miRTarBase - #MIRT023358 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EYA4   
Synonyms CMD1J, DFNA10
Description EYA transcriptional coactivator and phosphatase 4
Transcript NM_004100   
Other Transcripts NM_172103 , NM_172105   
Expression
Putative miRNA Targets on EYA4
3'UTR of EYA4
(miRNA target sites are highlighted)
>EYA4|NM_004100|3'UTR
   1 CTGTGTTCTTTAGCCGGAGATCCATTTTTTATATTTCAAGTACACTGAATTTTTATGTGTGATTCAATGCCTCTGGCTCT
  81 ACACATATAAATTGTCTTAATGGATGAAATCATATTTGGAATAAAAATTCCAGAATGAAGAATTCAGATTGCTGAATGGA
 161 GTTAAACTTTAGTGCTACAGAAAAGAAACTCTATGGTCTTATATTTACAACACTTTAATGGGTTTTTTAAAAATCTGTGG
 241 AGGTTGCTGGTACACACCAAATGAGTCCAAACTGGAATGAGCAGCTTTAGCAAAGAACTCTTACCCTGGCAAAGCAGCAA
 321 CACACATGCTCCGTCTGACAAGGTGGTCAACAACATTCCTCAAAATGGGAGATCTTCTCAGCCCTGAGGTTTGAATCTGA
 401 CTTTAGCCTACCTAACCCAGAAAATCTGAATTGGAATGCACTCAGACTGTATAAGGACAGTCCTATTTAGACATGTAATT
 481 TGTGTAAATTATTGATGAAAATAATTTACTGTGACTTTATTAGCAGCTGACTTTCAAAGTGGATGCAATTTTTCTTTCTT
 561 TTGTTGGGGAGGGGAATGGGAGGGGAAATGGGAATATAATATTGTCTCTTTTTTAAGTTTGGCAAACAGAATGTTCATAC
 641 TGATGTGTTGTGCCTTAAAGACAAGACAGCATTTGTGTGTTACAATGTAACTTTGGTTAAAATCTCTGTAGATAATGAAA
 721 AAAAACAAAAAAAAAAACCTTTGTGATGATTCTTAACATGACCAAATTTAAAAGTCAAGCTCTCAGAGCTTAATTACCGC
 801 ATCAGCAAGAAACTGAGTATTTTTTGCAATAAGAAAACAACAATAATAAAGGAAAGCTTGTGTTTCATTTGGGTTCTTAA
 881 TAATTCCAATAATTGTATGAGGCAACTATTTGCGCATCCAACCATGAGTGGAAGGTTTGGGAAAGACTGTGGGACCTTTA
 961 CTTAGAAAGTGAAATGTATGTAGAAGTCTCAAGTACCCCTTCTACAGTTTTACTGGAGAAAACTAAGAGCCATATTCATG
1041 ACAACTTGCACAGTTTTGAGGTTGAGACTTTTGATATGTGTAAGTTGCATAGAGGAGGATATTATCATGCAAATCATGAG
1121 CAATTATCACATAAACTTTTTTAGAATGTGCCATGAACATGGCATAAAATTCACATTGAGTGCACAGGGCTTAAAATAAA
1201 GCTAAGTATGTTTATTCCCAATGCCATGGCAAAAATGATAATATCATCAGAAATGGAAGGCAGTTCTCCCAGATGGTGTC
1281 TAATGAAAGCAATGAGTCTATGAAAATTTTACCTAGAATATCATCATAAATTAAATTAGCAAGTGCGCTGGATCTTGGCA
1361 GCGCTGCTGAAATGACAACAGTAAAATAATACCTGGTTCTCCATCTGAATACATCAATGCAGGTTCTCCTCGTAACAGAC
1441 TTGCATATGTTTGTTAGTTTCTGCCTGTATTGTCACTGCGCAACGGATGGCATTCATTACAAGAAGAGCCCATCATCGTT
1521 GTGTTTGCATGGTTTTTTTCCTTGTGTGTAGCCCATGTTGGGAACACGATACAGGTTCTCCTCTTATTTCCTATGACACG
1601 ATTTCCCTTGTGGAAATTTAAGACTTTAAGAACTAGAGTATTTTTATGGTGTCTGCACCTGCAGTTCTGTGTTTAAAATG
1681 TCATAATGTGGATCCTGGAGTCAGGCTACTAGTCAGTGCCCCTAGCCAGAGGCTGGTTCATGAGTTCATCAACTGAGGCC
1761 TCTGTGGCTTCAATAAAGTCTACATTTTGCTCACAGATCACAACATTCACTGTGGAAATATGATTTCATTTCTTTAGGCT
1841 ACAAACCTGTATTTCTTTACTGAATGCTAAGGCCATGTTTATATTGGGTAGAAAGATATTGAGATCCCAATTTTGTACAA
1921 GATTGTGATTTCATTATCTAAACCTTAAACTTAATCCTTTAAATTTTGTAGCTTTTGGCTGCATCTGCCCCAAGTACTAT
2001 TCCAGGCAAATTAAAGTTGGAATACCTTTAATAATATAAAAATAATGATAGTAAATCTTATACTTCTGTTGGCCCTTAGC
2081 TTGAAAATAGCAGTTAAAAAAATTTAAATGTTGCCTTGATTATCAGTACTTAATTATGTTGTGCACTAAAACCTTAAATA
2161 TTTATTACTGTGAATAAAAACAAATTATCTTTACTGTATAGCTGGTTTCTTTAAATGTTGATAGAATTGTGGCATTACAT
2241 CTAAATTTGTAAGTCTTTTCATATCAAACAAGCAAGGCTTTTTATGCTGCTAAGTCTGTGGGTGCAGAAAGAAACACCCC
2321 TTGGAAGGGCAAAGAGAAGCCGGCTGGTTGCATCACCCCGTGCAGTTTCTCACACACATCTCTTTTTCTGATTCTGTGTT
2401 CAGAAGAGGCTGCCGGCATAAAACCTAAATGCAAGGTTGACGGAGAACAGCTTGTCTGGCACAACAATGGTGCAGGCCCA
2481 CGAGCCAGCATCACAGCTTGGCCATGGGACGTTGAGTATGCACAAACTAGAACTCTTCCCTTCCCACCTTAGGAATAGAA
2561 AATCCTCTTCCTTTCTAATCTGAAAAACGAAAACTGAACAAACACAAAACCAACCCCTTGGCAGTTCCCACCTCCTATTG
2641 ACATATGGAATATTGTGCCTTATTGTAAACCAGTTTGAAAAATGTTCTGTAACTAAAGTGGGTTTTCGGCTATTATGTAT
2721 ACAGCTTGGTATATTACTACGAAAGATAACCACCTTGTGTTGCACCTTAAAAATATCAAGACCATGTAATTTCCATAACA
2801 AAATAGGTGGCCTGGCTATGGTATTATAGCATACAATTAGGACACTATGCCCCTGCAAAATTTTGTAAATCAAATTCAGA
2881 GGCAAAAACATATTTTAGAATCATACAGTTTGCACACGACAAGTAGGTAATAACTGTCTCTAAAAATGTTTTCTCCTTAG
2961 TCCGCAATGAGCTAAGATTCAGAATAGTGTCAACAGCATGCTCCTATATGAAGTTGTTTTTTTTAAAGCACATTTGTTTA
3041 TGACAAGCCTACATTCTCAGTGAATATGGCATTTAGTATTTCTTTTGAAAACAAACTTAAGCATCATGAGCCAAAGTTGC
3121 ACTTTGACTCCCAACTACGGTAGCATTATGGACATCTCACAATGTCAAGGGTTTCTGTTATGTATTAGTAAAGTATAGAT
3201 TATTGGGGCCTACATAATTTAAAAGAAATGTAAATTAATATTAAAAGCTTGTAAAAATATGTATATCTTTACTATTTCTC
3281 AATAAATACCTTTGCAATTGTTTTCATTTCCTTCAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG----UGUGAGGu 5'
            :|||  :| |||    |||:||| 
Target 5' ctGACAAGGTGGTCAACAACATTCCt 3'
335 - 360 138.00 -11.50
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |||| ||    ||::|||| 
Target 5' gcAACA-CA----CATGCTCCg 3'
317 - 333 121.00 -11.90
3
miRNA  3' guUUGUGGUAACAG-----------UGUGAGGu 5'
            ||| |:|| |||           |||||:: 
Target 5' gaAACTCTATGGTCTTATATTTACAACACTTTa 3'
185 - 217 120.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
496552 7 ClinVar
905513 16 ClinVar
355448 24 ClinVar
905514 223 ClinVar
905515 266 ClinVar
906022 309 ClinVar
355449 334 ClinVar
906023 348 ClinVar
906024 380 ClinVar
907040 567 ClinVar
907041 634 ClinVar
355450 727 ClinVar
355451 727 ClinVar
904792 733 ClinVar
904793 757 ClinVar
355452 1137 ClinVar
355453 1265 ClinVar
904794 1347 ClinVar
355454 1351 ClinVar
905583 1364 ClinVar
355455 1435 ClinVar
905584 1441 ClinVar
906089 1485 ClinVar
355456 1514 ClinVar
906090 1533 ClinVar
906091 1552 ClinVar
907096 1601 ClinVar
355457 1659 ClinVar
355458 1745 ClinVar
903729 1771 ClinVar
355459 1813 ClinVar
903730 1821 ClinVar
355460 1868 ClinVar
355461 1906 ClinVar
905647 1944 ClinVar
355462 2011 ClinVar
905648 2045 ClinVar
905649 2050 ClinVar
355463 2109 ClinVar
355464 2185 ClinVar
355465 2189 ClinVar
355466 2270 ClinVar
355467 2303 ClinVar
355468 2360 ClinVar
355469 2361 ClinVar
903809 2378 ClinVar
903810 2440 ClinVar
355470 2477 ClinVar
355471 2512 ClinVar
355472 2589 ClinVar
355473 2661 ClinVar
905714 2686 ClinVar
355474 2751 ClinVar
355475 2760 ClinVar
905715 2919 ClinVar
355476 2969 ClinVar
355477 3015 ClinVar
906225 3122 ClinVar
906226 3133 ClinVar
907223 3161 ClinVar
907224 3212 ClinVar
907225 3227 ClinVar
355478 3268 ClinVar
COSN30185587 3 COSMIC
COSN31580945 9 COSMIC
COSN508141 16 COSMIC
COSN30482496 18 COSMIC
COSN31599573 20 COSMIC
COSN14689464 24 COSMIC
COSN31614214 31 COSMIC
COSN30180249 39 COSMIC
COSN31613403 43 COSMIC
COSN30483659 48 COSMIC
COSN31599356 52 COSMIC
COSN30135396 71 COSMIC
COSN30518768 92 COSMIC
COSN31543017 95 COSMIC
COSN31518498 100 COSMIC
COSN31613693 101 COSMIC
COSN20120015 112 COSMIC
COSN31523513 125 COSMIC
COSN30533757 176 COSMIC
COSN31572065 199 COSMIC
COSN19660894 229 COSMIC
COSN31518420 276 COSMIC
COSN31527494 296 COSMIC
COSN20103363 307 COSMIC
COSN31550518 355 COSMIC
COSN31550802 383 COSMIC
COSN30158020 400 COSMIC
COSN19003642 452 COSMIC
COSN15196148 481 COSMIC
COSN31585872 508 COSMIC
COSN19663873 547 COSMIC
COSN31485699 552 COSMIC
COSN31549072 559 COSMIC
COSN31556083 690 COSMIC
COSN28918565 727 COSMIC
COSN24301682 728 COSMIC
COSN20527720 738 COSMIC
COSN27231060 738 COSMIC
COSN30544439 838 COSMIC
COSN15098591 914 COSMIC
COSN26894813 922 COSMIC
COSN6588892 1069 COSMIC
COSN22150208 1347 COSMIC
COSN23700144 1432 COSMIC
COSN9297562 1445 COSMIC
COSN24622030 1507 COSMIC
COSN22739656 1637 COSMIC
COSN2142357 1652 COSMIC
COSN9297563 1713 COSMIC
COSN30539912 1768 COSMIC
COSN28674748 1868 COSMIC
COSN28635765 1882 COSMIC
COSN8493692 1882 COSMIC
COSN25260174 1931 COSMIC
COSN27660305 2181 COSMIC
COSN18718843 2199 COSMIC
COSN20075568 2221 COSMIC
COSN26437457 2277 COSMIC
COSN14681072 2303 COSMIC
COSN20075571 2335 COSMIC
COSN30752299 2351 COSMIC
COSN20938180 2399 COSMIC
COSN30090372 2404 COSMIC
COSN20073320 2415 COSMIC
COSN32251827 2417 COSMIC
COSN28746495 2440 COSMIC
COSN7690067 2442 COSMIC
COSN26677890 2621 COSMIC
COSN31589071 2726 COSMIC
COSN31514068 2795 COSMIC
COSN19484356 2796 COSMIC
COSN26849603 2856 COSMIC
COSN7690068 2857 COSMIC
COSN28201059 2908 COSMIC
COSN32058654 3045 COSMIC
COSN29205330 3122 COSMIC
COSN19360273 3208 COSMIC
COSN21833211 3273 COSMIC
COSN31639474 3279 COSMIC
COSN2142358 3311 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772920962 3 dbSNP
rs1020367366 5 dbSNP
rs762905955 8 dbSNP
rs766259463 10 dbSNP
rs966989614 15 dbSNP
rs773904240 16 dbSNP
rs376077686 17 dbSNP
rs767270382 18 dbSNP
rs752280888 22 dbSNP
rs3734279 24 dbSNP
rs762378482 25 dbSNP
rs774954777 25 dbSNP
rs765702716 26 dbSNP
rs750777633 27 dbSNP
rs759022263 33 dbSNP
rs780675614 36 dbSNP
rs938191931 37 dbSNP
rs1376374401 38 dbSNP
rs747179143 40 dbSNP
rs1255056755 42 dbSNP
rs768043447 44 dbSNP
rs990936240 45 dbSNP
rs1226412038 47 dbSNP
rs1465966957 63 dbSNP
rs1250365607 67 dbSNP
rs916699019 68 dbSNP
rs971219532 69 dbSNP
rs982139051 78 dbSNP
rs1266736270 85 dbSNP
rs918550853 88 dbSNP
rs929925558 102 dbSNP
rs1322342209 126 dbSNP
rs1048316782 141 dbSNP
rs34027993 148 dbSNP
rs529648360 154 dbSNP
rs902814899 157 dbSNP
rs942538345 162 dbSNP
rs527715225 176 dbSNP
rs1400612007 177 dbSNP
rs1434030823 194 dbSNP
rs1316727767 197 dbSNP
rs999907409 202 dbSNP
rs1032713262 206 dbSNP
rs1457983887 208 dbSNP
rs1367445125 212 dbSNP
rs1162087435 213 dbSNP
rs1039548656 214 dbSNP
rs975261543 214 dbSNP
rs900959456 217 dbSNP
rs998303327 223 dbSNP
rs1212209005 224 dbSNP
rs1041389862 228 dbSNP
rs1264973260 249 dbSNP
rs1220327499 250 dbSNP
rs1344614196 253 dbSNP
rs1298560522 254 dbSNP
rs1227403199 256 dbSNP
rs1362697360 259 dbSNP
rs955337817 264 dbSNP
rs983068379 266 dbSNP
rs908552217 278 dbSNP
rs1381406551 303 dbSNP
rs3842093 304 dbSNP
rs397787787 304 dbSNP
rs780007229 305 dbSNP
rs999799440 309 dbSNP
rs1354377148 327 dbSNP
rs926677062 329 dbSNP
rs546518910 332 dbSNP
rs894053783 333 dbSNP
rs746964933 334 dbSNP
rs1434297565 348 dbSNP
rs1023720917 352 dbSNP
rs970846632 359 dbSNP
rs1220398567 362 dbSNP
rs918054922 368 dbSNP
rs982578038 374 dbSNP
rs1025660001 380 dbSNP
rs1313681392 385 dbSNP
rs1042582068 389 dbSNP
rs1257583436 391 dbSNP
rs1233676868 398 dbSNP
rs1211095705 402 dbSNP
rs1299021442 405 dbSNP
rs114941538 408 dbSNP
rs1350633659 410 dbSNP
rs1306863760 413 dbSNP
rs1169311287 420 dbSNP
rs1460136789 442 dbSNP
rs1180637980 452 dbSNP
rs1238832186 461 dbSNP
rs1174704689 476 dbSNP
rs984107457 478 dbSNP
rs1466843221 485 dbSNP
rs538512265 490 dbSNP
rs1197826062 491 dbSNP
rs909832897 492 dbSNP
rs1473851274 495 dbSNP
rs1470099460 508 dbSNP
rs942590456 521 dbSNP
rs1181510287 525 dbSNP
rs1436339221 536 dbSNP
rs1258482319 544 dbSNP
rs1200827615 551 dbSNP
rs1343957779 556 dbSNP
rs1157289280 570 dbSNP
rs1292804652 572 dbSNP
rs1427711053 584 dbSNP
rs1329738319 589 dbSNP
rs1287209361 593 dbSNP
rs899596195 604 dbSNP
rs1341930820 627 dbSNP
rs1334332543 632 dbSNP
rs996978211 634 dbSNP
rs1029502866 638 dbSNP
rs975246197 644 dbSNP
rs1404965251 651 dbSNP
rs1449975624 662 dbSNP
rs1413316300 668 dbSNP
rs1332830346 670 dbSNP
rs567583721 671 dbSNP
rs1335784881 672 dbSNP
rs1004167401 676 dbSNP
rs1239444722 684 dbSNP
rs371085173 686 dbSNP
rs1369641785 688 dbSNP
rs933768865 696 dbSNP
rs1241080582 697 dbSNP
rs1223956415 699 dbSNP
rs1015517656 717 dbSNP
rs1267378552 718 dbSNP
rs1368384338 718 dbSNP
rs1335202120 719 dbSNP
rs1262250957 725 dbSNP
rs199939442 726 dbSNP
rs55805978 727 dbSNP
rs749389761 727 dbSNP
rs886061090 727 dbSNP
rs962728831 727 dbSNP
rs1200713225 729 dbSNP
rs1163877619 732 dbSNP
rs1472618646 732 dbSNP
rs902919934 733 dbSNP
rs1449780669 738 dbSNP
rs1247362877 739 dbSNP
rs1437254648 739 dbSNP
rs935703369 740 dbSNP
rs1213629685 744 dbSNP
rs568665526 747 dbSNP
rs538007180 751 dbSNP
rs538385030 753 dbSNP
rs1290019900 754 dbSNP
rs1208705842 760 dbSNP
rs1249034688 762 dbSNP
rs1356853056 777 dbSNP
rs1231092203 779 dbSNP
rs147339459 779 dbSNP
rs1054047961 780 dbSNP
rs1269973014 781 dbSNP
rs1429289128 784 dbSNP
rs992612130 790 dbSNP
rs1324304571 799 dbSNP
rs894065195 800 dbSNP
rs574813657 804 dbSNP
rs1012421149 809 dbSNP
rs945525992 817 dbSNP
rs1199198326 818 dbSNP
rs1042656068 820 dbSNP
rs187746879 826 dbSNP
rs936896852 832 dbSNP
rs1247166379 836 dbSNP
rs1197587794 860 dbSNP
rs1489604705 867 dbSNP
rs1205512892 882 dbSNP
rs1276137295 882 dbSNP
rs1340982286 890 dbSNP
rs1272799633 892 dbSNP
rs1213122694 895 dbSNP
rs1370399018 897 dbSNP
rs1467929547 902 dbSNP
rs1172302005 908 dbSNP
rs1396602050 914 dbSNP
rs1023820022 915 dbSNP
rs1326268586 922 dbSNP
rs1332805673 925 dbSNP
rs899458108 925 dbSNP
rs1405445635 926 dbSNP
rs1415923072 939 dbSNP
rs1425793521 962 dbSNP
rs754758889 964 dbSNP
rs1175688511 967 dbSNP
rs1282429304 970 dbSNP
rs906673410 972 dbSNP
rs1479412055 974 dbSNP
rs1003694448 976 dbSNP
rs554178779 980 dbSNP
rs1230773435 981 dbSNP
rs1338976879 982 dbSNP
rs1202866812 985 dbSNP
rs1314247473 987 dbSNP
rs951434516 991 dbSNP
rs984159791 997 dbSNP
rs1016904535 1000 dbSNP
rs1051281941 1003 dbSNP
rs1290347913 1005 dbSNP
rs891002496 1006 dbSNP
rs1292077798 1008 dbSNP
rs1004032766 1017 dbSNP
rs1296601384 1019 dbSNP
rs577625750 1022 dbSNP
rs368346286 1028 dbSNP
rs975298813 1029 dbSNP
rs962631097 1042 dbSNP
rs995398329 1049 dbSNP
rs1491540363 1050 dbSNP
rs922478775 1057 dbSNP
rs1373355931 1061 dbSNP
rs933847881 1062 dbSNP
rs1474866706 1067 dbSNP
rs1405357828 1069 dbSNP
rs1165689490 1071 dbSNP
rs959599469 1071 dbSNP
rs773922539 1088 dbSNP
rs546476839 1089 dbSNP
rs1025477186 1100 dbSNP
rs1460390550 1104 dbSNP
rs1270533757 1105 dbSNP
rs1229093374 1107 dbSNP
rs1316355813 1108 dbSNP
rs556090403 1119 dbSNP
rs1380132879 1120 dbSNP
rs978216133 1120 dbSNP
rs1335865402 1122 dbSNP
rs1363489869 1125 dbSNP
rs1450132296 1127 dbSNP
rs1390748165 1132 dbSNP
rs1321073692 1135 dbSNP
rs886061091 1137 dbSNP
rs925432540 1137 dbSNP
rs1342999072 1148 dbSNP
rs1318711712 1153 dbSNP
rs935714660 1155 dbSNP
rs571458030 1158 dbSNP
rs1326122099 1159 dbSNP
rs75052704 1160 dbSNP
rs1054059282 1164 dbSNP
rs915550985 1174 dbSNP
rs974932183 1179 dbSNP
rs1443093973 1182 dbSNP
rs1286051256 1199 dbSNP
rs920973587 1203 dbSNP
rs1206306583 1205 dbSNP
rs75704251 1210 dbSNP
rs759095348 1214 dbSNP
rs1259089366 1219 dbSNP
rs1223797073 1222 dbSNP
rs948327156 1226 dbSNP
rs1045753265 1227 dbSNP
rs1243513649 1231 dbSNP
rs374052557 1238 dbSNP
rs1367165297 1244 dbSNP
rs1050890222 1247 dbSNP
rs1381623451 1256 dbSNP
rs9483585 1265 dbSNP
rs1294800081 1272 dbSNP
rs890859539 1277 dbSNP
rs1364577894 1284 dbSNP
rs560805387 1293 dbSNP
rs1431242172 1301 dbSNP
rs769453409 1303 dbSNP
rs1005604379 1306 dbSNP
rs1206147306 1318 dbSNP
rs898290498 1324 dbSNP
rs1260208486 1344 dbSNP
rs1192994430 1345 dbSNP
rs772550313 1347 dbSNP
rs964015985 1348 dbSNP
rs553570769 1351 dbSNP
rs895186297 1355 dbSNP
rs1030027447 1360 dbSNP
rs1324654597 1363 dbSNP
rs539858245 1364 dbSNP
rs1386859419 1373 dbSNP
rs1383370003 1381 dbSNP
rs1300708388 1393 dbSNP
rs1411329621 1395 dbSNP
rs1370737305 1409 dbSNP
rs1025085630 1413 dbSNP
rs977662216 1414 dbSNP
rs966785337 1418 dbSNP
rs770388782 1421 dbSNP
rs924414648 1432 dbSNP
rs1421417704 1433 dbSNP
rs9483586 1435 dbSNP
rs1484174188 1438 dbSNP
rs1251468796 1441 dbSNP
rs1383909124 1448 dbSNP
rs1195016041 1453 dbSNP
rs1337138851 1454 dbSNP
rs1257527397 1470 dbSNP
rs1380760537 1473 dbSNP
rs989837535 1480 dbSNP
rs532278099 1481 dbSNP
rs116238383 1485 dbSNP
rs545500595 1486 dbSNP
rs928243767 1490 dbSNP
rs939578289 1497 dbSNP
rs1047683363 1498 dbSNP
rs1470618567 1501 dbSNP
rs531393207 1504 dbSNP
rs1260523799 1512 dbSNP
rs886061092 1514 dbSNP
rs1348910995 1515 dbSNP
rs867018264 1519 dbSNP
rs1038487456 1521 dbSNP
rs1436289354 1529 dbSNP
rs776008831 1533 dbSNP
rs548694298 1535 dbSNP
rs377162172 1540 dbSNP
rs1261104356 1547 dbSNP
rs1350829316 1552 dbSNP
rs895041455 1552 dbSNP
rs1278438356 1559 dbSNP
rs760928719 1568 dbSNP
rs553476791 1569 dbSNP
rs902489940 1570 dbSNP
rs1029625648 1573 dbSNP
rs1032386848 1575 dbSNP
rs1459272954 1584 dbSNP
rs1385848964 1586 dbSNP
rs958226759 1592 dbSNP
rs955480870 1600 dbSNP
rs998755605 1601 dbSNP
rs1240691358 1606 dbSNP
rs1029135388 1608 dbSNP
rs1295659919 1609 dbSNP
rs571675814 1613 dbSNP
rs1159671504 1618 dbSNP
rs1241019567 1626 dbSNP
rs1031486855 1636 dbSNP
rs1447478122 1641 dbSNP
rs1451444534 1651 dbSNP
rs1174099003 1653 dbSNP
rs1361927617 1656 dbSNP
rs73546865 1659 dbSNP
rs1027700334 1662 dbSNP
rs1291972004 1665 dbSNP
rs1247196193 1666 dbSNP
rs1469459420 1669 dbSNP
rs989931057 1670 dbSNP
rs1313368435 1671 dbSNP
rs961020974 1678 dbSNP
rs1327479405 1698 dbSNP
rs1317758577 1706 dbSNP
rs754043989 1709 dbSNP
rs972516490 1722 dbSNP
rs1393163270 1733 dbSNP
rs1334834675 1739 dbSNP
rs554215772 1741 dbSNP
rs542230437 1745 dbSNP
rs1383193010 1746 dbSNP
rs1190244209 1749 dbSNP
rs931161902 1753 dbSNP
rs981515129 1759 dbSNP
rs765287346 1771 dbSNP
rs1268962378 1772 dbSNP
rs939611538 1773 dbSNP
rs1235959906 1774 dbSNP
rs983030009 1778 dbSNP
rs191469181 1781 dbSNP
rs1290106154 1785 dbSNP
rs1216649041 1786 dbSNP
rs1264119079 1797 dbSNP
rs1340685327 1806 dbSNP
rs1270067865 1811 dbSNP
rs555600336 1813 dbSNP
rs184735364 1821 dbSNP
rs1303801473 1822 dbSNP
rs1404616135 1828 dbSNP
rs1202588341 1833 dbSNP
rs941543513 1847 dbSNP
rs1363889025 1850 dbSNP
rs1260724137 1861 dbSNP
rs17053540 1868 dbSNP
rs142545479 1875 dbSNP
rs1177272691 1876 dbSNP
rs1166147635 1878 dbSNP
rs1478968178 1878 dbSNP
rs1249805951 1889 dbSNP
rs949336810 1890 dbSNP
rs1201373631 1891 dbSNP
rs542036379 1906 dbSNP
rs1207077511 1916 dbSNP
rs150567885 1944 dbSNP
rs902561734 1945 dbSNP
rs1174469803 1947 dbSNP
rs1213368545 1947 dbSNP
rs574459334 1958 dbSNP
rs1222941415 1968 dbSNP
rs139584647 1970 dbSNP
rs1300056038 1979 dbSNP
rs1297665294 1996 dbSNP
rs1353782547 2007 dbSNP
rs1395026582 2010 dbSNP
rs886061093 2011 dbSNP
rs1388999156 2012 dbSNP
rs1218573600 2014 dbSNP
rs1470945951 2017 dbSNP
rs891106997 2030 dbSNP
rs1429854349 2037 dbSNP
rs59167148 2045 dbSNP
rs1031580406 2049 dbSNP
rs752513150 2050 dbSNP
rs893907241 2053 dbSNP
rs1469280892 2061 dbSNP
rs996253346 2075 dbSNP
rs893044924 2084 dbSNP
rs1308880962 2085 dbSNP
rs369227704 2105 dbSNP
rs17053541 2109 dbSNP
rs1203130098 2112 dbSNP
rs1250239227 2113 dbSNP
rs1309233685 2114 dbSNP
rs767362242 2116 dbSNP
rs1372851365 2125 dbSNP
rs1277582113 2127 dbSNP
rs1454343058 2131 dbSNP
rs1022712672 2134 dbSNP
rs1224572693 2147 dbSNP
rs1269342624 2148 dbSNP
rs1406746805 2155 dbSNP
rs970221281 2159 dbSNP
rs1015179143 2166 dbSNP
rs1197007540 2171 dbSNP
rs376137523 2183 dbSNP
rs17053542 2185 dbSNP
rs1159165893 2186 dbSNP
rs376366555 2189 dbSNP
rs1177167288 2197 dbSNP
rs919562911 2197 dbSNP
rs1446765224 2205 dbSNP
rs1371366566 2209 dbSNP
rs950437826 2210 dbSNP
rs1183586439 2215 dbSNP
rs531602978 2233 dbSNP
rs1262621431 2234 dbSNP
rs1216531179 2238 dbSNP
rs983103088 2242 dbSNP
rs1282347514 2250 dbSNP
rs1248425911 2258 dbSNP
rs548096495 2259 dbSNP
rs568204536 2262 dbSNP
rs533609774 2270 dbSNP
rs1314065318 2273 dbSNP
rs1403551717 2286 dbSNP
rs941553356 2289 dbSNP
rs916435576 2290 dbSNP
rs949245741 2299 dbSNP
rs41286208 2303 dbSNP
rs923849661 2306 dbSNP
rs1214758775 2317 dbSNP
rs935223041 2321 dbSNP
rs1165148213 2322 dbSNP
rs921412168 2330 dbSNP
rs1446119008 2341 dbSNP
rs932744767 2342 dbSNP
rs1292491373 2343 dbSNP
rs1051210313 2347 dbSNP
rs1422609756 2347 dbSNP
rs1264429272 2353 dbSNP
rs547907467 2360 dbSNP
rs886061094 2361 dbSNP
rs1479197630 2362 dbSNP
rs1205497819 2378 dbSNP
rs934711269 2379 dbSNP
rs1157398227 2380 dbSNP
rs1261122884 2382 dbSNP
rs1482983020 2392 dbSNP
rs1360410036 2395 dbSNP
rs1053048547 2401 dbSNP
rs149715482 2409 dbSNP
rs781272288 2410 dbSNP
rs748320254 2415 dbSNP
rs769960534 2416 dbSNP
rs1430447582 2424 dbSNP
rs114670853 2426 dbSNP
rs1174951025 2427 dbSNP
rs556844312 2429 dbSNP
rs758548564 2435 dbSNP
rs1465152807 2436 dbSNP
rs1298238435 2440 dbSNP
rs570269258 2442 dbSNP
rs1015213186 2443 dbSNP
rs1287258119 2448 dbSNP
rs1345935128 2452 dbSNP
rs1225073220 2455 dbSNP
rs879890509 2456 dbSNP
rs1311508876 2460 dbSNP
rs1205380783 2465 dbSNP
rs995064139 2468 dbSNP
rs1482083096 2470 dbSNP
rs1163383492 2471 dbSNP
rs1204737580 2471 dbSNP
rs1022768163 2473 dbSNP
rs201389132 2475 dbSNP
rs886061095 2477 dbSNP
rs146768600 2482 dbSNP
rs1375124790 2483 dbSNP
rs1003102332 2487 dbSNP
rs991016119 2497 dbSNP
rs1454169052 2501 dbSNP
rs1315108077 2511 dbSNP
rs560590444 2512 dbSNP
rs950516994 2515 dbSNP
rs1243626564 2518 dbSNP
rs983117921 2522 dbSNP
rs1490583595 2524 dbSNP
rs555686436 2525 dbSNP
rs970999082 2529 dbSNP
rs572598615 2540 dbSNP
rs1207852975 2541 dbSNP
rs1481527796 2550 dbSNP
rs1015902175 2566 dbSNP
rs1251670089 2581 dbSNP
rs140401218 2589 dbSNP
rs553437932 2590 dbSNP
rs576461073 2597 dbSNP
rs1223554250 2617 dbSNP
rs1344483101 2621 dbSNP
rs923753725 2628 dbSNP
rs1392765723 2632 dbSNP
rs921495194 2638 dbSNP
rs989322263 2639 dbSNP
rs954264440 2644 dbSNP
rs915260718 2646 dbSNP
rs116548108 2651 dbSNP
rs931996175 2654 dbSNP
rs886061096 2661 dbSNP
rs1480771162 2663 dbSNP
rs545419920 2672 dbSNP
rs41286210 2686 dbSNP
rs1462808629 2701 dbSNP
rs1184335820 2708 dbSNP
rs912688576 2709 dbSNP
rs1251037196 2715 dbSNP
rs934709237 2723 dbSNP
rs1194967421 2728 dbSNP
rs1456413842 2730 dbSNP
rs549410299 2737 dbSNP
rs1053058853 2741 dbSNP
rs995121778 2742 dbSNP
rs1027907405 2746 dbSNP
rs886061097 2751 dbSNP
rs888134350 2754 dbSNP
rs1335927091 2755 dbSNP
rs1320204343 2758 dbSNP
rs886061098 2760 dbSNP
rs1023695276 2762 dbSNP
rs1398751352 2766 dbSNP
rs1339337586 2777 dbSNP
rs970524620 2780 dbSNP
rs768947607 2783 dbSNP
rs374232339 2785 dbSNP
rs905762502 2788 dbSNP
rs143596676 2800 dbSNP
rs1364564124 2807 dbSNP
rs542058220 2810 dbSNP
rs561779137 2814 dbSNP
rs886197124 2819 dbSNP
rs1336852151 2824 dbSNP
rs1381339926 2835 dbSNP
rs1004605087 2847 dbSNP
rs1015954497 2849 dbSNP
rs1460798047 2853 dbSNP
rs1445752113 2860 dbSNP
rs776895586 2866 dbSNP
rs963062977 2871 dbSNP
rs1206343185 2879 dbSNP
rs1281279968 2905 dbSNP
rs995828196 2916 dbSNP
rs1028605361 2918 dbSNP
rs75986250 2919 dbSNP
rs1281848035 2924 dbSNP
rs1325966215 2928 dbSNP
rs986992285 2929 dbSNP
rs912690779 2931 dbSNP
rs956139106 2943 dbSNP
rs932002876 2949 dbSNP
rs547945546 2964 dbSNP
rs185922920 2965 dbSNP
rs911857233 2968 dbSNP
rs181492427 2969 dbSNP
rs749177727 2972 dbSNP
rs866060640 2977 dbSNP
rs947420025 2981 dbSNP
rs1163923966 3001 dbSNP
rs767475976 3007 dbSNP
rs76510133 3015 dbSNP
rs755998255 3016 dbSNP
rs938563120 3016 dbSNP
rs1214053217 3017 dbSNP
rs1260427411 3017 dbSNP
rs777738050 3025 dbSNP
rs549917496 3033 dbSNP
rs1056978292 3037 dbSNP
rs569987812 3042 dbSNP
rs1356270861 3046 dbSNP
rs1175891947 3047 dbSNP
rs1282886140 3047 dbSNP
rs1433491918 3048 dbSNP
rs1327172282 3049 dbSNP
rs535820414 3050 dbSNP
rs1398406167 3069 dbSNP
rs1367634824 3079 dbSNP
rs1303535323 3087 dbSNP
rs1423697810 3097 dbSNP
rs1431856122 3115 dbSNP
rs755881972 3122 dbSNP
rs1049807530 3135 dbSNP
rs1176632481 3138 dbSNP
rs773729529 3139 dbSNP
rs1490747619 3140 dbSNP
rs1269075592 3141 dbSNP
rs1412316652 3152 dbSNP
rs185303391 3164 dbSNP
rs894742708 3167 dbSNP
rs565969311 3183 dbSNP
rs1288166890 3189 dbSNP
rs1385210893 3207 dbSNP
rs1013564969 3209 dbSNP
rs1247014497 3211 dbSNP
rs140619740 3212 dbSNP
rs199878738 3214 dbSNP
rs1286247256 3215 dbSNP
rs1216799807 3226 dbSNP
rs73546871 3227 dbSNP
rs370484570 3229 dbSNP
rs1003279148 3247 dbSNP
rs1436020228 3249 dbSNP
rs1224355237 3250 dbSNP
rs1282960773 3252 dbSNP
rs954329355 3258 dbSNP
rs1399409218 3260 dbSNP
rs1167923997 3261 dbSNP
rs1481100817 3263 dbSNP
rs886061099 3268 dbSNP
rs956559899 3278 dbSNP
rs1198330823 3283 dbSNP
rs557906515 3290 dbSNP
rs1273769812 3296 dbSNP
rs569444729 3297 dbSNP
rs865823204 3311 dbSNP
rs539476063 3319 dbSNP
rs1019800195 3324 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.747 1.4e-5 -0.692 9.0e-5 24 Click to see details
GSE28260 Renal cortex and medulla 0.697 4.1e-3 0.610 1.3e-2 13 Click to see details
GSE27834 Pluripotent stem cells -0.528 1.8e-2 -0.629 4.5e-3 16 Click to see details
GSE21687 Ependynoma primary tumors 0.258 2.0e-2 0.272 1.5e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.417 2.4e-2 0.528 4.8e-3 23 Click to see details
GSE17306 Multiple myeloma 0.273 2.9e-2 0.388 2.9e-3 49 Click to see details
GSE38226 Liver fibrosis 0.408 3.3e-2 0.327 7.4e-2 21 Click to see details
GSE19350 CNS germ cell tumors 0.516 4.3e-2 0.451 7.1e-2 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.293 7.8e-2 0.237 1.3e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.256 7.9e-2 -0.294 5.1e-2 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.28 8.8e-2 0.275 9.2e-2 25 Click to see details
GSE17498 Multiple myeloma 0.178 1.4e-1 0.169 1.5e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.251 1.4e-1 -0.235 1.6e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.193 1.8e-1 0.168 2.2e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.037 3.6e-1 0.012 4.6e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.037 4.7e-1 0.143 3.9e-1 6 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.037 4.7e-1 0.143 3.9e-1 6 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KICH -0.823 0.01 -0.762 0.01 8 Click to see details
KIRP -0.43 0.12 -0.417 0.13 9 Click to see details
THCA 0.518 0.19 0.300 0.31 5 Click to see details
HNSC 0.536 0.32 0.500 0.33 3 Click to see details
STAD 0.195 0.32 0.429 0.14 8 Click to see details
KIRC -0.046 0.41 -0.060 0.38 29 Click to see details
LIHC 0.004 0.49 -0.096 0.26 49 Click to see details
ESCA -0.015 0.49 0.100 0.44 5 Click to see details
CHOL -0.005 0.49 -0.100 0.4 9 Click to see details
CHOL -0.005 0.49 -0.100 0.4 9 Click to see details
CHOL -0.005 0.49 -0.100 0.4 9 Click to see details
CHOL -0.005 0.49 -0.100 0.4 9 Click to see details
CHOL -0.005 0.49 -0.100 0.4 9 Click to see details
CHOL -0.005 0.49 -0.100 0.4 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*