miRTarBase - #MIRT023364 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC15A2   
Synonyms PEPT2
Description solute carrier family 15 member 2
Transcript NM_001145998   
Other Transcripts NM_021082   
Expression
Putative miRNA Targets on SLC15A2
3'UTR of SLC15A2
(miRNA target sites are highlighted)
>SLC15A2|NM_001145998|3'UTR
   1 TGACTCCCTAGATTCTGTCCTGACCCCAATTCCTGGCCCTGTCTTGAAGCATTTTTTTTCTTCTACTGGATTAGACAAGA
  81 GAGATAGCAGCATATCAGAGCTGATCTCCTCCACCTTTCTCCAATGACAGAAGTTCCAGGACTGGTTTTCCAGTACATCT
 161 TTAAACAAGGCCCCAGAGACTCTATGTCTGCCCGTCCATCAGTGAACTCATTAAAACTTGTGCAGTGTTGCTGGAGCTGG
 241 CCTGGTGTCTCCAAATGACCATGAAAATACACACGTATAATGGAGATCATTCTCTGTGGGTATGCAAAGTTATGGGAATT
 321 CCTTTATAGGTAACTGCCATTTAGGACTGATGGCCCTAATTTTTGAGGTGCTGATTTAGAGGCAAAATTGCAGAATAACA
 401 AAGAAATGGTATTTCAAGTTTTTTTTTTTATAAGCAATGTAATTATGCTATTCACAGGGGCCTCAAGAATTGGTATGTAT
 481 GATGTGATCTGGTCCAGCCAGGGCCTGGCTTGTCAGCTCTCTAGGTTTGATATGACTTTAGTAAATTTGTCAATATAGAT
 561 GGTAGGAAGCAGAATGCCATTTTATTAAAACACAGGAGAAGTTATATCTCTCTGATTATGATAGTATTTTATTTACTTAT
 641 CCAAACCCTCCTTTCTCAGTATGGATAGATCATGGAAACCAGATTAGAGATAGTAAGCATTAGTAAACATTGTTCTGGAG
 721 AACAGGAACAGGTGTAAGTTGTAGAAATCCTGAAGAGCCAGTCATTCTTTTACAGAGTACATTCTTCTTAGCCTCTATGG
 801 CGCTGGTCTATGCCCTTCAGTGAACAGTTGTATAAACAATAATTATAATTTGCAACCTTGTCTTGTCAACCTTGCTGATC
 881 CAGCTTTTTCTTATTATTACACCTTGTCTTGCTTATTGCAGCAAATATTCAATAACAACAATGTTTCTATAAGTCCAACT
 961 TCCTTTATTAATGTTTCCATTTAGCCTCAAAAATATCAAAGTAGTTCCTTTTTGATGTTGTTTTCCTGATTTACTTTTCC
1041 CATAAGTTTTAAATACCATTTCTGCCTTGAAGCCTAGAAATTTTCTTTTTATTCAAAAAAAGTTACATTAATGCTCTAGG
1121 TTTGAGGTTCTAAAATGGAAATGTCAATAGAGGAGCATGGTCCTATGTGAGGTTCCTATCAAAATTTGTGGGAGTAGGGA
1201 TGGTAGAGCATGAGGGTTTTGTTTGTGTATGTGTATGGTCATGAAAAAAAATTGAGAAACATTACCTCATACACAATGAA
1281 TGAATCAGAGGACAGACACGGGAATGGCACGACTGTGCAGTGTGTTACTAGGAAAAAAGTTCAGAATCACTGTTCTAGAG
1361 AGCTTCATTTCCATTGGTTTTAAAACATTATTCTCATGTAGAACAGTGTTGGGTCTCATACTGTTAATGTTAATACGTAA
1441 CAATGTTCATGTTAACAGGCACCTGTTAATATTAACAGATAATGTTACTGTTAACAGGTAAGAGAAATTGCTCTAAGTGC
1521 CCAAACTTTATATACTTCAGTTTTAATGACAAGCATTTCAGAAATATAAGAGCGGCAGCCAGACCAACCAGTTTTTCCAG
1601 ATATCTTGATGTGAACCTGACCCTACTCCTTTAGAAGACAGCCTGTTCATTTTTAAATAGCTTTAACCCAAACTGTTCTA
1681 TGACCATTGTTTCAAGAGACATTAACACAGTTCTGTAAATAGAAGTGTCTATGGACAAATAAGTTTGGGAAATGTGGCAT
1761 ACTGTATCCTTTTCTTAACATTTGCATATTAAAGACTCTGAGATATCCTGCAGTAAAGACACAAGATACCTTGTTTAAAT
1841 TAACATGTACGCTGCAGAACATTGGTTTGGAAAAAACTGTTGAGCAGTTCTTCCTTGTAAGTGCTGAGCTTCCTCTCTGA
1921 AACCTCCTACCATTGTTTTTTTTCCCCTGTAGCTAACAAGAATAAGTATAACAGCCGGCCAGGCACAGTGGCTCATGCCT
2001 GTAATCCCAGCACTTTGGGAGGCTGAGACAGGTGGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTG
2081 AAACCGTGTCTCTACTAAAAGTACAAAAATTAGCCAGGTGTGATGGCAGGTGCCTGTAATCCCAGCTACTCGGGAGGCTG
2161 AAGCAGAAGAATTGCTTGAACCCGGGAGGCAGAGGTTGCAATGAGCCGAGATCACGCCATCACACTCTAGCCTGGGGGAC
2241 AAGAGTGAGACTTCATCTAAAAAAAAAAAGAAAAGAATATGTATACCCCCTTTTTCATGTGGCAGATGTTTAGCTATTTG
2321 GGGAGAACTTTCATGGCTCTTCCCTAATCATCAAGTATTCAAGGTAAAGATTCTCGGTTCCTGTAATGGTTCCTCACCAG
2401 GCATAATTTGTCCTTTTACCATCCTACTTTCTGTCTTCTGAAAAACATTCTTTATCTGAAATACAGCAATTAATATTAAG
2481 ATATCTTAATATGAAGTGCCTGGAGTCAAATATAACATTCCAAAGTAGTCTGACTGGAAGAACTAGCACCTGCCTTTCTT
2561 CAAACAATGCACTTCTGTTAATGCAGTGTAAGGTAACATGAGTTGTTTTTGGAAACTACATCATAATGTGGGCTTACATT
2641 CTAGCACTTATCACTTAATGACAGGGATACATTTGAGGAATGCATTGTTAGGCAATTTTGTCATTATGCAAACATCATAG
2721 AGTGTACTTACACAAACCTATGGTATAGCCTACTACACATCTAAGTTATATGGTATAGACTGTTTCTCCAGCTATATGGT
2801 GTAGACTGTTTCTCCTAGGCTACAAACCTGCACAGCATGTTACTGTATTAAATGCTGTAGGCAATTGTAACACAATGGTA
2881 TTTTTATACTTAAACATATCTAAACATAGAAACGGTACAAAAAACTTTACACATTATATAGATGTATCAAATTATTCATA
2961 TGTGCTCTGAAAATGTCTATATCTGTTATGTATCAATTTTTTAAAAAGTGAATGACATAATTCATTTGAAAAAATGTGGA
3041 CACACAAATTGGAAAAGAGGTATAAATGCAGTATTATAATCTAATGGGACCACCATCACATATTTGGTCTGTCATTGACT
3121 GAAACTGCAATATAGAGTTTTTCTTAACATTTGCATATTAAAGACTCTGACTATATATGG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:|||   ||||||||: 
Target 5' atcACGCCA---TCACACTCTa 3'
2211 - 2229 148.00 -20.40
2
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                | | | | |||:||| 
Target 5' tggagtCAAATATAACATTCCa 3'
2501 - 2522 132.00 -13.10
3
miRNA  3' guuUGUGGUA----AC---AGUGUGAGGu 5'
             |||:|||    ||   |:|||:||: 
Target 5' actACATCATAATGTGGGCTTACATTCTa 3'
2615 - 2643 129.00 -14.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30531632 3 COSMIC
COSN30118412 9 COSMIC
COSN30496403 33 COSMIC
COSN31531512 38 COSMIC
COSN19525165 42 COSMIC
COSN30509435 48 COSMIC
COSN28862370 60 COSMIC
COSN30480616 64 COSMIC
COSN1911263 78 COSMIC
COSN27306425 430 COSMIC
COSN8362064 468 COSMIC
COSN25388969 475 COSMIC
COSN20954535 1004 COSMIC
COSN1266278 1048 COSMIC
COSN26764335 1151 COSMIC
COSN20215654 1410 COSMIC
COSN9234267 1544 COSMIC
COSN21534312 1826 COSMIC
COSN14968512 1862 COSMIC
COSN26700485 1983 COSMIC
COSN25860221 2110 COSMIC
COSN1266280 2758 COSMIC
COSN16679159 3051 COSMIC
rs4285028 811 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1236805984 1 dbSNP
rs756335354 4 dbSNP
rs376337534 6 dbSNP
rs1920313 7 dbSNP
rs1451053926 10 dbSNP
rs768742539 15 dbSNP
rs778904221 17 dbSNP
rs748657034 22 dbSNP
rs772562183 24 dbSNP
rs527863503 25 dbSNP
rs1400209176 28 dbSNP
rs1318732225 39 dbSNP
rs1036035419 51 dbSNP
rs1159003988 52 dbSNP
rs755630690 52 dbSNP
rs777613903 52 dbSNP
rs761079256 53 dbSNP
rs1462696442 62 dbSNP
rs1452296032 68 dbSNP
rs1168264312 75 dbSNP
rs1379412210 76 dbSNP
rs79639971 77 dbSNP
rs1251436979 89 dbSNP
rs72551379 91 dbSNP
rs1465132599 97 dbSNP
rs1307392514 98 dbSNP
rs559591002 104 dbSNP
rs1203272659 122 dbSNP
rs528336333 126 dbSNP
rs114413458 130 dbSNP
rs1231970030 134 dbSNP
rs1008934377 141 dbSNP
rs778136112 142 dbSNP
rs4388019 147 dbSNP
rs867271060 151 dbSNP
rs893581232 152 dbSNP
rs1040894644 154 dbSNP
rs892558344 160 dbSNP
rs1010562370 162 dbSNP
rs1009943265 172 dbSNP
rs1366320797 175 dbSNP
rs1318118208 177 dbSNP
rs1022311674 181 dbSNP
rs1405054539 189 dbSNP
rs1253417062 191 dbSNP
rs904408185 194 dbSNP
rs1000141095 195 dbSNP
rs1204925057 199 dbSNP
rs1039398864 212 dbSNP
rs1450355791 223 dbSNP
rs900058598 227 dbSNP
rs60598279 236 dbSNP
rs1030210398 241 dbSNP
rs1256861017 246 dbSNP
rs1486946008 265 dbSNP
rs1199808264 272 dbSNP
rs138962289 275 dbSNP
rs1228642334 276 dbSNP
rs1180126117 285 dbSNP
rs529243087 290 dbSNP
rs550247692 301 dbSNP
rs1269963079 304 dbSNP
rs1429331658 308 dbSNP
rs992572181 314 dbSNP
rs1024442405 327 dbSNP
rs961825599 328 dbSNP
rs972117428 329 dbSNP
rs1414733604 338 dbSNP
rs920287985 350 dbSNP
rs1309984090 352 dbSNP
rs1311789235 381 dbSNP
rs1430623388 392 dbSNP
rs1419153575 394 dbSNP
rs1165939374 397 dbSNP
rs930883393 404 dbSNP
rs371138496 410 dbSNP
rs1186693710 412 dbSNP
rs910712167 417 dbSNP
rs370093110 419 dbSNP
rs748506460 419 dbSNP
rs944840959 419 dbSNP
rs991426947 419 dbSNP
rs1167761154 429 dbSNP
rs1270365951 430 dbSNP
rs530221312 433 dbSNP
rs1358846770 436 dbSNP
rs1285187555 440 dbSNP
rs762138549 446 dbSNP
rs766029633 449 dbSNP
rs969678400 451 dbSNP
rs942849972 453 dbSNP
rs756354407 463 dbSNP
rs1300564065 467 dbSNP
rs1400921275 474 dbSNP
rs982045798 485 dbSNP
rs1382417254 494 dbSNP
rs546837114 495 dbSNP
rs945492700 500 dbSNP
rs935132138 504 dbSNP
rs751250602 506 dbSNP
rs567058006 512 dbSNP
rs1469126846 520 dbSNP
rs914963083 522 dbSNP
rs946466056 525 dbSNP
rs903876589 526 dbSNP
rs1039346773 529 dbSNP
rs754443512 530 dbSNP
rs1034303774 532 dbSNP
rs1208719318 534 dbSNP
rs894406532 535 dbSNP
rs1486261869 542 dbSNP
rs780701550 547 dbSNP
rs752572222 548 dbSNP
rs1229563345 550 dbSNP
rs1014466184 552 dbSNP
rs1372639386 559 dbSNP
rs1277887636 561 dbSNP
rs1438839971 563 dbSNP
rs1024162050 565 dbSNP
rs1206993802 577 dbSNP
rs998293419 603 dbSNP
rs1390578705 611 dbSNP
rs114029015 619 dbSNP
rs1449095718 622 dbSNP
rs142177281 635 dbSNP
rs1004309059 651 dbSNP
rs867414732 672 dbSNP
rs756081770 710 dbSNP
rs1191372326 712 dbSNP
rs1017076416 713 dbSNP
rs1434807017 719 dbSNP
rs1173927785 723 dbSNP
rs951749059 724 dbSNP
rs1377025945 727 dbSNP
rs985767613 728 dbSNP
rs910764340 735 dbSNP
rs944976594 739 dbSNP
rs976625956 756 dbSNP
rs1321981957 759 dbSNP
rs1439008233 775 dbSNP
rs1367039301 781 dbSNP
rs1321020416 782 dbSNP
rs1429907340 782 dbSNP
rs1385920508 788 dbSNP
rs1343424676 794 dbSNP
rs914101768 798 dbSNP
rs945432555 799 dbSNP
rs1043858485 802 dbSNP
rs549316174 803 dbSNP
rs189331203 804 dbSNP
rs981871233 805 dbSNP
rs4285028 811 dbSNP
rs575030069 814 dbSNP
rs1055133387 816 dbSNP
rs1212876670 820 dbSNP
rs779247161 831 dbSNP
rs915079514 839 dbSNP
rs1232323939 840 dbSNP
rs946413831 841 dbSNP
rs1298041215 843 dbSNP
rs1014186215 844 dbSNP
rs1359614933 847 dbSNP
rs1045962231 852 dbSNP
rs1448697957 859 dbSNP
rs540732902 881 dbSNP
rs921051746 884 dbSNP
rs897681117 885 dbSNP
rs993645851 901 dbSNP
rs1169314392 903 dbSNP
rs1428229075 913 dbSNP
rs1247046285 922 dbSNP
rs1489313125 935 dbSNP
rs531812216 940 dbSNP
rs772806361 941 dbSNP
rs1208890872 944 dbSNP
rs1484158322 944 dbSNP
rs1419618374 948 dbSNP
rs887345416 949 dbSNP
rs1027326529 950 dbSNP
rs1233793163 959 dbSNP
rs1354798786 962 dbSNP
rs1290891901 968 dbSNP
rs1411055966 972 dbSNP
rs552847936 973 dbSNP
rs757417534 977 dbSNP
rs1297197984 978 dbSNP
rs573015969 987 dbSNP
rs544941945 997 dbSNP
rs1007155873 1002 dbSNP
rs1456347596 1005 dbSNP
rs1017235187 1007 dbSNP
rs1013080367 1015 dbSNP
rs1023033109 1017 dbSNP
rs907308038 1019 dbSNP
rs1417855454 1021 dbSNP
rs966251295 1021 dbSNP
rs1293310412 1027 dbSNP
rs1473582723 1030 dbSNP
rs565220482 1032 dbSNP
rs1251363766 1035 dbSNP
rs976382919 1038 dbSNP
rs530405533 1052 dbSNP
rs1482588043 1054 dbSNP
rs956568808 1057 dbSNP
rs988063612 1061 dbSNP
rs1214161698 1065 dbSNP
rs1022254893 1067 dbSNP
rs1271128466 1075 dbSNP
rs1230170909 1076 dbSNP
rs1286499537 1086 dbSNP
rs1305720953 1090 dbSNP
rs966940963 1098 dbSNP
rs746126829 1107 dbSNP
rs967871051 1112 dbSNP
rs778872054 1115 dbSNP
rs1257376544 1126 dbSNP
rs925320808 1127 dbSNP
rs1234003975 1128 dbSNP
rs975675382 1134 dbSNP
rs1394224689 1148 dbSNP
rs920994819 1153 dbSNP
rs192450987 1156 dbSNP
rs1364430257 1157 dbSNP
rs1055103497 1159 dbSNP
rs1417546671 1161 dbSNP
rs933753378 1165 dbSNP
rs1194515982 1166 dbSNP
rs1219043021 1170 dbSNP
rs1245974119 1187 dbSNP
rs185103906 1193 dbSNP
rs1184304493 1197 dbSNP
rs1248955282 1198 dbSNP
rs908227150 1199 dbSNP
rs1236336527 1203 dbSNP
rs1471948885 1207 dbSNP
rs1313443397 1208 dbSNP
rs1188086662 1211 dbSNP
rs1303616488 1221 dbSNP
rs1439738241 1228 dbSNP
rs949990896 1230 dbSNP
rs1415428430 1233 dbSNP
rs529693887 1235 dbSNP
rs1384400780 1238 dbSNP
rs1386389825 1240 dbSNP
rs1288361279 1241 dbSNP
rs1451645463 1244 dbSNP
rs939724354 1244 dbSNP
rs1045689374 1251 dbSNP
rs897743771 1260 dbSNP
rs1393013447 1262 dbSNP
rs775728795 1266 dbSNP
rs1447508414 1284 dbSNP
rs898777047 1286 dbSNP
rs1203332988 1288 dbSNP
rs1483919383 1293 dbSNP
rs1280459908 1295 dbSNP
rs546696556 1300 dbSNP
rs887498613 1301 dbSNP
rs1007291681 1302 dbSNP
rs948900426 1303 dbSNP
rs1044968254 1304 dbSNP
rs907259580 1311 dbSNP
rs1003370320 1320 dbSNP
rs555691789 1324 dbSNP
rs1313608584 1326 dbSNP
rs1434327137 1328 dbSNP
rs891793282 1338 dbSNP
rs1169875240 1340 dbSNP
rs965777475 1341 dbSNP
rs1011623786 1347 dbSNP
rs1425529691 1351 dbSNP
rs1257578309 1356 dbSNP
rs1022202672 1361 dbSNP
rs1484485533 1362 dbSNP
rs1377228455 1363 dbSNP
rs967971262 1367 dbSNP
rs998165928 1375 dbSNP
rs370769120 1379 dbSNP
rs1340443244 1385 dbSNP
rs760729736 1389 dbSNP
rs1225842387 1398 dbSNP
rs148590480 1405 dbSNP
rs955118062 1416 dbSNP
rs1207067135 1424 dbSNP
rs1272341844 1429 dbSNP
rs979573620 1436 dbSNP
rs141615516 1437 dbSNP
rs1210139768 1438 dbSNP
rs1471948760 1445 dbSNP
rs1238761977 1452 dbSNP
rs552570472 1453 dbSNP
rs1331080347 1458 dbSNP
rs990927312 1460 dbSNP
rs1410774798 1461 dbSNP
rs1395465506 1466 dbSNP
rs769190266 1476 dbSNP
rs1165990876 1484 dbSNP
rs1462940097 1489 dbSNP
rs908341053 1490 dbSNP
rs571776597 1492 dbSNP
rs949380076 1499 dbSNP
rs569616194 1509 dbSNP
rs1390427251 1514 dbSNP
rs1473907777 1515 dbSNP
rs1253380137 1520 dbSNP
rs1436910796 1522 dbSNP
rs1451672590 1523 dbSNP
rs538236066 1525 dbSNP
rs777050322 1529 dbSNP
rs762204947 1552 dbSNP
rs1159319843 1553 dbSNP
rs13860 1558 dbSNP
rs1274288655 1560 dbSNP
rs1920312 1565 dbSNP
rs1336238000 1567 dbSNP
rs1332718083 1568 dbSNP
rs1048866331 1571 dbSNP
rs746320200 1573 dbSNP
rs1281390953 1574 dbSNP
rs751162905 1575 dbSNP
rs759200218 1577 dbSNP
rs1326605082 1580 dbSNP
rs1357544839 1583 dbSNP
rs1394962352 1588 dbSNP
rs772490919 1602 dbSNP
rs1459845137 1610 dbSNP
rs928802868 1612 dbSNP
rs1158700061 1615 dbSNP
rs1469305400 1617 dbSNP
rs1230753141 1618 dbSNP
rs1270945525 1623 dbSNP
rs752200009 1630 dbSNP
rs150509976 1676 dbSNP
rs1254057123 1692 dbSNP
rs1038791210 1701 dbSNP
rs1295149098 1702 dbSNP
rs901599424 1709 dbSNP
rs1213582224 1711 dbSNP
rs1341355874 1726 dbSNP
rs780352121 1727 dbSNP
rs1136995 1744 dbSNP
rs1011571414 1745 dbSNP
rs1440147157 1746 dbSNP
rs1021059689 1753 dbSNP
rs1371418530 1756 dbSNP
rs1325028489 1767 dbSNP
rs868239053 1770 dbSNP
rs753762104 1790 dbSNP
rs1465984650 1798 dbSNP
rs1346957807 1802 dbSNP
rs1187048808 1803 dbSNP
rs1399554447 1813 dbSNP
rs1405189922 1814 dbSNP
rs1001146764 1821 dbSNP
rs1478622731 1823 dbSNP
rs540357170 1830 dbSNP
rs959567322 1851 dbSNP
rs1028276279 1852 dbSNP
rs1487789646 1853 dbSNP
rs189039600 1856 dbSNP
rs1217155373 1869 dbSNP
rs1423716772 1871 dbSNP
rs1008088057 1877 dbSNP
rs1413942577 1882 dbSNP
rs990894710 1895 dbSNP
rs1213256431 1897 dbSNP
rs769402552 1904 dbSNP
rs1302404625 1906 dbSNP
rs1231719512 1908 dbSNP
rs1363830566 1911 dbSNP
rs572938112 1914 dbSNP
rs1015287199 1916 dbSNP
rs1270644204 1923 dbSNP
rs1429973023 1929 dbSNP
rs1433244109 1935 dbSNP
rs961122335 1936 dbSNP
rs973684910 1936 dbSNP
rs559986684 1941 dbSNP
rs558418994 1944 dbSNP
rs1431749769 1946 dbSNP
rs980752931 1949 dbSNP
rs1187575482 1954 dbSNP
rs1475400947 1970 dbSNP
rs575153648 1973 dbSNP
rs1261103905 1974 dbSNP
rs1190231466 1975 dbSNP
rs1233735559 1977 dbSNP
rs181632804 1978 dbSNP
rs972729537 1980 dbSNP
rs918611120 1984 dbSNP
rs938829453 1986 dbSNP
rs1273495600 1998 dbSNP
rs560519467 1999 dbSNP
rs1053308542 2001 dbSNP
rs929205031 2002 dbSNP
rs1359856451 2005 dbSNP
rs757039060 2007 dbSNP
rs574386831 2008 dbSNP
rs374035960 2012 dbSNP
rs1354287420 2014 dbSNP
rs1268272950 2023 dbSNP
rs1330764779 2026 dbSNP
rs1310652154 2030 dbSNP
rs1463232391 2047 dbSNP
rs1356613874 2055 dbSNP
rs9856253 2057 dbSNP
rs1038848097 2058 dbSNP
rs900495615 2076 dbSNP
rs746034249 2078 dbSNP
rs560218637 2079 dbSNP
rs1256935978 2080 dbSNP
rs780477412 2081 dbSNP
rs891076016 2086 dbSNP
rs1007988896 2087 dbSNP
rs1042044029 2088 dbSNP
rs995222790 2090 dbSNP
rs532593042 2091 dbSNP
rs1159986049 2100 dbSNP
rs1333478177 2105 dbSNP
rs902201480 2117 dbSNP
rs1001115425 2121 dbSNP
rs1455813296 2122 dbSNP
rs147809456 2126 dbSNP
rs979814537 2131 dbSNP
rs1391761793 2137 dbSNP
rs895402495 2149 dbSNP
rs1398585184 2150 dbSNP
rs1036339436 2151 dbSNP
rs1325292481 2152 dbSNP
rs566390843 2153 dbSNP
rs1435752476 2164 dbSNP
rs564727531 2165 dbSNP
rs531998014 2183 dbSNP
rs1176854303 2184 dbSNP
rs867010572 2185 dbSNP
rs1254693585 2195 dbSNP
rs548923534 2200 dbSNP
rs762353138 2208 dbSNP
rs768655399 2209 dbSNP
rs973250645 2216 dbSNP
rs1025640227 2217 dbSNP
rs947570460 2221 dbSNP
rs1226069915 2224 dbSNP
rs1316998810 2229 dbSNP
rs952746343 2232 dbSNP
rs1237546013 2234 dbSNP
rs377397800 2234 dbSNP
rs1328402220 2236 dbSNP
rs984092105 2239 dbSNP
rs978839974 2247 dbSNP
rs909096278 2248 dbSNP
rs943310324 2250 dbSNP
rs1455360615 2252 dbSNP
rs1364484380 2258 dbSNP
rs113345338 2259 dbSNP
rs1350156712 2259 dbSNP
rs931965276 2260 dbSNP
rs974576100 2264 dbSNP
rs923128804 2268 dbSNP
rs777153408 2269 dbSNP
rs1451535417 2270 dbSNP
rs748622799 2272 dbSNP
rs186321233 2277 dbSNP
rs189679175 2279 dbSNP
rs770413756 2281 dbSNP
rs1053466357 2282 dbSNP
rs773737871 2284 dbSNP
rs1181556270 2287 dbSNP
rs535433796 2290 dbSNP
rs995337304 2295 dbSNP
rs1229054236 2304 dbSNP
rs1330900649 2305 dbSNP
rs895371334 2307 dbSNP
rs547552360 2309 dbSNP
rs1012531694 2319 dbSNP
rs1164773485 2330 dbSNP
rs1046540513 2338 dbSNP
rs1388354031 2345 dbSNP
rs570973048 2353 dbSNP
rs905640839 2364 dbSNP
rs1297717173 2372 dbSNP
rs1001579143 2376 dbSNP
rs906732174 2377 dbSNP
rs558673030 2382 dbSNP
rs1352296513 2386 dbSNP
rs1433811847 2389 dbSNP
rs1407382994 2390 dbSNP
rs1195199521 2391 dbSNP
rs1305693830 2397 dbSNP
rs770085522 2398 dbSNP
rs1260414329 2399 dbSNP
rs960245618 2400 dbSNP
rs773569375 2401 dbSNP
rs1486369281 2402 dbSNP
rs1280529568 2405 dbSNP
rs989055330 2407 dbSNP
rs763375102 2411 dbSNP
rs1344709070 2413 dbSNP
rs1254670524 2417 dbSNP
rs1020589500 2431 dbSNP
rs1327593035 2437 dbSNP
rs968857235 2454 dbSNP
rs978955232 2465 dbSNP
rs1357467529 2466 dbSNP
rs555732549 2472 dbSNP
rs921984233 2476 dbSNP
rs1282755765 2478 dbSNP
rs1005487645 2481 dbSNP
rs932105810 2494 dbSNP
rs1920311 2497 dbSNP
rs1462429855 2498 dbSNP
rs964587793 2499 dbSNP
rs1168463173 2510 dbSNP
rs911903543 2516 dbSNP
rs1257643262 2528 dbSNP
rs1186746883 2546 dbSNP
rs1920310 2547 dbSNP
rs767375557 2554 dbSNP
rs1254499838 2567 dbSNP
rs1198000439 2577 dbSNP
rs760202543 2583 dbSNP
rs180751034 2584 dbSNP
rs1257919673 2585 dbSNP
rs977960249 2587 dbSNP
rs1036905490 2593 dbSNP
rs1336998184 2594 dbSNP
rs1294034497 2598 dbSNP
rs1447557842 2599 dbSNP
rs1338994260 2606 dbSNP
rs923661196 2607 dbSNP
rs1391700259 2610 dbSNP
rs897100720 2616 dbSNP
rs554474411 2618 dbSNP
rs572102629 2621 dbSNP
rs1048237150 2642 dbSNP
rs1053435422 2644 dbSNP
rs1471605625 2648 dbSNP
rs139641465 2669 dbSNP
rs916272135 2673 dbSNP
rs752517456 2679 dbSNP
rs948326497 2684 dbSNP
rs1237992820 2685 dbSNP
rs116726781 2693 dbSNP
rs1185743791 2696 dbSNP
rs1470263418 2701 dbSNP
rs906789875 2713 dbSNP
rs994702642 2714 dbSNP
rs1443744586 2715 dbSNP
rs760615804 2718 dbSNP
rs764401126 2724 dbSNP
rs1354349563 2749 dbSNP
rs1281441413 2772 dbSNP
rs1240071532 2780 dbSNP
rs770085405 2781 dbSNP
rs1047246643 2787 dbSNP
rs1168998285 2790 dbSNP
rs1306872427 2792 dbSNP
rs374168152 2795 dbSNP
rs775841949 2797 dbSNP
rs1018214777 2802 dbSNP
rs538110514 2811 dbSNP
rs757277800 2813 dbSNP
rs1297103202 2816 dbSNP
rs1030629356 2831 dbSNP
rs1402348541 2834 dbSNP
rs557684452 2837 dbSNP
rs765061553 2841 dbSNP
rs1203477183 2844 dbSNP
rs978299901 2846 dbSNP
rs576833949 2856 dbSNP
rs545917825 2858 dbSNP
rs923798567 2859 dbSNP
rs1247743869 2862 dbSNP
rs1381589267 2865 dbSNP
rs1221508654 2866 dbSNP
rs1449899353 2868 dbSNP
rs577727865 2876 dbSNP
rs1286480996 2879 dbSNP
rs750243872 2882 dbSNP
rs189813159 2890 dbSNP
rs1300332527 2894 dbSNP
rs570746718 2900 dbSNP
rs1029163004 2902 dbSNP
rs766034587 2902 dbSNP
rs1236142240 2907 dbSNP
rs78573588 2914 dbSNP
rs1434264197 2915 dbSNP
rs1228360649 2917 dbSNP
rs139263922 2919 dbSNP
rs987564008 2933 dbSNP
rs1418709814 2935 dbSNP
rs780389434 2937 dbSNP
rs1175142572 2939 dbSNP
rs912015172 2942 dbSNP
rs916239558 2950 dbSNP
rs961999121 2951 dbSNP
rs1191093762 2952 dbSNP
rs1477355635 2966 dbSNP
rs199705222 2973 dbSNP
rs200774493 2975 dbSNP
rs1255657525 2976 dbSNP
rs947675293 2976 dbSNP
rs972067340 2980 dbSNP
rs1488008457 2992 dbSNP
rs1284080614 2995 dbSNP
rs754056587 3003 dbSNP
rs981800591 3003 dbSNP
rs918474412 3004 dbSNP
rs1217391993 3005 dbSNP
rs1188957433 3007 dbSNP
rs928180346 3008 dbSNP
rs1391859003 3010 dbSNP
rs1270700985 3029 dbSNP
rs930258056 3035 dbSNP
rs757426996 3037 dbSNP
rs1337805893 3043 dbSNP
rs1314290553 3046 dbSNP
rs1415063244 3046 dbSNP
rs1360089069 3047 dbSNP
rs112532686 3050 dbSNP
rs1378157058 3053 dbSNP
rs1467069780 3057 dbSNP
rs1300582038 3065 dbSNP
rs1404882602 3069 dbSNP
rs888640384 3070 dbSNP
rs1477511465 3077 dbSNP
rs1261171518 3078 dbSNP
rs927141654 3091 dbSNP
rs1322928557 3092 dbSNP
rs941446659 3094 dbSNP
rs1483733292 3095 dbSNP
rs376667157 3101 dbSNP
rs145263025 3103 dbSNP
rs76033877 3112 dbSNP
rs1309051372 3126 dbSNP
rs2689275 3136 dbSNP
rs998555143 3137 dbSNP
rs895598713 3139 dbSNP
rs1029676313 3149 dbSNP
rs1217971423 3150 dbSNP
rs890355808 3151 dbSNP
rs1041424510 3158 dbSNP
rs1330083469 3165 dbSNP
rs999471664 3172 dbSNP
rs1210868726 3176 dbSNP
rs1249641606 3182 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*