miRTarBase - #MIRT023375 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PHF14   
Synonyms -
Description PHD finger protein 14
Transcript NM_014660   
Expression
Putative miRNA Targets on PHF14
3'UTR of PHF14
(miRNA target sites are highlighted)
>PHF14|NM_014660|3'UTR
   1 GACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTA
  81 AACTCTCGATAGAGTACATAAAGTAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCT
 161 TTTGCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAACAAGGCAGTAGATTTGCCTGTGTGGA
 241 ATTTTTTTTCCTATTTTTCTTCTTTTTGCTTTTTTTGCACTTATCAGAAATATTTGATGTGTGCATTGTTGAAAAATACT
 321 GGATACATGTCTTGTCAGAATTGTCGTATTAAGTAATGTCTTTCCCTCTTGCTTCTTTGGCAAATGTTGATACACAGTGT
 401 TTGGACTTACTGAAGAGTTACTGAAGCCTGTGGGACTTAATAAATACAATATGCTACTCCCTGTTGTGATTGAACAATAC
 481 AAATAACAAACAAGAAAGACAATGCATTCCATTAGTCTGCTATTCTGTTTCCTTCAACTTCATACATAGATTCATATATG
 561 AAGTACTGCATTGTAAAACAACTATAGACTCATATTAAATGTTATTTCTATTTATAATATTCAGCAAAAGTGAAAGACTT
 641 GTGAAGCATATGACATTCTATTTTTGACTTATTAGTCCTAGTGTGAAAGCATTAATATTATTAGCATGAAATTTTTACTT
 721 CAGATTTTAAGCTCATGAATAAAGATATATCTGTGTTGATCTCTAGATATTTTTAGTAATACCCAAATATATTCAGTCCT
 801 TATTGTTTTAATATAAGCTTTCTGTGTTCAGTATAATTTTATTTTTCTCAACCTTAAATATGAACTTAGGAAATAAGGAG
 881 GGAAGTACAAAGATTATTGACTATACAACCTACCAGCTGAAAGAAAGATCTTCATCAACATCTGTATCTTTCCAGAGGTA
 961 TACAGAATTAAAATTTGATCTTCAAGCTTTAATGATCCAGTTTTAAGTCAACGGCAGAAGTATGTTGAATATTTCATCAC
1041 TCAATCTTGAACTGATTTAGAAGAGACTCTTTGCTGAAATTGAATTGCACTTATACATGTAAATTGTCAACATGTAATTT
1121 GGAATTTTCTGATTAATAAATGTGGTTTTGGACATCTTTTCGGGTATAGTGACAATGGAAAATAGTTTAAACTTTAGGAA
1201 TAGAGTAGGTAATGTTATAGATAATCAAAAGCAATTGTAATTGTAAAGCTGCTGTAATCTAGTGATCTCTAGTTACAGTG
1281 AGGAACGCTATGATTGGATGAGATGTTTGATAAAAGTAAAATGTGTATGAAATTACATATAAACAGATTATTAGCTTATT
1361 GAAAGATCTCATAACATTGGAGGAAAAATATTCATAATCTTTAGCAAAACTAGTAGACTTTTGTTTAAAAGAATAAGATA
1441 GGACTAGTTGTCACTATATTAGCTTAAGGAAATGTTGGTAATTATTACTGTTGCTGAACTCTGGCTGCTTTTAAGCAAAA
1521 TGACAGATTGCCATTTTCTAAGTGGAATATACTAATCCATTAGACCATGGCCCTCTTTTAATATTTAGTGAGAAATTACT
1601 CGCAGTTGCTTTATTTTAGGTTTTTTGAGAAACTCTTAGGCCTTGTTTTGGTATCACTGTTAATCAAAATCCTTTTCACT
1681 TTGATTCCAATTATAATACTATATTATCATCATTTTCCATCTTGCATTTTCAGTGGTGGTGGATATTCTATTCCACATTT
1761 GGTGCTAGTCCTAAGAATCTTTGTCACATGTTATACATATAGACTGCAAAATTCATAAGATATAGGTCCTGCAAAAAGTA
1841 TAGTTGAAGTAAGAAAACTTGAAGTAACTAGAATAGAATACTTTCTCCTAATAATCTCTTAAATGCTCTCATATCCACAG
1921 TATAAAATTATTCCGTGTCCATAATCGGTCCAACTACTATAAGGAGAAAATTGATGTGTGCTTAAGAAAATATGTACTAA
2001 ATGATTCATATTTCACAGACCTACATAAGAAAAAAATGGCACATCAGGTAAATGATAGTTGTTTATCACACAGTAGGGAA
2081 AGGAAGAAACATGAAAATATCAGGAAGGAGATGAAATGTCTCTGAAATACAGGAAGAATGACATAATAGCAAGTAGTGGT
2161 TCTCAAACGTTGTGCATTGGAATCACAGGAAGGATTTGTAAAAACACAGGTGACTACCCTATTCCTCTCCTGGATCTGCC
2241 CTCTGCCCACTTTACTCCCTCCCCCTTCACCCTGGAGTTTCTGATTTAGTAGAAAATTTGCATTTCTAACAAGTTCCCAG
2321 CTGATGCTGATGCTACTGGCCTGGAACACCACATTAAGAACCATTCATAGGTAGTATTTTTTTTAAAACATCGTTGTGTT
2401 GTGCTTAACATTGATTGATAAAGGAATGTGCTTTTAACATCTCCTTAAAAGGTCCCTTAGATTTCCTCTAGATAAAAGAA
2481 TTAGTAATTTCATCTGCAACACATACAATTTTTTTTAATTTTATAAAATTTAGTTAAATGTTTGTTTTACACTGACTATG
2561 GAAACAGCACTATTTTAGATACAGAAAGAAATCAATAAACATAGCCTGTGTTCACAATTCACTCATCCTTTTGTTATAAA
2641 AAGACTTGAAATTAGGGTTATGTTTTAACATGAAAACAAAATTTAGCCTTAGCTTTTATCCATCTTAACTTTAGAAATTA
2721 TATTTATGCATTGTTTATAGATCATTGTCATTCGTTGTTGCTTAAGTGTTCATCTGATTTTATATTTATGATGTTAAAAA
2801 TAGACTGCTGACCAATAAATAATAAAATATTTACACTCCATTCTATTTCCCTGTATTCACATCCTATTAATGAAAACCAC
2881 TGGTTTTAAACAAAGTTACTTATTTCATAAAACTCACCACTATTTTACTTGATTCTCAATATGAGAATATTTCATGACTA
2961 TTTCACCAAAATTTATTCAAGGAATTCAGAAGGACTCTCCAGCAGAGCAGAATATTTACATCATTAAATTTTTAAAAAAA
3041 TTTAAAAATGGCAATTGAAACTTGTTTAAGAGACTCAACTTGGAGTTTCCTGACATACGAAGGCAGAATCATTTTTTCTA
3121 CCTGTCTGAATCAGCACTTTGTAAGTTTACATAAAATTAAGGATTGTGATTTCTAAGATAGGCATGCTTTGCAAATATTT
3201 CTCTATAAAAGTGGAAGCCTCTTTCCCATAGTGCTCACTTTAAGGCTTTCTGTAGGCCTGCCGATAAGATTCACTGCTGT
3281 TCAGGTACATAAGATGTAATGTAATTGGATGCACATGCTGGGCTTTGTAAATAAAATGAGATTGACACCCAGCAATTATC
3361 TCATTTATCTGATTTACATTGTAAAATCAGGATCTACACTATTGATTAGAGCATAATTAGTTAATTATGAACAGGGAAAT
3441 ACAAAGTTACATGGAGCTTGAGCTCAGCAGGTTGTACTGCTGAAAAATTTCCAAGGGCATGAGCAGATGGAAATCAGTTT
3521 ATTAAAGAACAAAGCAGACATGTTTCAGGTATGGAAATGTCTAATTCTTCTCTCATGCTGTGAAGAGTTGCTTGACCTTA
3601 TTGTGTATTTTTATATGAATTGTTTTGTCTCATCTTTCATTTTCTTGTTTCACATTTAATCTTGTAATCTGGCTGCCACA
3681 GATATAGCTAACTGAATTGATCCCACTCTTTAAGTGACTATTAAATACAGATTTGGATTTGGATATTTTTCTAATTTTTT
3761 AAAATTAATTTTTATGTGTAAAGAATATTTTTGTCTTTCTTACTACCCATTCATTCATTATTGGCTGATACAGAAGTCTG
3841 TAGTGGTATTAATGAAATAGGTTCAAGCCCTCCACGTTAGTCTTATATTTGTGAAATGATTAAAAACCATTTTCTAATTA
3921 TTTTGTATAGAAACTGCTCATGTAGGTAATTTGCACTAAAATTGTTGTAAATTACAAGGAATAAAATATTGTACTTATTG
4001 ATACTAAATGTTATTCCGTATTGGTAGAATGCAGAATTTTGTGCAAGCTTGTATTATTTGTAAAGTGATTTAACTCATTG
4081 ACCACAATTTGTATTTTCTCCATCTGTTAAGATGTTTAATCAAAATAATTGGCCACTATTCAATGAAAGAACTCATCGCT
4161 ACCTGTTAATAGATTTGCGTAGATGTTTGAGCTGCTAGTGAGATTTTTATTTAAGTAATGACAGTATTCAAGACTAATTT
4241 TTTTGAACATTCTTGTGATGGAATTTTTACACAGAAATGAAAAAGTTGGAAAATCCAACCCATCAGTTCTCTGGATATTT
4321 AGTTTTTTTTAAGTGGACAGACATAATAGTCTATATTTTCAGAGTCCAGTTTTTGTTTTGCTTTATATAAACTTATAGGG
4401 GCTACAAGTAAAATGTTCCATTGGCATAAAAGATAATGTGATTATCACAATCAACTTGATCATAAAAATGTACATCCTTG
4481 TTCAAGTCTATGTTATGGATTTTGCTTCTTTCTAAAGTTTAGCTTACAAATGGCTATAAATTATTTGCATAGGAGGTGCA
4561 CTTAATTGTTTCAGTTAGGTTTTAAAAAGTAGTTGTAGTTTACTCCTCTAATGAAATTAGAGATGTTAAACCCTTTGGAA
4641 TACTGACTTTTGGCCTCTTAGGCATTCGATGAAATAAATCAGCTGCTTCTTTTTACTTGTTTGCATATTCTCAATAGTCA
4721 GGTAAACACCTGACTAATTGCTTGTTATATGGATCATAGCACATATGAAGGTAAATCATTTTTTTCCCTCTTCTTTGTTT
4801 AGGGTGCTATTCTTAATCATATACTAAGTAAGTATTTTACATACATATAGACTGTGTTTATTTGGTCACTACATTTTGTT
4881 AATGGGTAAAAGACCATATATTAAGCTACTTTGTTATTTACATCTATATCTGTTATTAATCTGATAGCTAGGAAGTTGTA
4961 TTTAGTAAGAATCTAATTAGGTTTGCTTTTATCTTATAATTGGGATTCCTTTATGCTCTATAGTGTTAATGTGTACAGTG
5041 TTTATTAGAGGCTTAAATGATACTTCTTTAAGCATCCAGTTTTTATTTTATTAAAAAATCTTAGTGTTTCTTTACAGGTT
5121 AGTTTTGTATTCTTTTTTAATATTTTAAGACATTGCCTTCCTATTTAATAATGTGCTATTCGTATAATAATCTGTTTTTA
5201 TTACATAGACATTTGTGTTATTTAATAAAGTATATTGTGTTATATCCCTAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||:|  ||  |:||||||| 
Target 5' atAATAAAATATTTACACTCCa 3'
2819 - 2840 160.00 -14.20
2
miRNA  3' guUUGUGGUAACAGUGU-GAGGu 5'
            ||:::  || | ||| |||| 
Target 5' ggAATGTGCTTTTAACATCTCCt 3'
2423 - 2445 124.00 -6.40
3
miRNA  3' guUUGUGGU---AACAG--UGUGAGGu 5'
            || ||:|   || |:  |||:||: 
Target 5' tcAAGACTAATTTTTTTGAACATTCTt 3'
4228 - 4254 122.00 -7.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30185149 40 COSMIC
COSN26988818 41 COSMIC
COSN30482522 49 COSMIC
COSN28811659 78 COSMIC
COSN30189546 89 COSMIC
COSN31606355 89 COSMIC
COSN26634651 93 COSMIC
COSN30192088 99 COSMIC
COSN30494032 101 COSMIC
COSN30134237 146 COSMIC
COSN26586381 158 COSMIC
COSN31554167 191 COSMIC
COSN31521901 192 COSMIC
COSN4864378 198 COSMIC
COSN30173563 212 COSMIC
COSN19058035 510 COSMIC
COSN9313970 672 COSMIC
COSN15711799 925 COSMIC
COSN30175195 1070 COSMIC
COSN14483297 1349 COSMIC
COSN21204059 1620 COSMIC
COSN30311908 1729 COSMIC
COSN9919566 2653 COSMIC
COSN21591815 3339 COSMIC
COSN27684475 3368 COSMIC
COSN27685895 3385 COSMIC
COSN15399720 3508 COSMIC
COSN26697672 3523 COSMIC
COSN16613569 3762 COSMIC
COSN20507944 4159 COSMIC
COSN27958376 4354 COSMIC
COSN7650903 4440 COSMIC
COSN16706451 4679 COSMIC
COSN27996763 4808 COSMIC
COSN31962739 4950 COSMIC
COSN2192702 4974 COSMIC
COSN6344330 5021 COSMIC
COSN7650904 5673 COSMIC
COSN17541850 5747 COSMIC
COSN22691337 5966 COSMIC
COSN17743326 6390 COSMIC
COSN23676687 6975 COSMIC
COSN16045508 6982 COSMIC
COSN23831669 7110 COSMIC
COSN15956019 7188 COSMIC
COSN14584775 7551 COSMIC
COSN27341249 7556 COSMIC
COSN15289584 7790 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1335619910 8 dbSNP
rs776531964 9 dbSNP
rs770539326 12 dbSNP
rs1194962591 15 dbSNP
rs780638130 20 dbSNP
rs1384977529 23 dbSNP
rs1443230006 28 dbSNP
rs59674198 30 dbSNP
rs371670051 33 dbSNP
rs775265290 36 dbSNP
rs376360985 40 dbSNP
rs1347079013 41 dbSNP
rs769965782 42 dbSNP
rs1015172582 43 dbSNP
rs1246755071 44 dbSNP
rs747269671 49 dbSNP
rs1472690797 53 dbSNP
rs1187006880 57 dbSNP
rs1363121758 63 dbSNP
rs1415367221 71 dbSNP
rs562072427 72 dbSNP
rs1179607857 76 dbSNP
rs962323851 86 dbSNP
rs1425545396 88 dbSNP
rs1165386420 89 dbSNP
rs1489903427 104 dbSNP
rs1286616110 116 dbSNP
rs1353782592 132 dbSNP
rs973566740 134 dbSNP
rs1306203912 138 dbSNP
rs1278194436 166 dbSNP
rs371675860 168 dbSNP
rs1410636359 170 dbSNP
rs1346771082 178 dbSNP
rs983653282 179 dbSNP
rs1283353097 189 dbSNP
rs1403815961 202 dbSNP
rs958667271 204 dbSNP
rs191509402 221 dbSNP
rs916877027 223 dbSNP
rs1383948166 231 dbSNP
rs1156661656 234 dbSNP
rs865844252 235 dbSNP
rs755382942 240 dbSNP
rs1041392587 242 dbSNP
rs1236069037 242 dbSNP
rs1314072636 242 dbSNP
rs1475110652 249 dbSNP
rs1479515116 252 dbSNP
rs1244011201 254 dbSNP
rs1194139662 257 dbSNP
rs781466175 263 dbSNP
rs397940425 270 dbSNP
rs57022517 270 dbSNP
rs747796982 270 dbSNP
rs941805369 271 dbSNP
rs1324825736 276 dbSNP
rs1038753342 278 dbSNP
rs1276115693 281 dbSNP
rs1054655966 288 dbSNP
rs1364910659 292 dbSNP
rs921614272 300 dbSNP
rs932951112 306 dbSNP
rs1051640626 313 dbSNP
rs1431004133 328 dbSNP
rs1325546851 330 dbSNP
rs1318225360 338 dbSNP
rs564538366 341 dbSNP
rs899670033 342 dbSNP
rs1209691009 343 dbSNP
rs544572338 344 dbSNP
rs1175643402 346 dbSNP
rs118014074 347 dbSNP
rs1421700518 354 dbSNP
rs1484112358 356 dbSNP
rs1168633939 365 dbSNP
rs1475202098 370 dbSNP
rs1240592741 389 dbSNP
rs1182170132 397 dbSNP
rs1050516723 398 dbSNP
rs1243024326 401 dbSNP
rs1420591978 407 dbSNP
rs145320424 416 dbSNP
rs1054049669 427 dbSNP
rs1392081475 431 dbSNP
rs772643438 433 dbSNP
rs1338264196 436 dbSNP
rs1294983907 448 dbSNP
rs1312496688 452 dbSNP
rs1008895965 460 dbSNP
rs1454332687 466 dbSNP
rs1383230792 471 dbSNP
rs1014972999 475 dbSNP
rs371800252 477 dbSNP
rs568604056 486 dbSNP
rs1356269506 493 dbSNP
rs537509151 498 dbSNP
rs1329560335 499 dbSNP
rs1409458319 500 dbSNP
rs184072342 503 dbSNP
rs1165730592 507 dbSNP
rs1445525641 524 dbSNP
rs970047622 528 dbSNP
rs376383472 547 dbSNP
rs1226806215 565 dbSNP
rs1233969472 569 dbSNP
rs1204556398 574 dbSNP
rs1436744143 585 dbSNP
rs142173904 587 dbSNP
rs774362173 588 dbSNP
rs1035684285 590 dbSNP
rs1342248801 591 dbSNP
rs1314095928 592 dbSNP
rs1232834922 596 dbSNP
rs950983795 602 dbSNP
rs1443735238 611 dbSNP
rs1375358132 614 dbSNP
rs983708464 615 dbSNP
rs958920363 633 dbSNP
rs992090045 633 dbSNP
rs1305080865 639 dbSNP
rs1425533554 649 dbSNP
rs1023994110 650 dbSNP
rs759453561 651 dbSNP
rs1421279795 654 dbSNP
rs1463529607 655 dbSNP
rs909384872 656 dbSNP
rs767344177 659 dbSNP
rs924280732 669 dbSNP
rs866871756 670 dbSNP
rs974901528 673 dbSNP
rs1290583502 677 dbSNP
rs990104053 678 dbSNP
rs921669676 690 dbSNP
rs1223116472 693 dbSNP
rs1348634777 696 dbSNP
rs933065722 699 dbSNP
rs143118216 705 dbSNP
rs554019131 711 dbSNP
rs1345073483 712 dbSNP
rs1405631263 712 dbSNP
rs923587969 716 dbSNP
rs1455583184 724 dbSNP
rs935276287 732 dbSNP
rs1456099665 736 dbSNP
rs1432101923 740 dbSNP
rs577138131 745 dbSNP
rs1053679021 749 dbSNP
rs539641367 750 dbSNP
rs932490168 750 dbSNP
rs1189081763 754 dbSNP
rs1416343241 755 dbSNP
rs1012041949 761 dbSNP
rs1261093477 767 dbSNP
rs551702295 770 dbSNP
rs1326898998 771 dbSNP
rs1385848780 776 dbSNP
rs905980846 779 dbSNP
rs775300156 787 dbSNP
rs556734335 794 dbSNP
rs1035722982 796 dbSNP
rs1344959532 804 dbSNP
rs944775870 818 dbSNP
rs1036330440 837 dbSNP
rs950667313 842 dbSNP
rs576617691 861 dbSNP
rs1288595208 883 dbSNP
rs1439548450 890 dbSNP
rs1016478317 891 dbSNP
rs1433357410 896 dbSNP
rs570103146 901 dbSNP
rs1177818659 904 dbSNP
rs368499299 909 dbSNP
rs1173428288 911 dbSNP
rs1429917618 913 dbSNP
rs1027887104 914 dbSNP
rs894748327 915 dbSNP
rs922103297 917 dbSNP
rs1024465791 918 dbSNP
rs1283373238 931 dbSNP
rs954487172 941 dbSNP
rs542259464 945 dbSNP
rs1268708269 947 dbSNP
rs1295164744 955 dbSNP
rs750460098 956 dbSNP
rs555497021 957 dbSNP
rs923619533 958 dbSNP
rs1337852351 968 dbSNP
rs1452547235 971 dbSNP
rs934987929 976 dbSNP
rs977146551 978 dbSNP
rs758508132 986 dbSNP
rs957044984 987 dbSNP
rs761256033 1013 dbSNP
rs572368148 1014 dbSNP
rs1198291246 1016 dbSNP
rs1386854668 1022 dbSNP
rs1184032048 1027 dbSNP
rs915127703 1028 dbSNP
rs1245030472 1032 dbSNP
rs947956916 1035 dbSNP
rs1479161280 1036 dbSNP
rs532726582 1037 dbSNP
rs1044944748 1043 dbSNP
rs764606017 1044 dbSNP
rs932601506 1045 dbSNP
rs938762601 1054 dbSNP
rs73679301 1055 dbSNP
rs564801886 1058 dbSNP
rs886443117 1061 dbSNP
rs1396549580 1070 dbSNP
rs180784176 1070 dbSNP
rs1461348564 1073 dbSNP
rs576720605 1076 dbSNP
rs1306944351 1081 dbSNP
rs1427408218 1082 dbSNP
rs1367064480 1089 dbSNP
rs1163911034 1090 dbSNP
rs1332498068 1091 dbSNP
rs1353294324 1093 dbSNP
rs1321069615 1095 dbSNP
rs3801455 1098 dbSNP
rs1436842905 1102 dbSNP
rs897935574 1107 dbSNP
rs1247285707 1109 dbSNP
rs899455875 1118 dbSNP
rs183763040 1125 dbSNP
rs1268485370 1130 dbSNP
rs3801456 1132 dbSNP
rs1207972850 1139 dbSNP
rs569619905 1149 dbSNP
rs1209560670 1153 dbSNP
rs781674485 1162 dbSNP
rs987198703 1163 dbSNP
rs548235176 1167 dbSNP
rs956580076 1179 dbSNP
rs1287095272 1182 dbSNP
rs1407459166 1184 dbSNP
rs1346962312 1189 dbSNP
rs115839373 1190 dbSNP
rs1404449679 1195 dbSNP
rs914888754 1198 dbSNP
rs1160153722 1199 dbSNP
rs1454238490 1209 dbSNP
rs1411169384 1213 dbSNP
rs535551232 1215 dbSNP
rs190383931 1219 dbSNP
rs927800732 1227 dbSNP
rs1198384085 1233 dbSNP
rs777573939 1235 dbSNP
rs765330247 1238 dbSNP
rs1028410820 1253 dbSNP
rs986729623 1270 dbSNP
rs1057247409 1272 dbSNP
rs1266816011 1273 dbSNP
rs748752167 1278 dbSNP
rs1274970491 1286 dbSNP
rs770464656 1287 dbSNP
rs547421372 1288 dbSNP
rs541976570 1291 dbSNP
rs1405458831 1292 dbSNP
rs1435554535 1298 dbSNP
rs1037732923 1304 dbSNP
rs1306821166 1313 dbSNP
rs1156826123 1330 dbSNP
rs1470936990 1337 dbSNP
rs1430063931 1338 dbSNP
rs899150625 1342 dbSNP
rs1172121508 1344 dbSNP
rs778358666 1345 dbSNP
rs935843025 1347 dbSNP
rs1368350208 1351 dbSNP
rs1411243444 1361 dbSNP
rs1288812136 1365 dbSNP
rs1194296061 1367 dbSNP
rs1354576632 1368 dbSNP
rs1242249837 1371 dbSNP
rs565912521 1371 dbSNP
rs1464746514 1372 dbSNP
rs760659536 1373 dbSNP
rs996452614 1376 dbSNP
rs570749377 1377 dbSNP
rs539703157 1378 dbSNP
rs1278700878 1383 dbSNP
rs182417779 1389 dbSNP
rs1342359230 1391 dbSNP
rs915903730 1392 dbSNP
rs948967801 1394 dbSNP
rs1364150216 1396 dbSNP
rs1318368319 1398 dbSNP
rs1228990778 1406 dbSNP
rs1359684246 1412 dbSNP
rs1333512186 1415 dbSNP
rs890624456 1417 dbSNP
rs1008984943 1419 dbSNP
rs140230936 1423 dbSNP
rs771948469 1428 dbSNP
rs1449137823 1434 dbSNP
rs1388702698 1438 dbSNP
rs1045978835 1442 dbSNP
rs1445708279 1446 dbSNP
rs1237417664 1448 dbSNP
rs956521338 1451 dbSNP
rs1440222938 1460 dbSNP
rs989616750 1463 dbSNP
rs1482223249 1466 dbSNP
rs775213381 1479 dbSNP
rs1207548580 1488 dbSNP
rs186585391 1489 dbSNP
rs1442215921 1496 dbSNP
rs561730153 1504 dbSNP
rs530775079 1507 dbSNP
rs969436711 1508 dbSNP
rs377175156 1520 dbSNP
rs550559778 1528 dbSNP
rs980687777 1529 dbSNP
rs1011750921 1534 dbSNP
rs927833185 1541 dbSNP
rs1027960801 1551 dbSNP
rs960606549 1558 dbSNP
rs982653478 1559 dbSNP
rs908355797 1560 dbSNP
rs1350828931 1571 dbSNP
rs1167461950 1574 dbSNP
rs1387763078 1579 dbSNP
rs940816401 1584 dbSNP
rs1240357003 1596 dbSNP
rs1206498775 1602 dbSNP
rs1431319532 1603 dbSNP
rs555812628 1608 dbSNP
rs1308265204 1614 dbSNP
rs572399048 1617 dbSNP
rs1394093535 1619 dbSNP
rs1019528755 1621 dbSNP
rs1226521710 1621 dbSNP
rs1335890624 1634 dbSNP
rs961318550 1642 dbSNP
rs1038159881 1657 dbSNP
rs972557105 1659 dbSNP
rs1341031818 1662 dbSNP
rs919755285 1663 dbSNP
rs1226570837 1670 dbSNP
rs952128605 1673 dbSNP
rs1349655196 1681 dbSNP
rs1340136430 1682 dbSNP
rs985291251 1691 dbSNP
rs1230622677 1692 dbSNP
rs1402887751 1701 dbSNP
rs920622020 1702 dbSNP
rs1335450619 1709 dbSNP
rs1275642835 1720 dbSNP
rs1471997245 1722 dbSNP
rs948712297 1725 dbSNP
rs769933887 1727 dbSNP
rs1199127966 1730 dbSNP
rs190306964 1734 dbSNP
rs150317823 1737 dbSNP
rs1188480435 1744 dbSNP
rs1227815710 1744 dbSNP
rs1327122525 1745 dbSNP
rs1053258252 1746 dbSNP
rs577922431 1751 dbSNP
rs1246655132 1763 dbSNP
rs1292094213 1765 dbSNP
rs1433357252 1768 dbSNP
rs1389971021 1774 dbSNP
rs1320435708 1793 dbSNP
rs1456160834 1795 dbSNP
rs558127411 1800 dbSNP
rs1049925896 1801 dbSNP
rs1424044086 1805 dbSNP
rs1450807861 1809 dbSNP
rs1052574807 1816 dbSNP
rs1007889734 1824 dbSNP
rs1208003697 1825 dbSNP
rs758343550 1826 dbSNP
rs897034128 1830 dbSNP
rs892614872 1832 dbSNP
rs543681002 1833 dbSNP
rs563556484 1839 dbSNP
rs1010674922 1841 dbSNP
rs1434372195 1842 dbSNP
rs1366352336 1843 dbSNP
rs529475018 1844 dbSNP
rs1408946784 1847 dbSNP
rs1304018949 1863 dbSNP
rs766475546 1865 dbSNP
rs1466123584 1869 dbSNP
rs952668769 1870 dbSNP
rs1318470628 1874 dbSNP
rs990689724 1877 dbSNP
rs1450993295 1889 dbSNP
rs766477462 1890 dbSNP
rs1390541446 1892 dbSNP
rs1187707117 1896 dbSNP
rs1447524874 1898 dbSNP
rs6954805 1906 dbSNP
rs181157208 1907 dbSNP
rs1254392061 1908 dbSNP
rs533127646 1909 dbSNP
rs1034683122 1914 dbSNP
rs970157910 1915 dbSNP
rs1437400760 1918 dbSNP
rs1296340085 1923 dbSNP
rs527337482 1935 dbSNP
rs115349983 1936 dbSNP
rs934886094 1937 dbSNP
rs1395997360 1944 dbSNP
rs543405191 1947 dbSNP
rs533285196 1948 dbSNP
rs373097187 1953 dbSNP
rs2190293 1954 dbSNP
rs1208435805 1960 dbSNP
rs369391817 1964 dbSNP
rs749041239 1985 dbSNP
rs1167679418 1991 dbSNP
rs1427618010 1993 dbSNP
rs1370019474 1994 dbSNP
rs973513572 1997 dbSNP
rs1423233835 2005 dbSNP
rs943771131 2007 dbSNP
rs920640189 2017 dbSNP
rs372996785 2019 dbSNP
rs1040698209 2026 dbSNP
rs866970730 2027 dbSNP
rs1274217223 2030 dbSNP
rs932059038 2041 dbSNP
rs1050423878 2044 dbSNP
rs911874349 2045 dbSNP
rs574016994 2047 dbSNP
rs1266451518 2050 dbSNP
rs753528405 2053 dbSNP
rs1339291887 2057 dbSNP
rs1200540824 2070 dbSNP
rs1411153670 2072 dbSNP
rs569897311 2073 dbSNP
rs185608690 2075 dbSNP
rs1156625539 2076 dbSNP
rs1390794785 2078 dbSNP
rs1163692583 2092 dbSNP
rs1457286465 2097 dbSNP
rs137956166 2098 dbSNP
rs892638458 2101 dbSNP
rs566176848 2112 dbSNP
rs1472976507 2118 dbSNP
rs142343631 2121 dbSNP
rs1251221974 2123 dbSNP
rs1289573974 2124 dbSNP
rs1180258150 2125 dbSNP
rs888406188 2132 dbSNP
rs1453594625 2136 dbSNP
rs1268485132 2137 dbSNP
rs1390095394 2146 dbSNP
rs1209635664 2154 dbSNP
rs1354808628 2157 dbSNP
rs1043893868 2158 dbSNP
rs1229594834 2159 dbSNP
rs557753577 2162 dbSNP
rs1001937371 2165 dbSNP
rs190371594 2168 dbSNP
rs1023471588 2169 dbSNP
rs778461334 2170 dbSNP
rs970084122 2171 dbSNP
rs1181793755 2177 dbSNP
rs182251032 2196 dbSNP
rs981506194 2197 dbSNP
rs557209857 2205 dbSNP
rs778369202 2206 dbSNP
rs535532032 2208 dbSNP
rs186273300 2211 dbSNP
rs1479089257 2216 dbSNP
rs1015884990 2219 dbSNP
rs956021362 2222 dbSNP
rs145900020 2225 dbSNP
rs1250350315 2228 dbSNP
rs559649481 2235 dbSNP
rs1487223053 2236 dbSNP
rs1211050539 2242 dbSNP
rs1266865761 2243 dbSNP
rs1202870829 2246 dbSNP
rs138453515 2247 dbSNP
rs911400487 2249 dbSNP
rs943738562 2256 dbSNP
rs1040833698 2265 dbSNP
rs918360896 2271 dbSNP
rs779969242 2294 dbSNP
rs1048100754 2302 dbSNP
rs541098484 2303 dbSNP
rs888324642 2306 dbSNP
rs1392413586 2310 dbSNP
rs1449332658 2311 dbSNP
rs1413878713 2313 dbSNP
rs1212986678 2314 dbSNP
rs1443608808 2317 dbSNP
rs1012175878 2320 dbSNP
rs77629149 2323 dbSNP
rs906394535 2334 dbSNP
rs1276422406 2335 dbSNP
rs1228880779 2348 dbSNP
rs1347987753 2350 dbSNP
rs1003356120 2351 dbSNP
rs1035724268 2353 dbSNP
rs1295320347 2357 dbSNP
rs911905727 2363 dbSNP
rs944670599 2369 dbSNP
rs532939547 2373 dbSNP
rs956158711 2377 dbSNP
rs988418905 2385 dbSNP
rs914174581 2386 dbSNP
rs1021630050 2393 dbSNP
rs200200118 2394 dbSNP
rs1044309510 2401 dbSNP
rs1224617349 2405 dbSNP
rs1388749925 2406 dbSNP
rs543143030 2408 dbSNP
rs1473443851 2409 dbSNP
rs1320394915 2410 dbSNP
rs965515756 2410 dbSNP
rs976945218 2413 dbSNP
rs1484450465 2417 dbSNP
rs1253568525 2421 dbSNP
rs559516781 2427 dbSNP
rs929747010 2432 dbSNP
rs1270697440 2438 dbSNP
rs563567189 2440 dbSNP
rs1356972215 2444 dbSNP
rs1202574940 2447 dbSNP
rs1253794475 2449 dbSNP
rs1483266571 2453 dbSNP
rs1352516792 2455 dbSNP
rs1181017088 2457 dbSNP
rs776477257 2462 dbSNP
rs909564242 2466 dbSNP
rs1167429721 2469 dbSNP
rs1406388887 2472 dbSNP
rs371921162 2473 dbSNP
rs1425450290 2477 dbSNP
rs62440510 2479 dbSNP
rs1044944308 2487 dbSNP
rs1004249702 2495 dbSNP
rs1253411154 2506 dbSNP
rs1385926389 2506 dbSNP
rs1429423574 2507 dbSNP
rs1166951465 2509 dbSNP
rs1482564428 2509 dbSNP
rs546266532 2517 dbSNP
rs370638008 2524 dbSNP
rs1289100187 2532 dbSNP
rs747564200 2533 dbSNP
rs898444589 2534 dbSNP
rs1289128500 2535 dbSNP
rs1228008790 2537 dbSNP
rs1371457274 2539 dbSNP
rs1295592557 2558 dbSNP
rs1377677004 2559 dbSNP
rs1052258854 2565 dbSNP
rs891834579 2573 dbSNP
rs1459341971 2593 dbSNP
rs1413530350 2596 dbSNP
rs1010328651 2601 dbSNP
rs995416904 2602 dbSNP
rs535135157 2607 dbSNP
rs968764707 2611 dbSNP
rs568092337 2619 dbSNP
rs1018523312 2637 dbSNP
rs965651303 2646 dbSNP
rs1307675339 2648 dbSNP
rs1268772332 2680 dbSNP
rs986197530 2685 dbSNP
rs1208197222 2688 dbSNP
rs1315300452 2689 dbSNP
rs1209208080 2692 dbSNP
rs1235496760 2693 dbSNP
rs1018950874 2697 dbSNP
rs1484228245 2709 dbSNP
rs1437824145 2710 dbSNP
rs1390039105 2713 dbSNP
rs1320583103 2717 dbSNP
rs1184124183 2718 dbSNP
rs1342968367 2721 dbSNP
rs966091771 2723 dbSNP
rs1247266318 2724 dbSNP
rs571337206 2730 dbSNP
rs1433467456 2731 dbSNP
rs10242862 2733 dbSNP
rs557271076 2734 dbSNP
rs1451186344 2737 dbSNP
rs913886131 2738 dbSNP
rs946988605 2741 dbSNP
rs979681720 2746 dbSNP
rs983907841 2754 dbSNP
rs926799598 2755 dbSNP
rs1435582700 2758 dbSNP
rs1231102732 2764 dbSNP
rs6951215 2764 dbSNP
rs1366509802 2765 dbSNP
rs1297472972 2768 dbSNP
rs1056231858 2773 dbSNP
rs947733920 2777 dbSNP
rs1304145114 2778 dbSNP
rs1466171359 2791 dbSNP
rs759541154 2799 dbSNP
rs927883280 2806 dbSNP
rs1390599203 2807 dbSNP
rs1169645101 2815 dbSNP
rs1426735403 2817 dbSNP
rs1258276168 2821 dbSNP
rs939273242 2822 dbSNP
rs1255710902 2825 dbSNP
rs1207611760 2828 dbSNP
rs1343294680 2831 dbSNP
rs1175860498 2842 dbSNP
rs1357775229 2846 dbSNP
rs1468092383 2847 dbSNP
rs115421974 2850 dbSNP
rs939782235 2853 dbSNP
rs1314171882 2854 dbSNP
rs1396126437 2856 dbSNP
rs1365039067 2863 dbSNP
rs1354384121 2865 dbSNP
rs1037127170 2869 dbSNP
rs898147245 2871 dbSNP
rs1370938777 2886 dbSNP
rs1167115847 2887 dbSNP
rs1460353806 2892 dbSNP
rs553552101 2902 dbSNP
rs1028172778 2908 dbSNP
rs946099207 2909 dbSNP
rs1415835724 2914 dbSNP
rs889624836 2918 dbSNP
rs1483542517 2929 dbSNP
rs1194451193 2930 dbSNP
rs1250172852 2930 dbSNP
rs1008049272 2946 dbSNP
rs796369695 2948 dbSNP
rs1218263243 2961 dbSNP
rs1006885833 2962 dbSNP
rs1333495728 2966 dbSNP
rs1290980176 2967 dbSNP
rs191793976 2969 dbSNP
rs901392470 2984 dbSNP
rs768081859 2985 dbSNP
rs1313743766 2989 dbSNP
rs565191084 2995 dbSNP
rs1203996598 2996 dbSNP
rs1350746072 2998 dbSNP
rs1327889024 3002 dbSNP
rs1267454521 3008 dbSNP
rs1389493006 3009 dbSNP
rs1392668359 3013 dbSNP
rs1294019266 3014 dbSNP
rs1021384800 3020 dbSNP
rs76322253 3024 dbSNP
rs1161466912 3025 dbSNP
rs1473007637 3034 dbSNP
rs184083665 3035 dbSNP
rs761333962 3039 dbSNP
rs959606293 3040 dbSNP
rs1268553131 3042 dbSNP
rs1190828997 3044 dbSNP
rs992368276 3045 dbSNP
rs918073304 3049 dbSNP
rs939795771 3051 dbSNP
rs1467533905 3052 dbSNP
rs1270672490 3055 dbSNP
rs1036754934 3061 dbSNP
rs577757079 3062 dbSNP
rs543453187 3063 dbSNP
rs1236493430 3068 dbSNP
rs1332596200 3075 dbSNP
rs777161085 3085 dbSNP
rs1306257364 3086 dbSNP
rs1303965114 3098 dbSNP
rs1049376367 3099 dbSNP
rs1456088129 3100 dbSNP
rs889739785 3105 dbSNP
rs1457860818 3110 dbSNP
rs1384396074 3111 dbSNP
rs142979315 3120 dbSNP
rs1345265484 3138 dbSNP
rs1467823554 3138 dbSNP
rs764526251 3149 dbSNP
rs988036142 3157 dbSNP
rs1435042836 3160 dbSNP
rs1453068248 3162 dbSNP
rs13238887 3171 dbSNP
rs1189823340 3183 dbSNP
rs1010082442 3187 dbSNP
rs946555703 3193 dbSNP
rs756881561 3196 dbSNP
rs968458125 3199 dbSNP
rs1203003738 3202 dbSNP
rs1223926245 3219 dbSNP
rs1000905107 3227 dbSNP
rs1033679969 3228 dbSNP
rs904602421 3232 dbSNP
rs549475481 3233 dbSNP
rs1368647705 3234 dbSNP
rs992399123 3239 dbSNP
rs1039699303 3249 dbSNP
rs901195762 3253 dbSNP
rs918092757 3263 dbSNP
rs559534595 3264 dbSNP
rs1403213307 3265 dbSNP
rs972897601 3274 dbSNP
rs919721126 3295 dbSNP
rs1245230680 3297 dbSNP
rs1169770305 3315 dbSNP
rs558142659 3317 dbSNP
rs1240941163 3319 dbSNP
rs749878976 3323 dbSNP
rs1200657581 3327 dbSNP
rs1017523743 3342 dbSNP
rs569665749 3345 dbSNP
rs980501746 3351 dbSNP
rs1345438491 3354 dbSNP
rs1034624781 3355 dbSNP
rs1215081886 3356 dbSNP
rs779596747 3360 dbSNP
rs1471934432 3362 dbSNP
rs1300646414 3367 dbSNP
rs1346621206 3369 dbSNP
rs960343666 3369 dbSNP
rs1160803295 3376 dbSNP
rs1409279453 3377 dbSNP
rs1282896262 3379 dbSNP
rs910874015 3379 dbSNP
rs1247128874 3381 dbSNP
rs1404265121 3381 dbSNP
rs1320970442 3382 dbSNP
rs943969950 3382 dbSNP
rs1351300760 3385 dbSNP
rs1405155031 3386 dbSNP
rs1195699869 3388 dbSNP
rs1251819908 3390 dbSNP
rs913809082 3390 dbSNP
rs1440079690 3391 dbSNP
rs1413231183 3393 dbSNP
rs373150504 3394 dbSNP
rs1372795104 3396 dbSNP
rs1307246282 3407 dbSNP
rs1040914921 3412 dbSNP
rs1329976741 3417 dbSNP
rs1409836321 3418 dbSNP
rs1348395603 3433 dbSNP
rs1229935770 3437 dbSNP
rs528249744 3444 dbSNP
rs1280080667 3450 dbSNP
rs945864162 3452 dbSNP
rs188269845 3453 dbSNP
rs571398292 3457 dbSNP
rs376380502 3464 dbSNP
rs1043277081 3468 dbSNP
rs112349754 3472 dbSNP
rs1287782466 3488 dbSNP
rs1490917494 3495 dbSNP
rs1000934363 3498 dbSNP
rs1033710966 3502 dbSNP
rs1270765263 3514 dbSNP
rs192004052 3516 dbSNP
rs1335534460 3522 dbSNP
rs148765636 3523 dbSNP
rs1013863774 3530 dbSNP
rs536968217 3531 dbSNP
rs1482286149 3541 dbSNP
rs1025185701 3543 dbSNP
rs1184362077 3548 dbSNP
rs1352574863 3549 dbSNP
rs922711094 3553 dbSNP
rs961851666 3555 dbSNP
rs1233996911 3560 dbSNP
rs1441971745 3562 dbSNP
rs1353159160 3564 dbSNP
rs933971649 3565 dbSNP
rs1462481067 3568 dbSNP
rs1394570369 3571 dbSNP
rs1047547099 3573 dbSNP
rs76455189 3577 dbSNP
rs1409753218 3578 dbSNP
rs887329052 3598 dbSNP
rs972965274 3610 dbSNP
rs754947953 3614 dbSNP
rs1231024524 3616 dbSNP
rs1223672683 3618 dbSNP
rs773373967 3619 dbSNP
rs1006223557 3621 dbSNP
rs952492021 3624 dbSNP
rs1211923115 3629 dbSNP
rs17163958 3630 dbSNP
rs1368260253 3632 dbSNP
rs1392944826 3633 dbSNP
rs1329258967 3648 dbSNP
rs1002349620 3654 dbSNP
rs910905074 3659 dbSNP
rs943665498 3660 dbSNP
rs1371613192 3662 dbSNP
rs1277041326 3663 dbSNP
rs747927280 3674 dbSNP
rs1442193749 3680 dbSNP
rs567078848 3681 dbSNP
rs1034716594 3683 dbSNP
rs1324590879 3686 dbSNP
rs1282563101 3694 dbSNP
rs960475248 3697 dbSNP
rs1361685520 3699 dbSNP
rs1405441519 3701 dbSNP
rs141482591 3707 dbSNP
rs1454621039 3711 dbSNP
rs1021040107 3712 dbSNP
rs557925352 3719 dbSNP
rs979778619 3720 dbSNP
rs771118779 3721 dbSNP
rs1215325783 3739 dbSNP
rs1315353779 3741 dbSNP
rs1240054341 3754 dbSNP
rs113497369 3761 dbSNP
rs1340251492 3765 dbSNP
rs1281094787 3777 dbSNP
rs910498490 3779 dbSNP
rs964529978 3782 dbSNP
rs368826482 3794 dbSNP
rs904342985 3797 dbSNP
rs1442408023 3798 dbSNP
rs577817018 3800 dbSNP
rs543518055 3808 dbSNP
rs1288950118 3810 dbSNP
rs774451399 3817 dbSNP
rs1175821582 3822 dbSNP
rs1444735069 3828 dbSNP
rs112509416 3832 dbSNP
rs934073658 3834 dbSNP
rs868850102 3844 dbSNP
rs1025393631 3846 dbSNP
rs1463177142 3854 dbSNP
rs183006103 3856 dbSNP
rs1394300060 3859 dbSNP
rs1168337921 3863 dbSNP
rs13227984 3871 dbSNP
rs1262433746 3875 dbSNP
rs111521152 3876 dbSNP
rs112957856 3877 dbSNP
rs1383374958 3883 dbSNP
rs1259839358 3887 dbSNP
rs751607039 3892 dbSNP
rs1211928726 3893 dbSNP
rs1453510561 3898 dbSNP
rs528312034 3899 dbSNP
rs1460245518 3902 dbSNP
rs1231176674 3906 dbSNP
rs1308616003 3911 dbSNP
rs1296926487 3915 dbSNP
rs1213508840 3918 dbSNP
rs1363353126 3926 dbSNP
rs952857036 3928 dbSNP
rs1374621476 3929 dbSNP
rs985177068 3931 dbSNP
rs1002318307 3934 dbSNP
rs1463408870 3935 dbSNP
rs557989989 3941 dbSNP
rs1373594172 3948 dbSNP
rs1169706995 3956 dbSNP
rs1252325510 3957 dbSNP
rs1426790940 3959 dbSNP
rs772276387 3961 dbSNP
rs1420186759 3965 dbSNP
rs1056595086 3971 dbSNP
rs1188918408 3971 dbSNP
rs1255783646 3976 dbSNP
rs1197954703 3980 dbSNP
rs965088432 3987 dbSNP
rs1251210838 3990 dbSNP
rs1297419693 3991 dbSNP
rs976486107 3992 dbSNP
rs912873865 3995 dbSNP
rs1294661688 3999 dbSNP
rs1265569410 4000 dbSNP
rs946016096 4013 dbSNP
rs1009737856 4015 dbSNP
rs1020596842 4018 dbSNP
rs1397011622 4019 dbSNP
rs979058693 4025 dbSNP
rs1460464189 4026 dbSNP
rs1396707371 4034 dbSNP
rs968102925 4038 dbSNP
rs1462126470 4040 dbSNP
rs1207607702 4042 dbSNP
rs571538582 4048 dbSNP
rs1323306039 4050 dbSNP
rs1017525828 4054 dbSNP
rs1416002262 4059 dbSNP
rs1184295924 4063 dbSNP
rs1420024131 4092 dbSNP
rs1250321164 4102 dbSNP
rs937119526 4103 dbSNP
rs1470224098 4105 dbSNP
rs1193456548 4106 dbSNP
rs1274442090 4107 dbSNP
rs114206218 4123 dbSNP
rs1030179106 4124 dbSNP
rs1263293778 4126 dbSNP
rs1476931160 4129 dbSNP
rs537367662 4133 dbSNP
rs1306030617 4136 dbSNP
rs1389549105 4139 dbSNP
rs983289861 4144 dbSNP
rs186974424 4153 dbSNP
rs1456620357 4155 dbSNP
rs1326617444 4158 dbSNP
rs6460785 4159 dbSNP
rs1160496855 4162 dbSNP
rs1392431754 4162 dbSNP
rs1046420899 4169 dbSNP
rs941344810 4174 dbSNP
rs1382876142 4179 dbSNP
rs897118301 4180 dbSNP
rs974076200 4186 dbSNP
rs1254209847 4188 dbSNP
rs926872961 4210 dbSNP
rs1467631768 4214 dbSNP
rs530571904 4216 dbSNP
rs994447125 4223 dbSNP
rs938266556 4226 dbSNP
rs1350961414 4227 dbSNP
rs1259883582 4237 dbSNP
rs1330698116 4238 dbSNP
rs1349841065 4240 dbSNP
rs1049081136 4244 dbSNP
rs376259335 4245 dbSNP
rs888620890 4255 dbSNP
rs1329410169 4261 dbSNP
rs115827670 4266 dbSNP
rs1228309459 4272 dbSNP
rs1266705362 4274 dbSNP
rs896678942 4275 dbSNP
rs1157150723 4278 dbSNP
rs1436935563 4296 dbSNP
rs1486567553 4302 dbSNP
rs1018393573 4304 dbSNP
rs139912759 4305 dbSNP
rs1375373871 4315 dbSNP
rs1194727701 4317 dbSNP
rs1447180146 4320 dbSNP
rs1449484001 4323 dbSNP
rs998332612 4323 dbSNP
rs1201378477 4326 dbSNP
rs1019963804 4337 dbSNP
rs1214065233 4345 dbSNP
rs967425918 4348 dbSNP
rs1280861411 4352 dbSNP
rs777010251 4354 dbSNP
rs1342799089 4365 dbSNP
rs1271953769 4366 dbSNP
rs925826363 4369 dbSNP
rs1325968884 4387 dbSNP
rs567159443 4395 dbSNP
rs867955690 4397 dbSNP
rs759715393 4402 dbSNP
rs917074460 4406 dbSNP
rs949508339 4419 dbSNP
rs574009110 4421 dbSNP
rs542744701 4423 dbSNP
rs950586134 4425 dbSNP
rs544417748 4427 dbSNP
rs1372054851 4434 dbSNP
rs929931803 4436 dbSNP
rs764882794 4439 dbSNP
rs1209915916 4441 dbSNP
rs553008643 4442 dbSNP
rs1346542584 4451 dbSNP
rs888735536 4454 dbSNP
rs1007080658 4455 dbSNP
rs1039880292 4462 dbSNP
rs539294489 4469 dbSNP
rs1276391953 4475 dbSNP
rs559218925 4477 dbSNP
rs191877686 4478 dbSNP
rs1356365276 4486 dbSNP
rs997965565 4487 dbSNP
rs1353892583 4489 dbSNP
rs1020415112 4490 dbSNP
rs967079642 4491 dbSNP
rs1409961578 4496 dbSNP
rs1000303908 4497 dbSNP
rs184130265 4501 dbSNP
rs1167929102 4504 dbSNP
rs1179691079 4505 dbSNP
rs1462645088 4506 dbSNP
rs918206669 4509 dbSNP
rs750029054 4513 dbSNP
rs945530835 4515 dbSNP
rs1471674407 4518 dbSNP
rs1234451362 4521 dbSNP
rs1032676791 4523 dbSNP
rs958640285 4531 dbSNP
rs11762847 4535 dbSNP
rs1256185983 4542 dbSNP
rs556759584 4560 dbSNP
rs1419573789 4561 dbSNP
rs77444093 4563 dbSNP
rs778760124 4572 dbSNP
rs1226881893 4574 dbSNP
rs1375974754 4576 dbSNP
rs917104221 4588 dbSNP
rs903561659 4595 dbSNP
rs1422745881 4597 dbSNP
rs542249845 4604 dbSNP
rs145326388 4606 dbSNP
rs1409632067 4607 dbSNP
rs1394644580 4609 dbSNP
rs565150560 4610 dbSNP
rs1376227108 4619 dbSNP
rs1392465473 4620 dbSNP
rs1409815154 4621 dbSNP
rs1158956352 4623 dbSNP
rs930071421 4624 dbSNP
rs1236257837 4626 dbSNP
rs1195479570 4631 dbSNP
rs997207484 4634 dbSNP
rs1252532320 4642 dbSNP
rs1311474257 4643 dbSNP
rs1318966696 4644 dbSNP
rs386710281 4645 dbSNP
rs1285329765 4647 dbSNP
rs1379948947 4654 dbSNP
rs1306239066 4663 dbSNP
rs1030239679 4670 dbSNP
rs886391918 4675 dbSNP
rs984106961 4676 dbSNP
rs189503347 4679 dbSNP
rs193036858 4689 dbSNP
rs1346633625 4703 dbSNP
rs1318611803 4705 dbSNP
rs963082146 4706 dbSNP
rs1378319916 4714 dbSNP
rs530603024 4715 dbSNP
rs1039911131 4716 dbSNP
rs1454656519 4716 dbSNP
rs1189565930 4717 dbSNP
rs544717889 4717 dbSNP
rs6980126 4722 dbSNP
rs959355356 4723 dbSNP
rs934119695 4727 dbSNP
rs992155846 4733 dbSNP
rs1041882483 4735 dbSNP
rs902971486 4737 dbSNP
rs1487504883 4739 dbSNP
rs918163374 4742 dbSNP
rs966989744 4748 dbSNP
rs1347818345 4755 dbSNP
rs10235587 4756 dbSNP
rs1216940302 4756 dbSNP
rs755849690 4757 dbSNP
rs1442877354 4760 dbSNP
rs1399088373 4763 dbSNP
rs185766591 4764 dbSNP
rs1386134259 4765 dbSNP
rs894121894 4767 dbSNP
rs1168847215 4768 dbSNP
rs1173912889 4771 dbSNP
rs1430358975 4772 dbSNP
rs1012840469 4774 dbSNP
rs1462756083 4776 dbSNP
rs1193212042 4779 dbSNP
rs1476966588 4779 dbSNP
rs1259990157 4786 dbSNP
rs1212086092 4789 dbSNP
rs921708405 4789 dbSNP
rs1254748215 4792 dbSNP
rs1207319416 4801 dbSNP
rs1308748636 4802 dbSNP
rs1295684589 4804 dbSNP
rs1217577452 4805 dbSNP
rs777693981 4813 dbSNP
rs1337989744 4815 dbSNP
rs1024192941 4823 dbSNP
rs932964618 4824 dbSNP
rs1381164496 4825 dbSNP
rs1300995132 4849 dbSNP
rs1454149727 4853 dbSNP
rs1355120216 4854 dbSNP
rs1051479323 4868 dbSNP
rs886313998 4881 dbSNP
rs971330043 4885 dbSNP
rs560483937 4887 dbSNP
rs75612541 4889 dbSNP
rs1004808617 4907 dbSNP
rs1037908095 4910 dbSNP
rs972344718 4917 dbSNP
rs1179399643 4918 dbSNP
rs1026126426 4923 dbSNP
rs552891217 4927 dbSNP
rs951577805 4940 dbSNP
rs147647595 4950 dbSNP
rs1274636723 4952 dbSNP
rs1233584373 4963 dbSNP
rs1320883594 4972 dbSNP
rs1310317681 4974 dbSNP
rs1393005579 4978 dbSNP
rs746059134 4980 dbSNP
rs1462571343 4989 dbSNP
rs1330639462 4995 dbSNP
rs1013500987 4997 dbSNP
rs538052336 4999 dbSNP
rs1165921222 5002 dbSNP
rs1457600543 5010 dbSNP
rs772475365 5014 dbSNP
rs967337261 5017 dbSNP
rs1420157660 5031 dbSNP
rs978386324 5032 dbSNP
rs1177365889 5040 dbSNP
rs925548886 5061 dbSNP
rs1254405948 5063 dbSNP
rs1209994321 5065 dbSNP
rs958178731 5070 dbSNP
rs974941473 5075 dbSNP
rs140578053 5077 dbSNP
rs975646037 5078 dbSNP
rs933057770 5080 dbSNP
rs922881765 5085 dbSNP
rs567260374 5091 dbSNP
rs934257957 5100 dbSNP
rs1373204946 5101 dbSNP
rs149742019 5101 dbSNP
rs1326683079 5104 dbSNP
rs1429507017 5104 dbSNP
rs1386382022 5106 dbSNP
rs1175751201 5117 dbSNP
rs1404588616 5118 dbSNP
rs1290891147 5130 dbSNP
rs1380135170 5132 dbSNP
rs1454607656 5132 dbSNP
rs1042303264 5144 dbSNP
rs1455969459 5150 dbSNP
rs1396300770 5177 dbSNP
rs903321315 5179 dbSNP
rs935754780 5182 dbSNP
rs145579688 5183 dbSNP
rs1336888848 5184 dbSNP
rs1206589210 5186 dbSNP
rs552714809 5188 dbSNP
rs1214290730 5189 dbSNP
rs1349994032 5191 dbSNP
rs758041502 5191 dbSNP
rs1232576354 5193 dbSNP
rs1427963795 5195 dbSNP
rs1012621032 5201 dbSNP
rs1023970242 5204 dbSNP
rs200516226 5212 dbSNP
rs766044810 5212 dbSNP
rs940578248 5212 dbSNP
rs1362168806 5231 dbSNP
rs899123305 5232 dbSNP
rs1218468424 5235 dbSNP
rs907136137 5242 dbSNP
rs1172556672 5244 dbSNP
rs1477401556 5247 dbSNP
rs1375495219 5251 dbSNP
rs1194796524 5255 dbSNP
rs1477952913 5259 dbSNP
rs1281114052 5263 dbSNP
rs1325654718 5266 dbSNP
rs572470837 5271 dbSNP
rs1486550525 5272 dbSNP
rs1279212022 5282 dbSNP
rs1224042704 5286 dbSNP
rs1267353636 5292 dbSNP
rs895200602 5297 dbSNP
rs1340147388 5302 dbSNP
rs1276655127 5305 dbSNP
rs1013685198 5313 dbSNP
rs538581175 5314 dbSNP
rs1446514598 5318 dbSNP
rs1334081375 5319 dbSNP
rs1413273821 5328 dbSNP
rs1025373939 5333 dbSNP
rs775667132 5335 dbSNP
rs190487897 5338 dbSNP
rs1465786180 5339 dbSNP
rs951892048 5342 dbSNP
rs1244090733 5344 dbSNP
rs1191121511 5345 dbSNP
rs1476055443 5351 dbSNP
rs1237906063 5354 dbSNP
rs1186667316 5365 dbSNP
rs984174011 5375 dbSNP
rs1440641927 5380 dbSNP
rs1016942476 5394 dbSNP
rs1199384834 5395 dbSNP
rs1317425875 5396 dbSNP
rs1256385067 5429 dbSNP
rs964090263 5431 dbSNP
rs111914745 5432 dbSNP
rs1199211648 5452 dbSNP
rs769137100 5454 dbSNP
rs779465627 5455 dbSNP
rs1332681461 5457 dbSNP
rs1446850741 5458 dbSNP
rs974868087 5460 dbSNP
rs1411805703 5465 dbSNP
rs1406740840 5469 dbSNP
rs1414176505 5471 dbSNP
rs1162453936 5473 dbSNP
rs148875938 5474 dbSNP
rs924775553 5475 dbSNP
rs1468998966 5482 dbSNP
rs1345467554 5483 dbSNP
rs987255211 5484 dbSNP
rs907639007 5485 dbSNP
rs1236437014 5492 dbSNP
rs1435290778 5492 dbSNP
rs940362953 5494 dbSNP
rs1452427999 5497 dbSNP
rs1289560078 5499 dbSNP
rs1195614889 5522 dbSNP
rs1353345689 5524 dbSNP
rs973519128 5527 dbSNP
rs561095210 5531 dbSNP
rs574859737 5540 dbSNP
rs1405270298 5545 dbSNP
rs1240150107 5560 dbSNP
rs1375434449 5561 dbSNP
rs1328706090 5563 dbSNP
rs75198836 5578 dbSNP
rs1054618713 5583 dbSNP
rs1350142587 5587 dbSNP
rs915701266 5593 dbSNP
rs1403378412 5597 dbSNP
rs181540121 5605 dbSNP
rs1428158768 5607 dbSNP
rs1045834874 5616 dbSNP
rs186241546 5618 dbSNP
rs80112715 5619 dbSNP
rs1378501459 5641 dbSNP
rs1195609774 5644 dbSNP
rs563166756 5645 dbSNP
rs1478418086 5658 dbSNP
rs993843054 5661 dbSNP
rs949949107 5662 dbSNP
rs1047603128 5668 dbSNP
rs1266963479 5669 dbSNP
rs528926174 5671 dbSNP
rs887621602 5673 dbSNP
rs1200545341 5678 dbSNP
rs773664675 5679 dbSNP
rs1006045425 5681 dbSNP
rs1017389695 5692 dbSNP
rs999528809 5694 dbSNP
rs1159851758 5695 dbSNP
rs531993203 5696 dbSNP
rs1423381588 5698 dbSNP
rs1362155271 5700 dbSNP
rs1298604283 5703 dbSNP
rs894028595 5706 dbSNP
rs964119922 5710 dbSNP
rs1358508560 5712 dbSNP
rs996443802 5714 dbSNP
rs996874847 5718 dbSNP
rs1029141144 5727 dbSNP
rs954881606 5728 dbSNP
rs988080942 5731 dbSNP
rs1367001307 5733 dbSNP
rs368038117 5741 dbSNP
rs1307150241 5744 dbSNP
rs1333961056 5746 dbSNP
rs1487536000 5747 dbSNP
rs548502568 5747 dbSNP
rs978083883 5761 dbSNP
rs1211522714 5789 dbSNP
rs1312194808 5790 dbSNP
rs1277313559 5793 dbSNP
rs962104251 5795 dbSNP
rs973058610 5799 dbSNP
rs1278486425 5800 dbSNP
rs1281418387 5802 dbSNP
rs1374159178 5807 dbSNP
rs7781258 5808 dbSNP
rs1289900361 5809 dbSNP
rs1466496403 5812 dbSNP
rs1358593392 5816 dbSNP
rs1361816831 5819 dbSNP
rs766042021 5822 dbSNP
rs1170297019 5825 dbSNP
rs1477038707 5828 dbSNP
rs937238516 5830 dbSNP
rs1483221109 5832 dbSNP
rs751004489 5834 dbSNP
rs367972495 5836 dbSNP
rs1436644276 5837 dbSNP
rs56802892 5840 dbSNP
rs1233907106 5842 dbSNP
rs1443505873 5849 dbSNP
rs142585533 5851 dbSNP
rs1314634216 5856 dbSNP
rs1386750823 5856 dbSNP
rs1378393655 5860 dbSNP
rs949905649 5861 dbSNP
rs1424879189 5863 dbSNP
rs1041978840 5864 dbSNP
rs1167174058 5865 dbSNP
rs1449063043 5870 dbSNP
rs1394068435 5871 dbSNP
rs1401197504 5890 dbSNP
rs902555407 5892 dbSNP
rs1329476404 5894 dbSNP
rs1370511937 5896 dbSNP
rs1165962546 5898 dbSNP
rs1423634359 5899 dbSNP
rs1405208403 5909 dbSNP
rs948462508 5911 dbSNP
rs1045464390 5913 dbSNP
rs566159193 5940 dbSNP
rs935418421 5946 dbSNP
rs1458707617 5948 dbSNP
rs538240960 5956 dbSNP
rs1238259811 5959 dbSNP
rs1053758957 5966 dbSNP
rs1452053228 5973 dbSNP
rs1479468863 5974 dbSNP
rs893829852 5976 dbSNP
rs1245209744 5980 dbSNP
rs759061293 5981 dbSNP
rs1320946999 5985 dbSNP
rs558460246 5987 dbSNP
rs1310471812 5989 dbSNP
rs928294745 5998 dbSNP
rs1377667130 6004 dbSNP
rs188663178 6007 dbSNP
rs1463452695 6019 dbSNP
rs1444783018 6021 dbSNP
rs1269754386 6024 dbSNP
rs890742869 6024 dbSNP
rs73681603 6049 dbSNP
rs1160900531 6050 dbSNP
rs1380329000 6051 dbSNP
rs1177503565 6055 dbSNP
rs1416835941 6068 dbSNP
rs115362391 6071 dbSNP
rs994566619 6072 dbSNP
rs1006076612 6075 dbSNP
rs1488032694 6090 dbSNP
rs10085512 6092 dbSNP
rs1201286028 6093 dbSNP
rs1354361732 6102 dbSNP
rs1308496699 6106 dbSNP
rs900320249 6107 dbSNP
rs997341947 6116 dbSNP
rs1332964445 6119 dbSNP
rs1029712380 6121 dbSNP
rs955635353 6125 dbSNP
rs535363226 6130 dbSNP
rs971721387 6133 dbSNP
rs1370930818 6140 dbSNP
rs1476286293 6146 dbSNP
rs1420801859 6150 dbSNP
rs1157436555 6153 dbSNP
rs998904392 6153 dbSNP
rs1428569858 6156 dbSNP
rs1468152793 6157 dbSNP
rs1378927015 6159 dbSNP
rs1334871913 6165 dbSNP
rs977245459 6167 dbSNP
rs1432256961 6190 dbSNP
rs1266457227 6201 dbSNP
rs7785008 6204 dbSNP
rs777412435 6206 dbSNP
rs1203385444 6210 dbSNP
rs763124471 6211 dbSNP
rs990369545 6212 dbSNP
rs1053852991 6214 dbSNP
rs771143332 6216 dbSNP
rs1343911335 6223 dbSNP
rs1023159658 6231 dbSNP
rs1324870528 6234 dbSNP
rs181285626 6235 dbSNP
rs546229459 6242 dbSNP
rs1296885208 6243 dbSNP
rs1398311440 6246 dbSNP
rs1172687763 6247 dbSNP
rs931968076 6248 dbSNP
rs1426742601 6252 dbSNP
rs928440948 6261 dbSNP
rs929046320 6271 dbSNP
rs890679739 6273 dbSNP
rs1262203889 6274 dbSNP
rs1190859589 6287 dbSNP
rs562825648 6288 dbSNP
rs73681605 6289 dbSNP
rs1222220545 6290 dbSNP
rs1321567799 6297 dbSNP
rs1036511429 6301 dbSNP
rs1265475731 6305 dbSNP
rs1317606012 6305 dbSNP
rs897971963 6325 dbSNP
rs1268801759 6327 dbSNP
rs1461392102 6329 dbSNP
rs1341562173 6332 dbSNP
rs994997016 6335 dbSNP
rs531932271 6339 dbSNP
rs1027353967 6341 dbSNP
rs758649231 6350 dbSNP
rs1428328272 6352 dbSNP
rs1479294633 6353 dbSNP
rs941967012 6359 dbSNP
rs967460188 6360 dbSNP
rs1429851000 6373 dbSNP
rs1012495839 6375 dbSNP
rs1038886935 6380 dbSNP
rs551568714 6381 dbSNP
rs542474033 6384 dbSNP
rs977760314 6401 dbSNP
rs1384123662 6408 dbSNP
rs924574168 6410 dbSNP
rs1271196422 6412 dbSNP
rs933202557 6414 dbSNP
rs957177616 6414 dbSNP
rs1052029636 6418 dbSNP
rs1244426046 6425 dbSNP
rs1379861966 6429 dbSNP
rs747024875 6433 dbSNP
rs999329163 6438 dbSNP
rs768602425 6440 dbSNP
rs1326503224 6441 dbSNP
rs893116321 6442 dbSNP
rs1285553277 6450 dbSNP
rs1391271778 6452 dbSNP
rs1313189753 6464 dbSNP
rs1162778968 6477 dbSNP
rs1442719298 6480 dbSNP
rs562177867 6483 dbSNP
rs527864391 6491 dbSNP
rs1037009885 6492 dbSNP
rs970709795 6497 dbSNP
rs1439212365 6500 dbSNP
rs1231382053 6506 dbSNP
rs1224142225 6507 dbSNP
rs368214242 6508 dbSNP
rs930808511 6520 dbSNP
rs571455613 6521 dbSNP
rs1287418303 6524 dbSNP
rs1240216294 6530 dbSNP
rs1267629508 6531 dbSNP
rs1277409019 6535 dbSNP
rs950525755 6538 dbSNP
rs983136476 6543 dbSNP
rs1012631104 6547 dbSNP
rs1302335571 6551 dbSNP
rs1422624595 6558 dbSNP
rs566218467 6573 dbSNP
rs1201554139 6577 dbSNP
rs1159238858 6590 dbSNP
rs1400188436 6595 dbSNP
rs908902186 6599 dbSNP
rs1193071893 6600 dbSNP
rs4534044 6601 dbSNP
rs185788814 6608 dbSNP
rs1031997793 6609 dbSNP
rs1460283756 6626 dbSNP
rs1455597771 6637 dbSNP
rs921891841 6638 dbSNP
rs561591008 6641 dbSNP
rs957277771 6641 dbSNP
rs1315742523 6645 dbSNP
rs933213523 6647 dbSNP
rs1159312057 6651 dbSNP
rs1365085211 6654 dbSNP
rs1220549970 6655 dbSNP
rs989949353 6661 dbSNP
rs1028174036 6662 dbSNP
rs953418865 6671 dbSNP
rs1423251142 6677 dbSNP
rs1342215349 6680 dbSNP
rs1305515739 6681 dbSNP
rs1298661531 6690 dbSNP
rs1051630435 6702 dbSNP
rs902314204 6705 dbSNP
rs1368680493 6718 dbSNP
rs1178358691 6720 dbSNP
rs572836178 6721 dbSNP
rs1415146522 6727 dbSNP
rs1428837199 6732 dbSNP
rs6972528 6739 dbSNP
rs114867919 6741 dbSNP
rs1337150589 6750 dbSNP
rs1264359031 6755 dbSNP
rs972131551 6757 dbSNP
rs1240485998 6760 dbSNP
rs1239823752 6764 dbSNP
rs1290359981 6768 dbSNP
rs1231968956 6776 dbSNP
rs1211579126 6777 dbSNP
rs554830296 6780 dbSNP
rs1262113515 6787 dbSNP
rs1224565546 6788 dbSNP
rs112412294 6795 dbSNP
rs1022971649 6803 dbSNP
rs369188657 6804 dbSNP
rs191086984 6809 dbSNP