs1287625986 172 dbSNP
rs1321164578 175 dbSNP
rs1410308002 181 dbSNP
rs13901 191 dbSNP
rs566606862 195 dbSNP
rs1010116370 196 dbSNP
rs996203884 206 dbSNP
rs577495983 207 dbSNP
rs955206427 213 dbSNP
rs1236719743 214 dbSNP
rs367578663 229 dbSNP
rs17512996 233 dbSNP
rs955946032 234 dbSNP
rs1483660694 236 dbSNP
rs184850570 239 dbSNP
rs1213979208 240 dbSNP
rs914228143 252 dbSNP
rs970232833 253 dbSNP
rs17513003 254 dbSNP
rs17513010 255 dbSNP
rs938838588 258 dbSNP
rs920466826 263 dbSNP
rs1047887093 269 dbSNP
rs529919249 269 dbSNP
rs1379309624 272 dbSNP
rs929161325 274 dbSNP
rs546789509 276 dbSNP
rs983680175 277 dbSNP
rs917041211 282 dbSNP
rs942267911 283 dbSNP
rs1164746306 289 dbSNP
rs1397818738 297 dbSNP
rs1424451949 308 dbSNP
rs1415991502 310 dbSNP
rs780123419 312 dbSNP
rs566365689 313 dbSNP
rs1248893600 317 dbSNP
rs1467809892 320 dbSNP
rs1209106263 322 dbSNP
rs538442980 324 dbSNP
rs1271161261 328 dbSNP
rs996256272 330 dbSNP
rs949793982 332 dbSNP
rs575000400 336 dbSNP
rs1051792422 337 dbSNP
rs1363997300 345 dbSNP
rs905556415 347 dbSNP
rs747320203 350 dbSNP
rs1392806678 351 dbSNP
rs1341743706 353 dbSNP
rs1458833050 354 dbSNP
rs1008021277 357 dbSNP
rs935631339 359 dbSNP
rs773621054 360 dbSNP
rs1391012808 361 dbSNP
rs1451070104 362 dbSNP
rs113681629 363 dbSNP
rs1009777695 364 dbSNP
rs1488726613 369 dbSNP
rs1267212141 377 dbSNP
rs1202404424 390 dbSNP
rs1021522287 395 dbSNP
rs890573159 396 dbSNP
rs1274888262 403 dbSNP
rs1230097189 405 dbSNP
rs1021746425 410 dbSNP
rs1008998760 411 dbSNP
rs969702025 412 dbSNP
rs1185244987 415 dbSNP
rs1429150888 421 dbSNP
rs1371296055 430 dbSNP
rs34891999 434 dbSNP
rs537847990 447 dbSNP
rs189355213 448 dbSNP
rs1190608 452 dbSNP
rs1433629781 456 dbSNP
rs1269340119 458 dbSNP
rs1417165895 465 dbSNP
rs973365820 466 dbSNP
rs1027604942 468 dbSNP
rs950688123 471 dbSNP
rs1482702949 472 dbSNP
rs983325635 473 dbSNP
rs534258084 474 dbSNP
rs1206688765 479 dbSNP
rs942300107 483 dbSNP
rs1342367335 489 dbSNP
rs1434637383 490 dbSNP
rs1234413641 494 dbSNP
rs1177061502 498 dbSNP
rs1314349065 500 dbSNP
rs917085362 511 dbSNP
rs1464722435 514 dbSNP
rs949865794 519 dbSNP
rs374597971 527 dbSNP
rs1351676660 529 dbSNP
rs1413024701 530 dbSNP
rs148732327 530 dbSNP
rs935703478 531 dbSNP
rs1054527860 537 dbSNP
rs546411178 539 dbSNP
rs1276808623 551 dbSNP
rs1370205152 559 dbSNP
rs562980094 564 dbSNP
rs1053384442 570 dbSNP
rs1301008253 570 dbSNP
rs538132702 571 dbSNP
rs1183701360 572 dbSNP
rs1440262615 576 dbSNP
rs1255007466 581 dbSNP
rs1200723946 589 dbSNP
rs752516011 596 dbSNP
rs58030616 600 dbSNP
rs1228165665 608 dbSNP
rs1330351671 611 dbSNP
rs542232811 617 dbSNP
rs1287589632 624 dbSNP
rs763834279 626 dbSNP
rs1488307912 627 dbSNP
rs1383081624 638 dbSNP
rs1009028496 643 dbSNP
rs1389279894 645 dbSNP
rs1021550143 652 dbSNP
rs1161333603 653 dbSNP
rs1471510206 657 dbSNP
rs1478965921 660 dbSNP
rs1367329499 670 dbSNP
rs1191617770 676 dbSNP
rs1425113107 685 dbSNP
rs1424182922 686 dbSNP
rs192523201 687 dbSNP
rs148449197 692 dbSNP
rs751672163 692 dbSNP
rs1465665097 693 dbSNP
rs1491030434 693 dbSNP
rs376541147 693 dbSNP
rs76566190 693 dbSNP
rs1001220027 695 dbSNP
rs1284787392 696 dbSNP
rs1247104914 706 dbSNP
rs527671872 706 dbSNP
rs546622526 713 dbSNP
rs1297229245 714 dbSNP
rs1434046144 716 dbSNP
rs1389166537 717 dbSNP
rs560004194 720 dbSNP
rs900578048 725 dbSNP
rs1403497177 727 dbSNP
rs1389925652 734 dbSNP
rs1459043019 735 dbSNP
rs994875916 736 dbSNP
rs141469051 743 dbSNP
rs1316856695 746 dbSNP
rs1352182286 753 dbSNP
rs1250250522 754 dbSNP
rs1015548171 756 dbSNP
rs963570685 758 dbSNP
rs184434709 759 dbSNP
rs568632814 762 dbSNP
rs113073185 763 dbSNP
rs548250926 779 dbSNP
rs567990382 780 dbSNP
rs927086413 787 dbSNP
rs533781715 791 dbSNP
rs554546923 792 dbSNP
rs1434042072 793 dbSNP
rs911872740 800 dbSNP
rs912902633 811 dbSNP
rs1406225411 812 dbSNP
rs1368110100 813 dbSNP
rs945708034 815 dbSNP
rs1260421247 816 dbSNP
rs935451007 818 dbSNP
rs1171173650 823 dbSNP
rs1477945479 827 dbSNP
rs1201706103 828 dbSNP
rs1247770692 828 dbSNP
rs1482372848 830 dbSNP
rs1043033662 839 dbSNP
rs1245941880 851 dbSNP
rs1205962645 854 dbSNP
rs1439172299 855 dbSNP
rs1276840633 860 dbSNP
rs1217257943 862 dbSNP
rs1344082549 863 dbSNP
rs1275247910 866 dbSNP
rs1052521005 872 dbSNP
rs1182128153 872 dbSNP
rs370597018 873 dbSNP
rs1409966461 879 dbSNP
rs1466929899 880 dbSNP
rs374402208 897 dbSNP
rs1331838889 898 dbSNP
rs1414241468 909 dbSNP
rs1426251187 913 dbSNP
rs944888948 916 dbSNP
rs1180755716 923 dbSNP
rs1238945910 929 dbSNP
rs893847221 933 dbSNP
rs1439319385 942 dbSNP
rs1484115069 947 dbSNP
rs1235912057 951 dbSNP
rs1039216009 952 dbSNP
rs1443246733 956 dbSNP
rs1043257630 974 dbSNP
rs905791116 977 dbSNP
rs900609137 979 dbSNP
rs995316136 980 dbSNP
rs1035379456 981 dbSNP
rs1446778308 983 dbSNP
rs1164646420 986 dbSNP
rs1049123525 989 dbSNP
rs1359381921 995 dbSNP
rs571118735 997 dbSNP
rs1004852921 998 dbSNP
rs1420932129 1006 dbSNP
rs150816754 1006 dbSNP
rs1014685901 1007 dbSNP
rs1189458692 1010 dbSNP
rs1449387297 1015 dbSNP
rs1024678074 1023 dbSNP
rs556769413 1027 dbSNP
rs189708764 1036 dbSNP
rs1267406862 1048 dbSNP
rs1209227890 1049 dbSNP
rs561400747 1049 dbSNP
rs745640880 1049 dbSNP
rs973616899 1049 dbSNP
rs1227252725 1052 dbSNP
rs1379427007 1053 dbSNP
rs953661663 1054 dbSNP
rs1433306088 1056 dbSNP
rs1034132892 1063 dbSNP
rs957173184 1064 dbSNP
rs1460882071 1066 dbSNP
rs879686836 1068 dbSNP
rs17513018 1069 dbSNP
rs1190609 1070 dbSNP
rs967455347 1073 dbSNP
rs935351999 1076 dbSNP
rs988507080 1080 dbSNP
rs1387283236 1081 dbSNP
rs986474322 1089 dbSNP
rs1449119015 1093 dbSNP
rs915346885 1094 dbSNP
rs1288981344 1097 dbSNP
rs1332414625 1099 dbSNP
rs912186471 1100 dbSNP
rs944920394 1115 dbSNP
rs553012895 1129 dbSNP
rs761839435 1129 dbSNP
rs1321837276 1133 dbSNP
rs1039245689 1137 dbSNP
rs1293461646 1144 dbSNP
rs1225667597 1146 dbSNP
rs774940824 1156 dbSNP
rs372856482 1157 dbSNP
rs1366107363 1160 dbSNP
rs1384334748 1160 dbSNP
rs541995441 1164 dbSNP
rs1179888414 1173 dbSNP
rs760334986 1187 dbSNP
rs930791295 1188 dbSNP
rs1473140272 1191 dbSNP
rs1181805135 1193 dbSNP
rs1416245436 1196 dbSNP
rs555810623 1202 dbSNP
rs1429270601 1207 dbSNP
rs1391029002 1217 dbSNP
rs1049621400 1219 dbSNP
rs1467630637 1220 dbSNP
rs1171890574 1225 dbSNP
rs1190594405 1227 dbSNP
rs757093364 1233 dbSNP
rs1270334868 1239 dbSNP
rs17541713 1243 dbSNP
rs1005333355 1244 dbSNP
rs1057064628 1259 dbSNP
rs753098302 1260 dbSNP
rs1341754491 1261 dbSNP
rs1310866175 1262 dbSNP
rs529902492 1267 dbSNP
rs1301046766 1270 dbSNP
rs895703436 1275 dbSNP
rs1347941436 1290 dbSNP
rs541374069 1295 dbSNP
rs17541720 1299 dbSNP
rs1371390572 1300 dbSNP
rs1036416346 1302 dbSNP
rs1034206300 1305 dbSNP
rs139998093 1306 dbSNP
rs1480690591 1309 dbSNP
rs1431433649 1312 dbSNP
rs1011373314 1316 dbSNP
rs17541727 1317 dbSNP
rs1352992903 1321 dbSNP
rs1250772722 1324 dbSNP
rs1197133980 1325 dbSNP
rs371737381 1326 dbSNP
rs967149937 1327 dbSNP
rs779632528 1336 dbSNP
rs1287074148 1341 dbSNP
rs1019274783 1354 dbSNP
rs926371909 1355 dbSNP
rs1309264985 1357 dbSNP
rs1394471275 1364 dbSNP
rs562376487 1376 dbSNP
rs963677907 1385 dbSNP
rs974997050 1388 dbSNP
rs988172082 1390 dbSNP
rs922147094 1392 dbSNP
rs1408169667 1397 dbSNP
rs1156922101 1398 dbSNP
rs1443079692 1408 dbSNP
rs1472239392 1415 dbSNP
rs1363834244 1433 dbSNP
rs531510566 1437 dbSNP
rs968183631 1440 dbSNP
rs1255112945 1448 dbSNP
rs1479111663 1450 dbSNP
rs1174950365 1454 dbSNP
rs980850242 1456 dbSNP
rs1423380604 1460 dbSNP
rs927145435 1461 dbSNP
rs1474596952 1462 dbSNP
rs548025027 1463 dbSNP
rs1262499047 1465 dbSNP
rs1242775879 1481 dbSNP
rs1340093478 1497 dbSNP
rs1453072390 1502 dbSNP
rs1384667558 1504 dbSNP
rs1056947761 1515 dbSNP
rs1456581714 1517 dbSNP
rs568139093 1523 dbSNP
rs907977071 1533 dbSNP
rs369262076 1534 dbSNP
rs1367495885 1535 dbSNP
rs748506484 1537 dbSNP
rs898810590 1541 dbSNP
rs1246530637 1553 dbSNP
rs181399198 1555 dbSNP
rs937303951 1556 dbSNP
rs1325655623 1561 dbSNP
rs533659836 1562 dbSNP
rs1055645675 1564 dbSNP
rs1009037356 1567 dbSNP
rs770344902 1568 dbSNP
rs780004654 1574 dbSNP
rs1326947470 1575 dbSNP
rs1320248548 1576 dbSNP
rs893044582 1578 dbSNP
rs1278321657 1589 dbSNP
rs1011862250 1592 dbSNP
rs1218002280 1594 dbSNP
rs1263011891 1597 dbSNP
rs1426090298 1598 dbSNP
rs1020096467 1600 dbSNP
rs773498148 1602 dbSNP
rs571182639 1606 dbSNP
rs1007991325 1607 dbSNP
rs1478176776 1619 dbSNP
rs980735309 1623 dbSNP
rs926698301 1632 dbSNP
rs763247839 1633 dbSNP
rs963717953 1639 dbSNP
rs975069105 1652 dbSNP
rs1224837827 1658 dbSNP
rs1172587467 1659 dbSNP
rs1392751693 1661 dbSNP
rs1029699719 1664 dbSNP
rs540106162 1665 dbSNP
rs753654475 1668 dbSNP
rs1339882828 1676 dbSNP
rs1271734688 1678 dbSNP
rs556881848 1682 dbSNP
rs1344809334 1684 dbSNP
rs1384249064 1688 dbSNP
rs1406315736 1688 dbSNP
rs992675095 1692 dbSNP
rs143510118 1700 dbSNP
rs1331432596 1705 dbSNP
rs1233871884 1707 dbSNP
rs908048364 1714 dbSNP
rs755269866 1719 dbSNP
rs1171194469 1725 dbSNP
rs1477956667 1727 dbSNP
rs940831427 1731 dbSNP
rs981493406 1732 dbSNP
rs536036435 1745 dbSNP
rs1205422670 1749 dbSNP
rs1050025608 1750 dbSNP
rs1260202515 1752 dbSNP
rs1198527204 1757 dbSNP
rs1349216968 1759 dbSNP
rs1212124844 1762 dbSNP
rs1322712888 1762 dbSNP
rs1268538383 1771 dbSNP
rs1451347711 1777 dbSNP
rs928689267 1779 dbSNP
rs888877511 1780 dbSNP
rs1192637058 1784 dbSNP
rs937376059 1787 dbSNP
rs1055718998 1790 dbSNP
rs944446287 1791 dbSNP
rs1355936775 1796 dbSNP
rs1332599067 1799 dbSNP
rs893065047 1808 dbSNP
rs892625642 1815 dbSNP
rs555586848 1819 dbSNP
rs1407292997 1820 dbSNP
rs1177856293 1838 dbSNP
rs1471246922 1845 dbSNP
rs1236003924 1846 dbSNP
rs1185104634 1850 dbSNP
rs1451581845 1859 dbSNP
rs545223184 1864 dbSNP
rs759573754 1878 dbSNP
rs1327006283 1881 dbSNP
rs1391203930 1882 dbSNP
rs1439801128 1885 dbSNP
rs763995710 1890 dbSNP
rs753831228 1893 dbSNP
rs1323638093 1900 dbSNP
rs1002224443 1908 dbSNP
rs1033652361 1912 dbSNP
rs1452340796 1913 dbSNP
rs1383925288 1914 dbSNP
rs375714200 1918 dbSNP
rs903032813 1922 dbSNP
rs757042421 1927 dbSNP
rs1159909184 1928 dbSNP
rs186870824 1935 dbSNP
rs1024183575 1937 dbSNP
rs1019412327 1941 dbSNP
rs1163118984 1947 dbSNP
rs17513025 1949 dbSNP
rs1247657273 1951 dbSNP
rs768741900 1952 dbSNP
rs565482329 1955 dbSNP
rs1241517905 1957 dbSNP
rs920524185 1960 dbSNP
rs1026638436 1964 dbSNP
rs1287154711 1965 dbSNP
rs952454804 1969 dbSNP
rs10135238 1971 dbSNP
rs1458852262 1972 dbSNP
rs1317537515 1974 dbSNP
rs910199741 1989 dbSNP
rs1177383794 1998 dbSNP
rs1290009158 2004 dbSNP
rs1433528779 2010 dbSNP
rs577599438 2021 dbSNP
rs1015553096 2024 dbSNP
rs962192996 2027 dbSNP
rs981566739 2028 dbSNP
rs928761381 2041 dbSNP
rs1425476718 2049 dbSNP
rs1387382539 2057 dbSNP
rs1165239241 2058 dbSNP
rs1369051286 2060 dbSNP
rs1460843461 2064 dbSNP
rs74081937 2065 dbSNP
rs1418673243 2066 dbSNP
rs991476338 2073 dbSNP
rs914590932 2074 dbSNP
rs1190610 2075 dbSNP
rs1041644715 2079 dbSNP
rs1221108328 2088 dbSNP
rs1297777454 2095 dbSNP
rs924516786 2100 dbSNP
rs1043878075 2101 dbSNP
rs1397794269 2104 dbSNP
rs904121704 2116 dbSNP
rs375629948 2117 dbSNP
rs943894051 2120 dbSNP
rs569362877 2131 dbSNP
rs562797329 2132 dbSNP
rs1306462018 2135 dbSNP
rs899613177 2136 dbSNP
rs1353661795 2141 dbSNP
rs1013551203 2143 dbSNP
rs1430171748 2144 dbSNP
rs369481532 2154 dbSNP
rs34903244 2156 dbSNP
rs1016103722 2157 dbSNP
rs996612291 2161 dbSNP
rs1480501292 2162 dbSNP
rs754588147 2164 dbSNP
rs781762307 2165 dbSNP
rs1257572107 2166 dbSNP
rs1474860778 2169 dbSNP
rs1027472338 2175 dbSNP
rs951993367 2183 dbSNP
rs865945910 2186 dbSNP
rs1224180474 2188 dbSNP
rs150966394 2189 dbSNP
rs536171181 2190 dbSNP
rs944378332 2198 dbSNP
rs541968228 2199 dbSNP
rs1035805565 2204 dbSNP
rs913653369 2206 dbSNP
rs561632769 2207 dbSNP
rs1403775664 2210 dbSNP
rs527352443 2213 dbSNP
rs547435062 2214 dbSNP
rs1430708233 2216 dbSNP
rs373025403 2222 dbSNP
rs756323998 2242 dbSNP
rs1250881806 2243 dbSNP
rs924549028 2244 dbSNP
rs943925085 2250 dbSNP
rs1460301858 2254 dbSNP
rs1040954996 2255 dbSNP
rs1413495847 2256 dbSNP
rs1300523920 2263 dbSNP
rs1341525102 2267 dbSNP
rs938275986 2278 dbSNP
rs1055380204 2279 dbSNP
rs1317737610 2283 dbSNP
rs1214416515 2285 dbSNP
rs1293861559 2294 dbSNP
rs140682198 2295 dbSNP
rs932435652 2297 dbSNP
rs1380240883 2302 dbSNP
rs1335846378 2312 dbSNP
rs1234916954 2316 dbSNP
rs1408286462 2318 dbSNP
rs1156303747 2327 dbSNP
rs116993724 2337 dbSNP
rs1485032669 2345 dbSNP
rs896707763 2347 dbSNP
rs888184678 2349 dbSNP
rs1014019708 2351 dbSNP
rs1242843323 2351 dbSNP
rs1184603944 2352 dbSNP
rs1463037083 2354 dbSNP
rs1003920499 2356 dbSNP
rs1037086199 2359 dbSNP
rs114416750 2365 dbSNP
rs1351557198 2368 dbSNP
rs778302381 2376 dbSNP
rs145815612 2377 dbSNP
rs995592300 2384 dbSNP
rs549523944 2389 dbSNP
rs34341993 2390 dbSNP
rs951879314 2395 dbSNP
rs1174455851 2398 dbSNP
rs1316196660 2400 dbSNP
rs894648896 2400 dbSNP
rs1432869216 2405 dbSNP
rs534825395 2413 dbSNP
rs771707253 2418 dbSNP
rs774484385 2419 dbSNP
rs779921621 2422 dbSNP
rs977480864 2423 dbSNP
rs1371822271 2425 dbSNP
rs1193038556 2426 dbSNP
rs1448112223 2430 dbSNP
rs1263873412 2435 dbSNP
rs557808439 2439 dbSNP
rs1220429557 2448 dbSNP
rs976170682 2450 dbSNP
rs965348493 2452 dbSNP
rs116800404 2453 dbSNP
rs1358146718 2457 dbSNP
rs921149429 2468 dbSNP
rs932534422 2469 dbSNP
rs1326965417 2471 dbSNP
rs1279522807 2477 dbSNP
rs984357515 2479 dbSNP
rs74081940 2480 dbSNP
rs556194937 2485 dbSNP
rs1346530099 2490 dbSNP
rs1426185432 2491 dbSNP
rs1394733113 2496 dbSNP
rs1167711761 2501 dbSNP
rs576240934 2505 dbSNP
rs1375355800 2507 dbSNP
rs772207258 2512 dbSNP
rs1480180498 2521 dbSNP
rs925479329 2522 dbSNP
rs1287526178 2523 dbSNP
rs1224961858 2524 dbSNP
rs529701043 2527 dbSNP
rs541680880 2528 dbSNP
rs1195066195 2530 dbSNP
rs1339985289 2536 dbSNP
rs1259960265 2540 dbSNP
rs918192545 2545 dbSNP
rs906223925 2551 dbSNP
rs938980179 2565 dbSNP
rs1057322705 2567 dbSNP
rs1283403651 2570 dbSNP
rs1214946641 2571 dbSNP
rs1240175670 2575 dbSNP
rs1333682152 2575 dbSNP
rs930834616 2575 dbSNP
rs1489306433 2576 dbSNP
rs1403060012 2578 dbSNP
rs752207118 2578 dbSNP
rs1174846459 2579 dbSNP
rs117601455 2579 dbSNP
rs1475587373 2579 dbSNP
rs34327327 2579 dbSNP
rs1232586791 2580 dbSNP
rs949645503 2581 dbSNP
rs554222479 2583 dbSNP
rs1252678853 2584 dbSNP
rs1201645895 2593 dbSNP
rs1452793758 2596 dbSNP
rs886891949 2597 dbSNP
rs1408765153 2598 dbSNP
rs1400665862 2600 dbSNP
rs561886997 2601 dbSNP
rs1352001987 2602 dbSNP
rs1003925774 2607 dbSNP
rs1442510661 2610 dbSNP
rs1379522882 2612 dbSNP
rs546635819 2618 dbSNP
rs1452468244 2622 dbSNP
rs1407552728 2625 dbSNP
rs371302883 2639 dbSNP
rs1325651100 2640 dbSNP
rs897146951 2643 dbSNP
rs996035420 2644 dbSNP
rs1441811233 2651 dbSNP
rs1438233036 2656 dbSNP
rs1239701862 2669 dbSNP
rs796427082 2670 dbSNP
rs1460813171 2671 dbSNP
rs1373380470 2672 dbSNP
rs1211590199 2673 dbSNP
rs1444727092 2674 dbSNP
rs776484703 2675 dbSNP
rs867280325 2681 dbSNP
rs1281980574 2682 dbSNP
rs1323426188 2685 dbSNP
rs541157814 2688 dbSNP
rs1313360285 2691 dbSNP
rs1245791158 2693 dbSNP
rs1305164448 2696 dbSNP
rs1429270628 2697 dbSNP
rs564169078 2700 dbSNP
rs1272287243 2703 dbSNP
rs1467339082 2704 dbSNP
rs1344646767 2711 dbSNP
rs1319071840 2713 dbSNP
rs34928054 2714 dbSNP
rs72241914 2714 dbSNP
rs1383688340 2721 dbSNP
rs189249352 2723 dbSNP
rs1161407430 2724 dbSNP
rs1233544618 2725 dbSNP
rs889833251 2727 dbSNP
rs181893743 2728 dbSNP
rs1175995092 2730 dbSNP
rs1183484263 2745 dbSNP
rs1017366759 2747 dbSNP
rs1474386697 2752 dbSNP
rs1240948602 2753 dbSNP
rs186293029 2754 dbSNP
rs529553494 2755 dbSNP
rs1489066584 2756 dbSNP
rs1462416984 2762 dbSNP
rs1222190179 2763 dbSNP
rs1360558658 2764 dbSNP
rs997427686 2768 dbSNP
rs1164719547 2773 dbSNP
rs1021072536 2777 dbSNP
rs1270833919 2786 dbSNP
rs1401967772 2790 dbSNP
rs1392700159 2792 dbSNP
rs1459577063 2798 dbSNP
rs894729410 2801 dbSNP
rs1013110507 2811 dbSNP
rs1024687276 2812 dbSNP
rs1425566661 2817 dbSNP
rs1350183387 2818 dbSNP
rs1022200627 2820 dbSNP
rs1166666168 2826 dbSNP
rs1440923244 2827 dbSNP
rs925039532 2828 dbSNP
rs1277253103 2834 dbSNP
rs1266182430 2835 dbSNP
rs1478546811 2835 dbSNP
rs1381311972 2839 dbSNP
rs1233787829 2840 dbSNP
rs1488606380 2843 dbSNP
rs1267545795 2849 dbSNP
rs959089504 2851 dbSNP
rs1332343124 2853 dbSNP
rs796685738 2855 dbSNP
rs904663103 2856 dbSNP
rs999363523 2857 dbSNP
rs1437462082 2858 dbSNP
rs1202597795 2859 dbSNP
rs1239267796 2860 dbSNP
rs1475843654 2864 dbSNP
rs369689387 2865 dbSNP
rs1282728007 2869 dbSNP
rs1405712889 2872 dbSNP
rs918796008 2874 dbSNP
rs1478974555 2877 dbSNP
rs931338468 2878 dbSNP
rs771539353 2880 dbSNP
rs889885817 2882 dbSNP
rs965380618 2883 dbSNP
rs942768143 2884 dbSNP
rs1326325248 2888 dbSNP
rs1038870969 2894 dbSNP
rs976742970 2894 dbSNP
rs566289830 2902 dbSNP
rs534884186 2903 dbSNP
rs1353338732 2908 dbSNP
rs997879568 2914 dbSNP
rs1020870368 2917 dbSNP
rs762700047 2918 dbSNP
rs1339040265 2922 dbSNP
rs1262572558 2923 dbSNP
rs1234137248 2925 dbSNP
rs2754497 2925 dbSNP
rs2754496 2927 dbSNP
rs1212995500 2929 dbSNP
rs1391063356 2939 dbSNP
rs552025947 2940 dbSNP
rs1331798597 2943 dbSNP
rs1000553628 2947 dbSNP
rs1486013528 2948 dbSNP
rs1210815866 2949 dbSNP
rs191121979 2950 dbSNP
rs1489548236 2953 dbSNP
rs1190611 2955 dbSNP
rs959139933 2956 dbSNP
rs1243109376 2957 dbSNP
rs1201090529 2958 dbSNP
rs1474893691 2960 dbSNP
rs1259074401 2961 dbSNP
rs990562350 2962 dbSNP
rs1309701029 2972 dbSNP
rs866703845 2973 dbSNP
rs970923149 2979 dbSNP
rs1396374895 2980 dbSNP
rs1434721834 2987 dbSNP
rs1172474136 2988 dbSNP
rs973278438 2990 dbSNP
rs1452586534 2991 dbSNP
rs1360842005 3003 dbSNP
rs918858903 3006 dbSNP
rs1385034243 3014 dbSNP
rs1188809026 3015 dbSNP
rs1426084532 3020 dbSNP
rs1259676877 3021 dbSNP
rs1204691732 3022 dbSNP
rs931541933 3029 dbSNP
rs1288477031 3032 dbSNP
rs1220565321 3033 dbSNP
rs557296840 3036 dbSNP
rs1283384881 3037 dbSNP
rs1245351645 3042 dbSNP
rs576274871 3043 dbSNP
rs1318775594 3044 dbSNP
rs1398888280 3045 dbSNP
rs1340718178 3047 dbSNP
rs1299604178 3048 dbSNP
rs984108552 3054 dbSNP
rs1325599272 3067 dbSNP
rs535779179 3069 dbSNP
rs112467092 3073 dbSNP
rs942820435 3076 dbSNP
rs1305830312 3077 dbSNP
rs113182112 3079 dbSNP
rs1348695303 3089 dbSNP
rs766035680 3094 dbSNP
rs1265466028 3096 dbSNP
rs555353941 3102 dbSNP
rs1353520624 3107 dbSNP
rs1288862017 3108 dbSNP
rs572318910 3109 dbSNP
rs901211629 3113 dbSNP
rs1261494631 3116 dbSNP
rs1042592640 3119 dbSNP
rs751231621 3121 dbSNP
rs1000772528 3122 dbSNP
rs182672522 3128 dbSNP
rs894811912 3132 dbSNP
rs1394942236 3133 dbSNP
rs1167803923 3140 dbSNP
rs1466605509 3144 dbSNP
rs1425792000 3149 dbSNP
rs1174439803 3151 dbSNP
rs564172832 3153 dbSNP
rs1247549307 3159 dbSNP
rs1454439685 3160 dbSNP
rs1192520899 3162 dbSNP
rs1453063201 3164 dbSNP
rs1248193260 3168 dbSNP
rs1485094454 3168 dbSNP
rs1197865926 3170 dbSNP
rs1392693003 3175 dbSNP
rs1024734911 3176 dbSNP
rs1455311784 3178 dbSNP
rs1221227607 3179 dbSNP
rs1234988949 3181 dbSNP
rs200599627 3181 dbSNP
rs772774012 3181 dbSNP
rs970855286 3181 dbSNP
rs1334747584 3185 dbSNP
rs1414024588 3185 dbSNP
rs765339869 3185 dbSNP
rs1159026613 3186 dbSNP
rs1174491257 3187 dbSNP
rs1468806065 3187 dbSNP
rs1383991932 3188 dbSNP
rs994365326 3188 dbSNP
rs1026213815 3189 dbSNP
rs1336264505 3189 dbSNP
rs74889698 3189 dbSNP
rs952994047 3189 dbSNP
rs201815964 3190 dbSNP
rs563664402 3191 dbSNP
rs775856080 3192 dbSNP
rs529511565 3193 dbSNP
rs577782127 3193 dbSNP
rs1380605951 3194 dbSNP
rs199935313 3194 dbSNP
rs1340096998 3195 dbSNP
rs1398669649 3195 dbSNP
rs1298980322 3196 dbSNP
rs1421787917 3197 dbSNP
rs3067915 3197 dbSNP
rs200282583 3198 dbSNP
rs1162498007 3199 dbSNP
rs957924317 3205 dbSNP
rs1372061146 3206 dbSNP
rs1440406346 3208 dbSNP
rs1183069369 3211 dbSNP
rs1476524243 3217 dbSNP
rs1261872878 3223 dbSNP
rs543063625 3234 dbSNP
rs1489076430 3238 dbSNP
rs1301380459 3240 dbSNP
rs1290030171 3241 dbSNP
rs1337557745 3247 dbSNP
rs1221385981 3248 dbSNP
rs1322821322 3249 dbSNP
rs1292702111 3253 dbSNP
rs1213347569 3254 dbSNP
rs964014532 3266 dbSNP
rs376954346 3271 dbSNP
rs1402064147 3272 dbSNP
rs1028282261 3273 dbSNP
rs61992471 3287 dbSNP
rs1216009602 3309 dbSNP
rs1274178045 3324 dbSNP
rs1350272525 3326 dbSNP
rs954080285 3334 dbSNP
rs984000022 3337 dbSNP
rs543352698 3338 dbSNP
rs1264883084 3341 dbSNP
rs559608628 3349 dbSNP
rs922731388 3351 dbSNP
rs1488983418 3353 dbSNP
rs972457428 3356 dbSNP
rs376229423 3357 dbSNP
rs927682028 3358 dbSNP
rs1197229189 3361 dbSNP
rs1457754351 3363 dbSNP
rs939061877 3365 dbSNP
rs1054702621 3373 dbSNP
rs1220587934 3374 dbSNP
rs1363225025 3376 dbSNP
rs1468514510 3385 dbSNP
rs1321645969 3390 dbSNP
rs1300786631 3397 dbSNP
rs1220061816 3403 dbSNP
rs528670088 3410 dbSNP
rs1042254259 3414 dbSNP
rs549177263 3416 dbSNP
rs894758952 3418 dbSNP
rs949002606 3419 dbSNP
rs186102363 3426 dbSNP
rs1394894693 3429 dbSNP
rs1461141732 3434 dbSNP
rs191346822 3438 dbSNP
rs1331403382 3441 dbSNP
rs530879305 3453 dbSNP
rs1466780135 3456 dbSNP
rs1053707823 3467 dbSNP
rs1398728030 3470 dbSNP
rs1433417806 3472 dbSNP
rs1427632022 3477 dbSNP
rs1177232154 3483 dbSNP
rs550781431 3484 dbSNP
rs1053228658 3491 dbSNP
rs901254786 3496 dbSNP
rs998209429 3505 dbSNP
rs1334566707 3514 dbSNP
rs1211015149 3518 dbSNP
rs567682110 3519 dbSNP
rs1028314811 3541 dbSNP
rs536251309 3542 dbSNP
rs1376037510 3545 dbSNP
rs1005898030 3552 dbSNP
rs1016810417 3554 dbSNP
rs906306390 3558 dbSNP
rs994308774 3559 dbSNP
rs1466225558 3566 dbSNP
rs7151023 3574 dbSNP
rs1157208786 3575 dbSNP
rs1481409799 3578 dbSNP
rs1439418287 3583 dbSNP
rs952878270 3585 dbSNP
rs183224331 3586 dbSNP
rs1422593526 3587 dbSNP
rs927743987 3590 dbSNP
rs960432609 3591 dbSNP
rs1189919019 3593 dbSNP
rs1418319327 3595 dbSNP
rs534832182 3597 dbSNP
rs1474718117 3608 dbSNP
rs1284208877 3615 dbSNP
rs1216198467 3616 dbSNP
rs1352659577 3621 dbSNP
rs1162519552 3625 dbSNP
rs557947206 3629 dbSNP
rs373888641 3630 dbSNP
rs1462670398 3631 dbSNP
rs1380737354 3641 dbSNP
rs542791028 3642 dbSNP
rs916253226 3643 dbSNP
rs977908866 3652 dbSNP
rs1313959114 3660 dbSNP
rs1456835250 3661 dbSNP
rs1368439546 3663 dbSNP
rs543532588 3666 dbSNP
rs946364359 3670 dbSNP
rs1165549078 3678 dbSNP
rs925988418 3687 dbSNP
rs367838472 3690 dbSNP
rs926219418 3696 dbSNP
rs1488748201 3703 dbSNP
rs1263617046 3707 dbSNP
rs1298172100 3708 dbSNP
rs1354141072 3713 dbSNP
rs1264743050 3717 dbSNP
rs934855902 3722 dbSNP
rs1053260660 3723 dbSNP
rs1398992934 3727 dbSNP
rs901285882 3730 dbSNP
rs1227648021 3736 dbSNP
rs1250291852 3744 dbSNP
rs947947036 3746 dbSNP
rs556777795 3747 dbSNP
rs573620977 3756 dbSNP
rs1046093501 3763 dbSNP
rs1212934878 3782 dbSNP
rs149368431 3783 dbSNP
rs559624091 3788 dbSNP
rs1485294792 3793 dbSNP
rs1170136547 3794 dbSNP
rs1478269686 3798 dbSNP
rs528733724 3800 dbSNP
rs1197051822 3806 dbSNP
rs993968751 3809 dbSNP
rs1047254160 3810 dbSNP
rs1179946456 3816 dbSNP
rs545213740 3817 dbSNP
rs1005685821 3831 dbSNP
rs565171803 3840 dbSNP
rs148542048 3848 dbSNP
rs865865929 3849 dbSNP
rs1169955553 3852 dbSNP
rs536214412 3858 dbSNP
rs771257385 3859 dbSNP
rs187344035 3863 dbSNP
rs552949732 3868 dbSNP
rs1443735726 3871 dbSNP
rs1034831471 3876 dbSNP
rs1398826505 3878 dbSNP
rs998838183 3879 dbSNP
rs1029704278 3882 dbSNP
rs960508202 3883 dbSNP
rs1477828093 3887 dbSNP
rs74264738 3894 dbSNP
rs1199387431 3896 dbSNP
rs567646520 3905 dbSNP
rs990532648 3906 dbSNP
rs957419111 3907 dbSNP
rs191911202 3909 dbSNP
rs1382449289 3914 dbSNP
rs546985314 3915 dbSNP
rs1339624893 3917 dbSNP
rs565994232 3923 dbSNP
rs1198314321 3924 dbSNP
rs987977397 3925 dbSNP
rs911949463 3928 dbSNP
rs142764722 3936 dbSNP
rs1237012541 3938 dbSNP
rs1375173139 3940 dbSNP
rs979119406 3941 dbSNP
rs974751254 3942 dbSNP
rs34285266 3945 dbSNP
rs111791627 3946 dbSNP
rs558059953 3952 dbSNP
rs760031363 3953 dbSNP
rs1414114733 3957 dbSNP
rs1403226704 3962 dbSNP
rs1174004832 3966 dbSNP
rs929637910 3975 dbSNP
rs1053335085 3982 dbSNP
rs1046682185 3986 dbSNP
rs1190612 3989 dbSNP
rs1440258354 3990 dbSNP
rs1234106621 3994 dbSNP
rs934106046 3999 dbSNP
rs1194404051 4001 dbSNP
rs1241490283 4002 dbSNP
rs1282468688 4002 dbSNP
rs1285764804 4002 dbSNP
rs1314958824 4002 dbSNP
rs1341169174 4002 dbSNP
rs1376247686 4002 dbSNP
rs1447454065 4002 dbSNP
rs1469696113 4002 dbSNP
rs758458056 4002 dbSNP
rs1050276598 4003 dbSNP
rs11394190 4003 dbSNP
rs888212738 4004 dbSNP
rs1410126426 4008 dbSNP
rs1161840760 4022 dbSNP
rs889868201 4022 dbSNP
rs1346163198 4024 dbSNP
rs1240771390 4025 dbSNP
rs1287468540 4026 dbSNP
rs1362641523 4027 dbSNP
rs1257604499 4029 dbSNP
rs1442606659 4030 dbSNP
rs1303549763 4042 dbSNP
rs1487135184 4045 dbSNP
rs536844630 4046 dbSNP
rs557026843 4051 dbSNP
rs1217859070 4057 dbSNP
rs1319226165 4062 dbSNP
rs1308977242 4063 dbSNP
rs772082724 4092 dbSNP
rs1317442240 4101 dbSNP
rs1214881361 4107 dbSNP
rs897135112 4115 dbSNP
rs1398370056 4116 dbSNP
rs146074061 4119 dbSNP
rs374040242 4123 dbSNP
rs539213849 4123 dbSNP
rs375554240 4128 dbSNP
rs1297326049 4144 dbSNP
rs1431268584 4155 dbSNP
rs1346770762 4164 dbSNP
rs775571575 4166 dbSNP
rs1321430172 4167 dbSNP
rs12893565 4168 dbSNP
rs1214499427 4178 dbSNP
rs1252464031 4181 dbSNP
rs896331096 4184 dbSNP
rs187063278 4187 dbSNP
rs1012028235 4198 dbSNP
rs1023845740 4217 dbSNP
rs1476617723 4218 dbSNP
rs143489786 4219 dbSNP
rs769691529 4221 dbSNP
rs979535458 4222 dbSNP
rs1030678746 4226 dbSNP
rs1477043228 4227 dbSNP
rs1245349781 4229 dbSNP
rs566215608 4240 dbSNP
rs572490425 4250 dbSNP
rs182889223 4259 dbSNP
rs1157452569 4277 dbSNP
rs1317500612 4282 dbSNP
rs1279022575 4289 dbSNP
rs908052197 4292 dbSNP
rs75365092 4300 dbSNP
rs565237359 4305 dbSNP
rs1397093183 4309 dbSNP
rs1216551981 4314 dbSNP
rs1363737625 4314 dbSNP
rs1030336335 4317 dbSNP
rs1435663630 4321 dbSNP
rs1395179145 4327 dbSNP
rs1327303552 4329 dbSNP
rs903407822 4350 dbSNP
rs1462713040 4353 dbSNP
rs1170628373 4364 dbSNP
rs1429946004 4365 dbSNP
rs1423488980 4368 dbSNP
rs999280013 4371 dbSNP
rs1032994792 4375 dbSNP
rs1326096855 4375 dbSNP
rs1197330485 4383 dbSNP
rs1457342960 4399 dbSNP
rs8019874 4410 dbSNP
rs1433764695 4411 dbSNP
rs1310729000 4412 dbSNP
rs114097095 4414 dbSNP
rs1374035761 4417 dbSNP
rs934179759 4420 dbSNP
rs1023511233 4422 dbSNP
rs561438820 4422 dbSNP
rs530102352 4425 dbSNP
rs1371485747 4429 dbSNP
rs1286247388 4430 dbSNP
rs187626120 4431 dbSNP
rs981931470 4432 dbSNP
rs1298311555 4439 dbSNP
rs528673804 4439 dbSNP
rs1272854614 4447 dbSNP
rs766157841 4456 dbSNP
rs927881865 4457 dbSNP
rs941470134 4469 dbSNP
rs1233493844 4472 dbSNP
rs929884718 4473 dbSNP
rs982443576 4481 dbSNP
rs1038840462 4484 dbSNP
rs897167736 4506 dbSNP
rs909547144 4510 dbSNP
rs560497772 4517 dbSNP
rs1480608993 4523 dbSNP
rs1180592193 4525 dbSNP
rs1179062283 4534 dbSNP
rs1482386321 4537 dbSNP
rs751161513 4540 dbSNP
rs1039431917 4541 dbSNP
rs899547391 4542 dbSNP
rs1164660926 4548 dbSNP
rs1046584547 4556 dbSNP
rs1412699902 4557 dbSNP
rs1352984633 4565 dbSNP
rs896406010 4567 dbSNP
rs1307050460 4568 dbSNP
rs934167150 4582 dbSNP
rs1403225351 4584 dbSNP
rs1376374463 4585 dbSNP
rs1301859728 4586 dbSNP
rs1415027298 4590 dbSNP
rs1012519523 4598 dbSNP
rs1377636544 4605 dbSNP
rs1157297022 4610 dbSNP
rs750281700 4618 dbSNP
rs74081947 4620 dbSNP
rs1161941607 4630 dbSNP
rs1422088955 4632 dbSNP
rs1190613 4635 dbSNP
rs752217012 4640 dbSNP
rs1486811194 4647 dbSNP
rs193111782 4649 dbSNP
rs1054494479 4653 dbSNP
rs755709341 4661 dbSNP
rs956365484 4662 dbSNP
rs1306032708 4670 dbSNP
rs1241139849 4680 dbSNP
rs1319336328 4685 dbSNP
rs537253447 4690 dbSNP
rs1233514976 4691 dbSNP
rs975735577 4709 dbSNP
rs1012882732 4719 dbSNP
rs1029956643 4720 dbSNP
rs1415229843 4721 dbSNP
rs1292423722 4726 dbSNP
rs1456850852 4727 dbSNP
rs1003803312 4732 dbSNP
rs1165834398 4737 dbSNP
rs955588184 4738 dbSNP
rs951412372 4743 dbSNP
rs986088804 4756 dbSNP
rs1193248930 4759 dbSNP
rs982664067 4761 dbSNP
rs550475648 4762 dbSNP
rs909765085 4765 dbSNP
rs778285852 4767 dbSNP
rs911414573 4768 dbSNP
rs941488594 4769 dbSNP
rs933737568 4770 dbSNP
rs1273833612 4773 dbSNP
rs1306934025 4782 dbSNP
rs1157400951 4783 dbSNP
rs567371154 4793 dbSNP
rs1051731314 4795 dbSNP
rs934937806 4795 dbSNP
rs1260313253 4799 dbSNP
rs974195721 4802 dbSNP
rs1397345661 4809 dbSNP
rs367630394 4810 dbSNP
rs575233592 4811 dbSNP
rs544730295 4812 dbSNP
rs1431342484 4817 dbSNP
rs540188991 4818 dbSNP
rs1169226905 4819 dbSNP
rs1002953187 4821 dbSNP
rs948009562 4827 dbSNP
rs951223417 4828 dbSNP
rs1428618812 4833 dbSNP
rs1016819622 4834 dbSNP
rs962579709 4835 dbSNP
rs1045361548 4841 dbSNP
rs903687196 4842 dbSNP
rs372553278 4843 dbSNP
rs560104135 4845 dbSNP
rs1001073426 4846 dbSNP
rs1415288899 4849 dbSNP
rs955332216 4853 dbSNP
rs986563045 4867 dbSNP
rs1394255440 4869 dbSNP
rs572553794 4876 dbSNP
rs1052215191 4877 dbSNP
rs1194119367 4882 dbSNP
rs117836261 4885 dbSNP
rs892215268 4886 dbSNP
rs997207310 4888 dbSNP
rs1030016964 4892 dbSNP
rs1438024431 4893 dbSNP
rs117398161 4900 dbSNP
rs1198407118 4908 dbSNP
rs1347531266 4926 dbSNP
rs1237128420 4931 dbSNP
rs575803744 4931 dbSNP
rs1352198924 4932 dbSNP
rs35848245 4945 dbSNP
rs1279008737 4951 dbSNP
rs1007148067 4952 dbSNP
rs1442954692 4955 dbSNP
rs1332360047 4956 dbSNP
rs1018910394 4958 dbSNP
rs1414410682 4966 dbSNP
rs1374607849 4967 dbSNP
rs1433174418 4972 dbSNP
rs1436472579 4976 dbSNP
rs962944691 4977 dbSNP
rs1157952926 4984 dbSNP
rs768496742 4985 dbSNP
rs544803326 4993 dbSNP
rs115913206 4994 dbSNP
rs1485176355 4996 dbSNP
rs951455389 4998 dbSNP
rs1284130912 4999 dbSNP
rs545861166 4999 dbSNP
rs992173873 5000 dbSNP
rs917934254 5001 dbSNP
rs371805707 5007 dbSNP
rs1356382668 5013 dbSNP
rs938644635 5020 dbSNP
rs1416343608 5021 dbSNP
rs1047818097 5022 dbSNP
rs1349290002 5023 dbSNP
rs562478057 5024 dbSNP
rs886499193 5025 dbSNP
rs780816183 5037 dbSNP
rs376178092 5038 dbSNP
rs1474661712 5041 dbSNP
rs367939065 5042 dbSNP
rs1044996596 5048 dbSNP
rs898448532 5048 dbSNP
rs574952033 5049 dbSNP
rs1241905629 5052 dbSNP
rs1194338217 5054 dbSNP
rs1449299059 5055 dbSNP
rs1287774263 5061 dbSNP
rs540775250 5067 dbSNP
rs1052246815 5071 dbSNP
rs1448479143 5075 dbSNP
rs139138337 5079 dbSNP
rs892247891 5080 dbSNP
rs1396319241 5083 dbSNP
rs1269441631 5085 dbSNP
rs867210858 5086 dbSNP
rs1431390505 5096 dbSNP
rs1031437270 5097 dbSNP
rs1435285922 5104 dbSNP
rs1171873816 5110 dbSNP
rs1460426800 5114 dbSNP
rs1399803332 5115 dbSNP
rs1051474629 5117 dbSNP
rs1394581147 5118 dbSNP
rs888797858 5121 dbSNP
rs532560074 5123 dbSNP
rs531498439 5124 dbSNP
rs184406138 5125 dbSNP
rs1433135790 5137 dbSNP
rs995662088 5143 dbSNP
rs1468918737 5145 dbSNP
rs1025781983 5155 dbSNP
rs1275145220 5159 dbSNP
rs1196972095 5177 dbSNP
rs754079226 5177 dbSNP
rs951524642 5185 dbSNP
rs992205329 5186 dbSNP
rs1371760217 5187 dbSNP
rs867317610 5195 dbSNP
rs1233163076 5196 dbSNP
rs917958467 5197 dbSNP
rs1214886955 5198 dbSNP
rs969446400 5199 dbSNP
rs1440094251 5209 dbSNP
rs981177855 5212 dbSNP
rs925247464 5218 dbSNP
rs938711238 5218 dbSNP
rs936571253 5222 dbSNP
rs1048169393 5227 dbSNP
rs1170738620 5239 dbSNP
rs1411962437 5241 dbSNP
rs988034194 5257 dbSNP
rs1393665638 5263 dbSNP
rs866280289 5268 dbSNP
rs913740763 5272 dbSNP
rs933106985 5274 dbSNP
rs530683191 5275 dbSNP
rs888863604 5276 dbSNP
rs1206383363 5287 dbSNP
rs78157962 5291 dbSNP
rs758658561 5292 dbSNP
rs780284570 5294 dbSNP
rs747039581 5300 dbSNP
rs567964374 5305 dbSNP
rs1025811311 5308 dbSNP
rs1233466037 5310 dbSNP
rs898330824 5313 dbSNP
rs887282619 5323 dbSNP
rs773130889 5348 dbSNP
rs997043524 5349 dbSNP
rs1025097060 5355 dbSNP
rs1158975408 5356 dbSNP
rs1028248519 5367 dbSNP
rs567378347 5368 dbSNP
rs1007909911 5379 dbSNP
rs1312726198 5383 dbSNP
rs980824473 5385 dbSNP
rs1397488487 5387 dbSNP
rs1238225225 5391 dbSNP
rs1157591561 5395 dbSNP
rs1418506032 5396 dbSNP
rs955801967 5403 dbSNP
rs1179152746 5404 dbSNP
rs536036807 5407 dbSNP
rs1255095443 5408 dbSNP
rs1021347505 5413 dbSNP
rs1485888654 5414 dbSNP
rs1386338492 5416 dbSNP
rs1321641785 5421 dbSNP
rs970261279 5424 dbSNP
rs957987051 5425 dbSNP
rs1307162253 5426 dbSNP
rs749246238 5427 dbSNP
rs1353225345 5431 dbSNP
rs1293042089 5435 dbSNP
rs1415734816 5438 dbSNP
rs1377653250 5444 dbSNP
rs1287568844 5457 dbSNP
rs1453743228 5458 dbSNP
rs1491452420 5458 dbSNP
rs1474335465 5459 dbSNP
rs928923705 5459 dbSNP
rs988065244 5460 dbSNP
rs913812889 5461 dbSNP
rs1226196237 5464 dbSNP
rs527553461 5465 dbSNP
rs907874213 5466 dbSNP
rs987694925 5467 dbSNP
rs1488595688 5475 dbSNP
rs1208776504 5477 dbSNP
rs910332734 5479 dbSNP
rs942160133 5479 dbSNP
rs1332065293 5483 dbSNP
rs1292213714 5487 dbSNP
rs1233535793 5489 dbSNP
rs943127766 5491 dbSNP
rs1342619734 5497 dbSNP
rs546332916 5500 dbSNP
rs898827151 5503 dbSNP
rs1382123297 5510 dbSNP
rs770740924 5515 dbSNP
rs566192296 5516 dbSNP
rs1037752781 5518 dbSNP
rs538252927 5519 dbSNP
rs1258831866 5524 dbSNP
rs1439528434 5526 dbSNP
rs1182379475 5530 dbSNP
rs1165854822 5538 dbSNP
rs1410977250 5544 dbSNP
rs774330339 5545 dbSNP
rs879488131 5546 dbSNP
rs932514620 5547 dbSNP
rs558242696 5548 dbSNP
rs1047333837 5557 dbSNP
rs1466702558 5563 dbSNP
rs769125408 5565 dbSNP
rs1457563416 5574 dbSNP
rs1161566948 5576 dbSNP
rs887356058 5585 dbSNP
rs759438078 5586 dbSNP
rs1025550719 5589 dbSNP
rs1249951669 5591 dbSNP
rs891066334 5593 dbSNP
rs568818011 5594 dbSNP
rs1002716331 5605 dbSNP
rs1326742459 5608 dbSNP
rs1388713485 5616 dbSNP
rs1394671827 5620 dbSNP
rs1167582878 5621 dbSNP
rs1307888998 5622 dbSNP
rs538181194 5623 dbSNP
rs1170395272 5627 dbSNP
rs958059360 5633 dbSNP
rs1251797064 5639 dbSNP
rs1294269374 5641 dbSNP
rs866257129 5647 dbSNP
rs1452854357 5648 dbSNP
rs1243567290 5651 dbSNP
rs1263195753 5652 dbSNP
rs1194877942 5661 dbSNP
rs891472627 5663 dbSNP
rs1277288450 5664 dbSNP
rs1232738155 5666 dbSNP
rs1347843972 5682 dbSNP
rs1020910075 5690 dbSNP
rs1205244386 5692 dbSNP
rs1251060470 5693 dbSNP
rs1482017614 5701 dbSNP
rs1189846612 5708 dbSNP
rs1011213868 5709 dbSNP
rs1309662247 5716 dbSNP
rs1256547473 5723 dbSNP
rs954599742 5724 dbSNP
rs1174218077 5725 dbSNP
rs987379504 5728 dbSNP
rs910397134 5729 dbSNP
rs189282285 5731 dbSNP
rs1438113132 5738 dbSNP
rs970190181 5739 dbSNP
rs1374868405 5747 dbSNP
rs1209244636 5750 dbSNP
rs1485563933 5751 dbSNP
rs964536191 5752 dbSNP
rs1202714172 5755 dbSNP
rs1348608021 5756 dbSNP
rs1168026491 5762 dbSNP
rs149938263 5763 dbSNP
rs1272339119 5795 dbSNP
rs199924210 5804 dbSNP
rs920335099 5807 dbSNP
rs929011508 5816 dbSNP
rs1239988150 5819 dbSNP
rs1467290952 5825 dbSNP
rs1352610777 5829 dbSNP
rs1437092405 5834 dbSNP
rs775297305 5836 dbSNP
rs540787933 5845 dbSNP
rs117208498 5846 dbSNP
rs960354171 5852 dbSNP
rs908827120 5857 dbSNP
rs1334683003 5858 dbSNP
rs1416152157 5867 dbSNP
rs983666652 5873 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1