miRTarBase - #MIRT023379 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CHST3   
Synonyms C6ST, C6ST1, HSD
Description carbohydrate sulfotransferase 3
Transcript NM_004273   
Expression
Putative miRNA Targets on CHST3
3'UTR of CHST3
(miRNA target sites are highlighted)
>CHST3|NM_004273|3'UTR
   1 GGGGGCCGGGGCCCCGTATGCCCCTCCTCGTGAAAGGCCTGCCCCGTCTTTCTGCCGCAGCCCTCGCAGAGGGCGGGTGC
  81 ACAGCGCCATGAGCGGGCAGCGCCTCCTGTAGCAGTAGGGCCCCCAGCCAGCGCTCCAGCCAAAGCGGCGGCCCCAGGGT
 161 TAATTGCGGAGAACAGGACAGTGCCCGGTCCCCTTGAGGGCCATCACACCCAGACCCAACGGGTTGCAGCCTCCTGAGCA
 241 GGCCTAGGCAGGCCCGGGCCTGTTGGCAAGCTTCGATCTCACACACACAGAAACATACATTCGTGCCTGGAGACCCTGCA
 321 GGCCAGAGTCCAAATATTTAACAATCAGAAGGGGCAAGGCTCTGACCAGTGACAGTCAGACCTCCTGCTTTATTTGGTGT
 401 TAACCGTTTCTTGTCTGGATGGTGAAGTCTGGAATCTGGGTGGGTCCTTGGAGGAGGGGCTAGGACAGCCGTGGGTGTCA
 481 AAGGTGGCATTTGAGGCTCGTTTGAGGTGACAGTGGCTGTTTACCAACTAGTACAGAGCGATTCAGCGTTTTCATGAATG
 561 GGTTGGCTGTGCTGGTTACTGATGAATATGGGCCCCTTATAGAGCTGCAAAACACACACATGCGTATAGACATACATACA
 641 TGTACACCATACATAGACAAGCATCATAAAGGCACAAGTGCACACACATCTATGCAGACAAGCTTCCTCGCTGCTTATGC
 721 CCACAGGGTTTTTCTGTATGACACACCTCAGAGGAGCCTGTGCTTAACATTTGTAGGATTATTTCGAGGGCAGGGCAGGG
 801 GAAAGAAACGCGTTAAAGGGCCATGACATGACACAGTTCCCTGGCCGGGTTTGGACTGAACAGTGGATTCAGAACTGCAG
 881 CGTTCAAAGCCCCTGCCCGCCTTAGATTCTCATGGCTACCTCCTCTGACCCATCCACATCCTTGCGGCTGGCAGGCAGGA
 961 TGTTTTGAAATGGTGCAGCCAAAGGCCCCGTCTAGCTTGGCTGGCTCCCGAACATGTCCATATTTGAAGGCTGCCTCAGG
1041 CCTGGCAGGCAGAAGCAGCTGTGGTCCCTGGAGGCAAAAGGCAGCTCACGGGGCCTTCCATTTCCAGCCAGGCCTCATCT
1121 GGGGTAGGGCCAAGAGGAAAGTACAGAGTGCCCGTGGGGGAGAAGTCCCACCAGGATGCCCCCCCTCCCCTGAGAAGCCC
1201 GCCTTCTCCCTCGTGGACAGGAGTCAGCCAGTTGGTTGCTGTGGTTACAGCCAGTGCCTGGAATTCCTCCTTAGGGCCCT
1281 GGGAAGAGTATTGCTTAACGCAGGATGTGCTGGGTGTTTTGTTTCGGGCTTTTATTTATGGCTTGGTGTCTTTCTTGTTT
1361 CATGGCTGTGTTTTTGCTTTTGTTTCTGTAGGAGCGCCTCTTCCAAGCAGTGGAGGCCTGAGGGCTTGAGGGAGGCTGGG
1441 GAAAACCAGCAGGGAGCACTTGGCTCCTGGCAGAGGGAGAGGACAGGAGGAGGAGCCTTCCCCAGGAGGAACGAGGAGAG
1521 GTGGCCACGTGGCAGGCCACAGTGCCCTATGGGCTTTTCTGTTTGAACCCCATGTGGGATGAATCTCAAAGCCACCAGCG
1601 TTCTTGCCTAGTGTCCAGAGCAGCAGAGATTTGCAGCCCTCGCCCCTCCCTGAGAAGAAGCTGGATTTGAAAATCCCTCA
1681 CAGGCCCTAACATGTTTCCTGGGTGGGCAGGGGCCTCATGACAAGCGACAAGTGTACCCAGAGTAGAAGGCCTTCCCCAC
1761 TCCCACCTCAAACCCAGGAGCAGAACTCAGTATCCAGAGCTTACAAGGAGCTGCAAGGGTTTGCCGAGGGCTGCCCAGCT
1841 CTGCTTCTGGTTTCCTGGACAATTTCTCTGTCAGATACGGCCCATTGTAAACCCAGAGGGCTGCATTTTGGGTTGAGTAA
1921 TATGGACACCATGGAAGTACAGGATCTGAGTCCAACATTGCCATGGGGGAGGGAAGAGTGTGTCCTGGCAGGAAGCCACC
2001 ATTGGAGAAGGTGAGGCCAGTAACCATCTCATGGGATTCGCTATAATCAGCCTATTTGAGCTGCTGGGTCTCTGTCACTG
2081 TGGACTCCAGTCATTCAAGGAGGTCTCCACTCTTGGGTTTTTTTTATTTTCTTTTCTTTTGCTATTTTGCCTGAACACCC
2161 CAACACTCTTGGTTTTAGAGTCCAAGAGTAAGTTGTGCAGAGACATGGTTCTAATTTGGAGTTCAAAGGAACACCAGCTC
2241 TGAAAACATGACCGTGGGGCCAGGATGTTTCTGGCAGGCCCAGAAGTGCTGGCCGTTCTTCCCCAGCCTCCCCACTGCTC
2321 CCTCCTCTGTTCCCCATGTGGAGGTCGGAGGGGCTGGGACTGGGGAGGGGGCAGCCACCTCCATCCAAGGCTCTTCCTAG
2401 GGGCCCTGCTAATGTGGACAGTAGACTTTATCCCTCCTTCTTACTCTGGGCCAAGACCTCCCACTCCGCCCTCTGAGGAT
2481 GGTACCAAGAATGGGCCTTTGGGACTTCTCAGGACATTGACAATGTGCACACTGCAGGTTGACTTAATTTATTTATTTTT
2561 TGAAAAGAAGAGACAGAAAATACCTTATTATCTGCAGGGACTCAAAGCTGTACCCAAATCAAGAAAGACAAAATAACAAT
2641 AGAAACCATTCACACACTCCGTTCATGCATGGACACCAGAAGACGATTCAGAACACAAGAGGAGAATGAGCTGGAGCGCC
2721 AGCACCACGATGGCCCCAGGACGTTGTTTAAGATCTGAGATCCCTTGGTTTCTCTCTTGTTGATCTGAGATGCTACATCA
2801 GGGCCCTTGCTGCTGTATTACCTCTGCCCGGGTGTTTGAGACAGGTCACAAGCGCGTGGATGTTTCCTGGAAGTGTATTC
2881 CCCTGGGGCTCAGCGATGCTCTGGGAACCCTTGGGGTTTGGGGAAGGACAGTGTGGTGTGACTATTGGCTTGAAACGTTA
2961 TGGATATGGTTGGAGTCACCCATGTGGATATGATTTTCAGCTTGGAGCTGGGATGGAGAAGATGGAAGCACTGGTGGCCG
3041 GGCCTCTTTTTCCAGCGAGGCCAGCCCTGGCTTCTCCTCTGTTCCAGCTTGTCTGCCAGAAGCCTTCCCCTGCAAGGTGC
3121 CCACCTGCCCGGAGACAGAGGGAGCAGCTGAGGCCTCTCTCCACTGGCCGCCAGCCTCCCTAGCACAAGGGGACCATTCA
3201 GCAATGAGTGTTTACTCATGTTCTTTCTTGTTGATGAGTTCTGCGGCCCAGCATATAGAAATGGCTCAGAACGTTCCAGG
3281 CCTTGGTGAGACACAGCAGCGTCCAATGCTCACAGGCTGTCCCCACTCTGCCTGTTCCCATCTTCCCCTCGGGACCTGTT
3361 TATAAATTGAGGAATGGATGAGGGCCCTGGAGGGTCCTTGGGAGTAGTTAGTGGAGGGCAGGATTCTCAGGTCCCCATAG
3441 AGAGGGAAAGAGAAGACCAGATGTGCATAGAAGCCAGTCTCTGTCACATACACCGCAGGTGGTCACCGAGTTATTTTCCA
3521 AAAGCTGAGGAACATAAAGCAAATTTAGGCTTTTGTCCTTCTGCAATACATGCACTTGAAAATAAACAGAAAAGAGATGT
3601 TTAATAACAAGTTTACTTCCGGTCTGCTAGCACCCTCAGCCTGGGAGCTACTGCCAGAGGCTGGCGTAGTGGGGCAGCTG
3681 CTGACCAAACCCCACAGAACAGAGGGCACCAGGCATCACACGACATCTTTCCCTCCCATCTCTGCCATCTGTCTGTCTGG
3761 CAATGGAAGGAGCTTCAGCAGGAGGTCCTTCCCAGAAGGTTGATTCTTGGCCTGGGTGGTAGAGGAGATATCCTGACCCT
3841 AAAGTCTTCCAGCCCCGGGTCATCCTCTCCTATACTAGGGCCTATTGACCGTAGAGGCCAGGTGCGGTGGCTCATACCTG
3921 TAATCCCAGCAGTTGGGGAGGCCAAGGTGGGAGGATTGCTTGAGCCCAAGAGTTGGAGACCAGCCTGGGCAACATGGTGA
4001 GACCAATTGACTGTAGGGCTTGTCCCTTGCTAAGACAGGAGCAGAAGACTGGATGGCTGTGTCCTCAAGGCAGTCCCCTC
4081 CCATCCCCATTCCCAAAGTCAGAAAGTGAAGCCAGATCTCAAGGGCTGATACCTGAGGCAAGGAGAGCTAAGGGGAGAGA
4161 AATTGGGGCTGAGTGGAAGCAGATGCCTGCACAAGCCAAGTGTGTCTTATTGATCTGTACAAGCTGATAGAAGGACCATC
4241 TGCTGAAATCCAGGGCTCCTGAGTTGGTGGGTTTGCTTGTGAAGCTTCTAGGACAAGGCGCAGCCAGATGGAAGGGAGAG
4321 GGTCCAGGGCTTCCTAAATGCAGCCGCATCACCTGTCAACTCGCTGCAGTTTCAGAGACAGTGGAAGCTGCTCTTTACCT
4401 CAAAAGCACAAAGCAGAATTGGCAACTTCACTTGTCTCAAGAGCTCCAAGATCCTTTGGTCTCGTGTCCTTTGGCACCCC
4481 GTAACTGGACTGGGGACAAATTTGTTACGTGTTTCCAAGGCTACAGACATGGCGCCATCCTCACAGGCCTAGCTCATGTC
4561 ATGGATCAGGTGCTTTGCTGGGGGGATACAATGACCCATGTGGTCTGCGTCTTCTGCCATTGGCTTGAACTGGGCACCCC
4641 CTGAAGTCTCCATCTCAGCTGTATATTCTAGTCCAAATTTTCCTGGCTCCCCTGCTCCCTCCCAGGTCCTGCACACTGTC
4721 TTTTTGCCAACACCTCAGCCCTGTTTGCTATTTCATGTCTGCATGGTACGAGACACCCCTTCACGGCATACACTGCCATG
4801 GTATGTACATATGCATCCACGTGTGTGTATGTGTAGCATGTAGCTCATTCTGCTCAGCCTCTGGCGCCGTTCCACATTGC
4881 TCCCAGCCCCATTGCTGTCACTGTCGTCCCAGATGTCCTTGCCATGGCCACAGACAATCTGCCGTCTCCTGGAAACGCTG
4961 GGGCTGCCCTTCAGAGAGCTGGCAGCCCCAGCAGTCAGGGCCTGCTTTGCAGAATAGAATGTGAACCCAACTCCTGATGG
5041 CCTACTTGACTTATTTAATTAAAGATGAAATCATGCAATGAGCAAAACCTGCAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :| ||||||  |||||||| 
Target 5' taGAAACCATTCACACACTCCg 3'
2640 - 2661 172.00 -21.90
2
miRNA  3' guUUGUGGUAACAG-UGUGAGGu 5'
            ||||||     | ||||||: 
Target 5' tgAACACC----CCAACACTCTt 3'
2152 - 2170 134.00 -15.10
3
miRNA  3' guUUGUG---GUAACA-GUGUGAGGu 5'
            :|||:   || ||| |||||| | 
Target 5' agGACATTGACAATGTGCACACTGCa 3'
2511 - 2536 132.00 -15.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
284351 8 ClinVar
878319 58 ClinVar
289041 67 ClinVar
300569 204 ClinVar
300570 239 ClinVar
300571 256 ClinVar
300572 275 ClinVar
300573 291 ClinVar
300574 347 ClinVar
300575 407 ClinVar
300576 411 ClinVar
300577 470 ClinVar
300578 484 ClinVar
300579 524 ClinVar
300580 545 ClinVar
878904 711 ClinVar
300581 764 ClinVar
880126 787 ClinVar
300582 810 ClinVar
300583 813 ClinVar
300584 852 ClinVar
300585 856 ClinVar
300586 857 ClinVar
300587 888 ClinVar
877335 901 ClinVar
300588 923 ClinVar
877336 970 ClinVar
300589 982 ClinVar
300590 1007 ClinVar
300591 1010 ClinVar
300592 1043 ClinVar
300593 1054 ClinVar
300594 1089 ClinVar
300595 1089 ClinVar
300596 1091 ClinVar
300597 1092 ClinVar
300598 1102 ClinVar
300599 1131 ClinVar
300600 1185 ClinVar
300601 1186 ClinVar
878951 1213 ClinVar
300602 1245 ClinVar
300603 1257 ClinVar
300604 1279 ClinVar
300605 1315 ClinVar
300606 1362 ClinVar
300607 1371 ClinVar
880171 1386 ClinVar
300608 1400 ClinVar
300609 1405 ClinVar
300610 1426 ClinVar
300611 1427 ClinVar
300612 1448 ClinVar
880172 1454 ClinVar
300613 1464 ClinVar
877391 1497 ClinVar
300614 1537 ClinVar
300615 1585 ClinVar
877392 1609 ClinVar
300616 1622 ClinVar
300617 1665 ClinVar
300618 1699 ClinVar
877393 1727 ClinVar
878414 1763 ClinVar
878415 1812 ClinVar
300619 1824 ClinVar
300620 1845 ClinVar
300621 1889 ClinVar
300622 1900 ClinVar
300623 1961 ClinVar
300624 1978 ClinVar
300625 2027 ClinVar
300626 2127 ClinVar
300627 2164 ClinVar
879006 2171 ClinVar
300628 2179 ClinVar
300629 2227 ClinVar
879007 2258 ClinVar
300630 2350 ClinVar
880223 2350 ClinVar
880224 2353 ClinVar
300631 2392 ClinVar
300632 2423 ClinVar
880225 2465 ClinVar
880226 2485 ClinVar
877447 2536 ClinVar
300633 2593 ClinVar
300634 2657 ClinVar
300635 2661 ClinVar
877448 2718 ClinVar
300636 2719 ClinVar
877449 2729 ClinVar
877450 2811 ClinVar
300637 2827 ClinVar
878471 2831 ClinVar
300638 2843 ClinVar
878472 2846 ClinVar
878473 2857 ClinVar
878474 2870 ClinVar
878475 2896 ClinVar
300639 3023 ClinVar
300640 3040 ClinVar
879058 3041 ClinVar
300641 3054 ClinVar
300642 3091 ClinVar
300643 3132 ClinVar
300644 3168 ClinVar
300645 3246 ClinVar
879059 3273 ClinVar
879060 3302 ClinVar
300646 3307 ClinVar
880277 3341 ClinVar
300647 3385 ClinVar
880278 3392 ClinVar
300648 3446 ClinVar
300649 3478 ClinVar
880279 3543 ClinVar
300650 3556 ClinVar
300651 3566 ClinVar
300652 3572 ClinVar
877495 3634 ClinVar
300653 3667 ClinVar
300654 3701 ClinVar
877496 3707 ClinVar
300655 3786 ClinVar
877497 3812 ClinVar
300656 3858 ClinVar
878522 3878 ClinVar
300657 3885 ClinVar
300658 3891 ClinVar
300659 3906 ClinVar
300660 3933 ClinVar
878523 3962 ClinVar
300661 3988 ClinVar
300662 4050 ClinVar
300663 4096 ClinVar
300664 4108 ClinVar
879107 4109 ClinVar
879108 4157 ClinVar
300665 4163 ClinVar
300666 4211 ClinVar
879109 4266 ClinVar
880321 4301 ClinVar
300667 4337 ClinVar
300668 4342 ClinVar
880322 4360 ClinVar
300669 4410 ClinVar
300670 4422 ClinVar
300671 4433 ClinVar
300672 4451 ClinVar
300673 4496 ClinVar
300674 4499 ClinVar
877542 4524 ClinVar
300675 4534 ClinVar
300676 4535 ClinVar
877543 4557 ClinVar
877544 4581 ClinVar
300677 4610 ClinVar
300678 4629 ClinVar
878567 4634 ClinVar
300679 4771 ClinVar
300680 4786 ClinVar
300681 4821 ClinVar
300682 4822 ClinVar
300683 4866 ClinVar
300684 4870 ClinVar
300685 4885 ClinVar
879162 4887 ClinVar
879163 5027 ClinVar
COSN10072331 257 COSMIC
COSN8719818 452 COSMIC
COSN10072332 625 COSMIC
COSN16411609 650 COSMIC
COSN27028689 780 COSMIC
COSN20638941 990 COSMIC
COSN30162988 1326 COSMIC
COSN28755789 1346 COSMIC
COSN28703487 1362 COSMIC
COSN17896187 1371 COSMIC
COSN30040090 1442 COSMIC
COSN8640457 1542 COSMIC
COSN20919535 1671 COSMIC
COSN1499972 1728 COSMIC
COSN16634573 1956 COSMIC
COSN29994332 2009 COSMIC
COSN15775141 2183 COSMIC
COSN5883132 2482 COSMIC
COSN20548846 2718 COSMIC
COSN1499973 2984 COSMIC
COSN6405555 3219 COSMIC
COSN25702187 4523 COSMIC
COSN19436417 4870 COSMIC
rs4148953 4771 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs995350964 2 dbSNP
rs1446068411 4 dbSNP
rs1213863700 5 dbSNP
rs1254476422 6 dbSNP
rs1452412369 7 dbSNP
rs1249974824 8 dbSNP
rs202242499 8 dbSNP
rs1192737163 10 dbSNP
rs887046205 11 dbSNP
rs750878420 12 dbSNP
rs887689306 14 dbSNP
rs773812968 16 dbSNP
rs1462180997 17 dbSNP
rs1320999930 22 dbSNP
rs766357492 27 dbSNP
rs1020067119 30 dbSNP
rs1440680951 36 dbSNP
rs1308133222 38 dbSNP
rs1338073031 45 dbSNP
rs751506408 46 dbSNP
rs189400876 47 dbSNP
rs868777370 55 dbSNP
rs760264135 58 dbSNP
rs55939908 67 dbSNP
rs955863270 72 dbSNP
rs1409456670 76 dbSNP
rs1298751834 77 dbSNP
rs1375655296 82 dbSNP
rs1409778257 82 dbSNP
rs988412391 83 dbSNP
rs1259087024 87 dbSNP
rs915534658 90 dbSNP
rs1320853590 91 dbSNP
rs946963097 92 dbSNP
rs1488030926 93 dbSNP
rs1246520711 96 dbSNP
rs924850146 99 dbSNP
rs1293694212 103 dbSNP
rs1233550366 120 dbSNP
rs1339555467 124 dbSNP
rs370177361 133 dbSNP
rs1298698322 134 dbSNP
rs1217904009 135 dbSNP
rs980935081 143 dbSNP
rs1232905584 148 dbSNP
rs1481357410 149 dbSNP
rs552909946 154 dbSNP
rs1180591567 165 dbSNP
rs577535813 166 dbSNP
rs182175534 169 dbSNP
rs926774878 171 dbSNP
rs939471862 172 dbSNP
rs1445605642 175 dbSNP
rs557325878 179 dbSNP
rs1185749276 185 dbSNP
rs1056925617 188 dbSNP
rs949097648 193 dbSNP
rs1379653167 197 dbSNP
rs919274246 200 dbSNP
rs929260496 203 dbSNP
rs77359818 204 dbSNP
rs887721794 205 dbSNP
rs1007461568 208 dbSNP
rs931114376 218 dbSNP
rs1463450343 221 dbSNP
rs1038903783 222 dbSNP
rs901647554 225 dbSNP
rs887022056 227 dbSNP
rs1004503007 231 dbSNP
rs1253940609 232 dbSNP
rs1040969706 238 dbSNP
rs543236876 239 dbSNP
rs529477443 243 dbSNP
rs1298749302 249 dbSNP
rs996817175 254 dbSNP
rs114569872 256 dbSNP
rs528575611 257 dbSNP
rs1000319336 259 dbSNP
rs1301317247 262 dbSNP
rs1011693712 269 dbSNP
rs1031837066 270 dbSNP
rs1370961537 271 dbSNP
rs1170308667 273 dbSNP
rs116508900 275 dbSNP
rs968294635 276 dbSNP
rs1227185864 280 dbSNP
rs1425054871 283 dbSNP
rs1024571387 285 dbSNP
rs1199555402 289 dbSNP
rs184330297 291 dbSNP
rs1207483309 297 dbSNP
rs926809095 299 dbSNP
rs980455809 303 dbSNP
rs961127613 304 dbSNP
rs532364295 306 dbSNP
rs926356178 316 dbSNP
rs1251253624 329 dbSNP
rs1254916051 331 dbSNP
rs1462104608 334 dbSNP
rs1246079208 337 dbSNP
rs1342371125 343 dbSNP
rs76094341 347 dbSNP
rs929392077 348 dbSNP
rs1246520207 349 dbSNP
rs1049112513 352 dbSNP
rs1310079833 354 dbSNP
rs909186730 355 dbSNP
rs1421997172 370 dbSNP
rs908332779 387 dbSNP
rs377661663 388 dbSNP
rs943280379 392 dbSNP
rs138805155 398 dbSNP
rs80210009 407 dbSNP
rs886047160 411 dbSNP
rs901119434 413 dbSNP
rs932637580 414 dbSNP
rs1253615256 422 dbSNP
rs548752382 424 dbSNP
rs567149313 445 dbSNP
rs997797619 452 dbSNP
rs1250205250 467 dbSNP
rs1049758062 469 dbSNP
rs539699501 470 dbSNP
rs1264170335 471 dbSNP
rs756243565 472 dbSNP
rs1329917793 476 dbSNP
rs113283291 484 dbSNP
rs1021264806 488 dbSNP
rs1334983402 497 dbSNP
rs1323915075 499 dbSNP
rs1388276609 500 dbSNP
rs969668452 501 dbSNP
rs75166049 503 dbSNP
rs1164127656 512 dbSNP
rs1429848459 512 dbSNP
rs1457319675 513 dbSNP
rs189173490 524 dbSNP
rs1156542235 525 dbSNP
rs755132369 528 dbSNP
rs1024959248 535 dbSNP
rs1033854823 540 dbSNP
rs779143325 541 dbSNP
rs886047161 545 dbSNP
rs1265951718 547 dbSNP
rs748488009 549 dbSNP
rs1465405458 551 dbSNP
rs1323649435 554 dbSNP
rs919413267 559 dbSNP
rs1033310819 561 dbSNP
rs181113786 562 dbSNP
rs141983962 591 dbSNP
rs1478363466 595 dbSNP
rs1275632962 599 dbSNP
rs908300070 600 dbSNP
rs939838162 601 dbSNP
rs772495684 613 dbSNP
rs976638149 621 dbSNP
rs575995648 624 dbSNP
rs576289588 625 dbSNP
rs1487606866 627 dbSNP
rs185445266 634 dbSNP
rs1425511542 637 dbSNP
rs1430052229 640 dbSNP
rs1479216496 642 dbSNP
rs1376216564 643 dbSNP
rs747508995 647 dbSNP
rs1450588614 650 dbSNP
rs1250425572 654 dbSNP
rs1206952578 655 dbSNP
rs1446499484 655 dbSNP
rs904507149 662 dbSNP
rs1481483359 666 dbSNP
rs923215765 668 dbSNP
rs933240446 669 dbSNP
rs573442020 677 dbSNP
rs1342645173 678 dbSNP
rs1302349577 679 dbSNP
rs1228836190 681 dbSNP
rs1178496214 691 dbSNP
rs1192996825 693 dbSNP
rs1367316114 698 dbSNP
rs1409740449 699 dbSNP
rs371743246 710 dbSNP
rs190298233 711 dbSNP
rs1335785883 718 dbSNP
rs1412361508 719 dbSNP
rs1374052860 724 dbSNP
rs1173461637 725 dbSNP
rs1042756804 726 dbSNP
rs1392644197 729 dbSNP
rs905540114 739 dbSNP
rs891901060 748 dbSNP
rs4148941 764 dbSNP
rs115478548 777 dbSNP
rs544271000 780 dbSNP
rs1189900355 786 dbSNP
rs906037991 787 dbSNP
rs1001748011 791 dbSNP
rs896753072 798 dbSNP
rs145689465 810 dbSNP
rs376451731 811 dbSNP
rs1224886213 812 dbSNP
rs886047162 813 dbSNP
rs1308260704 824 dbSNP
rs769354491 828 dbSNP
rs1372740023 831 dbSNP
rs1168963635 842 dbSNP
rs1286983079 845 dbSNP
rs530690554 847 dbSNP
rs886047163 852 dbSNP
rs181471425 856 dbSNP
rs186004202 857 dbSNP
rs1221073447 859 dbSNP
rs1483916284 864 dbSNP
rs974769911 871 dbSNP
rs1230924280 878 dbSNP
rs528231677 882 dbSNP
rs1322309476 883 dbSNP
rs555113303 888 dbSNP
rs961193494 891 dbSNP
rs1333510984 894 dbSNP
rs976985247 900 dbSNP
rs1411209674 904 dbSNP
rs1352735373 910 dbSNP
rs1296854640 914 dbSNP
rs1468410703 920 dbSNP
rs933251454 921 dbSNP
rs886047164 923 dbSNP
rs759237893 936 dbSNP
rs372105435 938 dbSNP
rs913066150 942 dbSNP
rs947185520 946 dbSNP
rs953897067 947 dbSNP
rs1417171293 949 dbSNP
rs1159096158 960 dbSNP
rs571247438 970 dbSNP
rs573670057 982 dbSNP
rs1406036629 987 dbSNP
rs905656258 990 dbSNP
rs925899239 991 dbSNP
rs116018996 1007 dbSNP
rs190763138 1010 dbSNP
rs1229669170 1011 dbSNP
rs913298416 1015 dbSNP
rs34158877 1023 dbSNP
rs568843394 1031 dbSNP
rs1368675909 1036 dbSNP
rs1295805309 1042 dbSNP
rs886047165 1043 dbSNP
rs1393862593 1044 dbSNP
rs895452223 1051 dbSNP
rs886047166 1054 dbSNP
rs1458861412 1056 dbSNP
rs1014260218 1064 dbSNP
rs906007154 1068 dbSNP
rs536272249 1074 dbSNP
rs1001717157 1082 dbSNP
rs115617050 1089 dbSNP
rs1453770126 1090 dbSNP
rs148125052 1091 dbSNP
rs886047167 1092 dbSNP
rs116999241 1102 dbSNP
rs964815410 1106 dbSNP
rs1259797508 1107 dbSNP
rs1210299926 1111 dbSNP
rs1313185467 1115 dbSNP
rs997908276 1122 dbSNP
rs577247765 1130 dbSNP
rs4148942 1131 dbSNP
rs954701706 1145 dbSNP
rs1437445235 1146 dbSNP
rs1382811713 1147 dbSNP
rs1288519503 1149 dbSNP
rs755041484 1149 dbSNP
rs1466712827 1151 dbSNP
rs1360709806 1152 dbSNP
rs985281879 1154 dbSNP
rs925868127 1155 dbSNP
rs34828900 1156 dbSNP
rs989141637 1156 dbSNP
rs4747236 1157 dbSNP
rs1166384763 1159 dbSNP
rs1182107637 1160 dbSNP
rs765379561 1162 dbSNP
rs1395108706 1166 dbSNP
rs1277712843 1174 dbSNP
rs1045788383 1179 dbSNP
rs1209265336 1179 dbSNP
rs1275994185 1179 dbSNP
rs1230181891 1182 dbSNP
rs1324797545 1183 dbSNP
rs927390810 1184 dbSNP
rs187692473 1185 dbSNP
rs373515105 1186 dbSNP
rs1170445160 1188 dbSNP
rs756598951 1201 dbSNP
rs560847494 1202 dbSNP
rs937102794 1204 dbSNP
rs866928391 1213 dbSNP
rs1385463002 1214 dbSNP
rs1226428958 1215 dbSNP
rs998286732 1219 dbSNP
rs1269869524 1228 dbSNP
rs1485553867 1231 dbSNP
rs1029347183 1234 dbSNP
rs1197684184 1240 dbSNP
rs886047168 1245 dbSNP
rs1338076457 1251 dbSNP
rs889570871 1254 dbSNP
rs886047169 1257 dbSNP
rs1006670007 1261 dbSNP
rs758894650 1265 dbSNP
rs528427679 1267 dbSNP
rs916903244 1270 dbSNP
rs778280355 1277 dbSNP
rs1232850342 1278 dbSNP
rs4148943 1279 dbSNP
rs1202987656 1290 dbSNP
rs1330691008 1291 dbSNP
rs886719426 1300 dbSNP
rs1006461774 1301 dbSNP
rs1037893512 1307 dbSNP
rs1372207795 1311 dbSNP
rs4148944 1315 dbSNP
rs996673640 1320 dbSNP
rs937443692 1326 dbSNP
rs544195789 1327 dbSNP
rs1436431462 1331 dbSNP
rs1030379309 1332 dbSNP
rs1250443321 1334 dbSNP
rs1210902268 1336 dbSNP
rs201456562 1346 dbSNP
rs1469896618 1347 dbSNP
rs984883743 1354 dbSNP
rs4148945 1362 dbSNP
rs372345396 1368 dbSNP
rs60924680 1371 dbSNP
rs1281475775 1378 dbSNP
rs1236698249 1382 dbSNP
rs535090592 1386 dbSNP
rs757821498 1386 dbSNP
rs1442946091 1387 dbSNP
rs1391686449 1389 dbSNP
rs902114662 1396 dbSNP
rs933667281 1397 dbSNP
rs1020693097 1398 dbSNP
rs562405951 1400 dbSNP
rs886047170 1405 dbSNP
rs1455998294 1413 dbSNP
rs80269486 1426 dbSNP
rs76062174 1427 dbSNP
rs927134523 1432 dbSNP
rs76808415 1448 dbSNP
rs993066875 1451 dbSNP
rs1349714479 1458 dbSNP
rs1322988673 1460 dbSNP
rs534540774 1463 dbSNP
rs529839491 1464 dbSNP
rs1462478146 1467 dbSNP
rs1020183023 1472 dbSNP
rs971760727 1474 dbSNP
rs981435017 1478 dbSNP
rs1315814967 1480 dbSNP
rs577339997 1487 dbSNP
rs775020468 1491 dbSNP
rs1402434427 1495 dbSNP
rs538070743 1497 dbSNP
rs556197350 1499 dbSNP
rs958699475 1501 dbSNP
rs909525435 1502 dbSNP
rs745509297 1504 dbSNP
rs1243867664 1506 dbSNP
rs1191340154 1511 dbSNP
rs942273374 1514 dbSNP
rs1279569391 1522 dbSNP
rs150772968 1523 dbSNP
rs766100098 1529 dbSNP
rs900676230 1529 dbSNP
rs996400319 1530 dbSNP
rs376062544 1537 dbSNP
rs890574833 1540 dbSNP
rs1340904421 1550 dbSNP
rs1010712162 1554 dbSNP
rs1429386337 1557 dbSNP
rs1020253797 1562 dbSNP
rs968654050 1570 dbSNP
rs1314326204 1580 dbSNP
rs886047171 1585 dbSNP
rs1000070713 1600 dbSNP
rs1034268546 1601 dbSNP
rs200563439 1609 dbSNP
rs748964958 1611 dbSNP
rs1410976307 1612 dbSNP
rs1050639056 1614 dbSNP
rs1166274922 1621 dbSNP
rs768478124 1622 dbSNP
rs1386165648 1625 dbSNP
rs1024540376 1632 dbSNP
rs942382770 1642 dbSNP
rs951182178 1643 dbSNP
rs982911402 1648 dbSNP
rs909557877 1660 dbSNP
rs375960396 1665 dbSNP
rs1273031919 1673 dbSNP
rs975074216 1675 dbSNP
rs1405688267 1677 dbSNP
rs1285288985 1680 dbSNP
rs922215542 1694 dbSNP
rs377338550 1699 dbSNP
rs1051963605 1703 dbSNP
rs1231021936 1707 dbSNP
rs1236830939 1711 dbSNP
rs890588228 1714 dbSNP
rs1443355116 1719 dbSNP
rs1351194252 1722 dbSNP
rs573032793 1727 dbSNP
rs540492052 1728 dbSNP
rs1452724349 1733 dbSNP
rs1409470329 1744 dbSNP
rs1223795488 1756 dbSNP
rs1418608063 1758 dbSNP
rs904611949 1760 dbSNP
rs547917558 1763 dbSNP
rs1010062444 1769 dbSNP
rs1270413342 1782 dbSNP
rs1177630203 1786 dbSNP
rs1481490898 1787 dbSNP
rs1231109237 1790 dbSNP
rs1417806715 1804 dbSNP
rs1034299518 1806 dbSNP
rs532295455 1807 dbSNP
rs894415519 1812 dbSNP
rs1455739344 1817 dbSNP
rs1002755902 1819 dbSNP
rs116289781 1824 dbSNP
rs958669808 1826 dbSNP
rs562569141 1827 dbSNP
rs1442066185 1839 dbSNP
rs1395822092 1841 dbSNP
rs4148946 1845 dbSNP
rs796258189 1853 dbSNP
rs1016344128 1857 dbSNP
rs1160020597 1869 dbSNP
rs1420666717 1876 dbSNP
rs1348734218 1879 dbSNP
rs1389580386 1880 dbSNP
rs982532545 1887 dbSNP
rs4148947 1889 dbSNP
rs962447329 1890 dbSNP
rs975106910 1899 dbSNP
rs17297481 1900 dbSNP
rs1467633868 1901 dbSNP
rs1260947942 1905 dbSNP
rs932263136 1924 dbSNP
rs747954035 1925 dbSNP
rs1222807933 1929 dbSNP
rs954888795 1931 dbSNP
rs988092420 1932 dbSNP
rs986323457 1943 dbSNP
rs765343233 1946 dbSNP
rs375471257 1956 dbSNP
rs1438808702 1959 dbSNP
rs1293297757 1960 dbSNP
rs886047172 1961 dbSNP
rs1479396772 1967 dbSNP
rs1343623282 1972 dbSNP
rs150678709 1978 dbSNP
rs886047173 1978 dbSNP
rs946244862 1978 dbSNP
rs1435087541 1988 dbSNP
rs190743499 1990 dbSNP
rs1251947281 2003 dbSNP
rs868455258 2005 dbSNP
rs1421412493 2006 dbSNP
rs1261769976 2020 dbSNP
rs1182060251 2025 dbSNP
rs115545740 2027 dbSNP
rs936069575 2031 dbSNP
rs1055740670 2034 dbSNP
rs552802132 2040 dbSNP
rs894438792 2041 dbSNP
rs1348966173 2045 dbSNP
rs1425485755 2067 dbSNP
rs1283105736 2072 dbSNP
rs1014179829 2079 dbSNP
rs1165758772 2081 dbSNP
rs1024604440 2087 dbSNP
rs1232678744 2091 dbSNP
rs571067004 2094 dbSNP
rs781781479 2098 dbSNP
rs867431158 2104 dbSNP
rs1054562913 2108 dbSNP
rs370007674 2113 dbSNP
rs1297524405 2114 dbSNP
rs945745991 2115 dbSNP
rs1041474641 2118 dbSNP
rs1288503214 2118 dbSNP
rs1415170035 2118 dbSNP
rs906998991 2122 dbSNP
rs887028975 2126 dbSNP
rs7072219 2127 dbSNP
rs1246222822 2132 dbSNP
rs1188151046 2145 dbSNP
rs1486216691 2154 dbSNP
rs374374308 2157 dbSNP
rs373466814 2158 dbSNP
rs796353800 2158 dbSNP
rs1209135996 2162 dbSNP
rs1016641500 2163 dbSNP
rs114563668 2164 dbSNP
rs1030435051 2165 dbSNP
rs112797457 2166 dbSNP
rs79099269 2171 dbSNP
rs886047174 2179 dbSNP
rs1310900061 2182 dbSNP
rs1413931311 2187 dbSNP
rs1397209842 2194 dbSNP
rs986290512 2196 dbSNP
rs996576574 2198 dbSNP
rs1194743134 2206 dbSNP
rs1027994851 2211 dbSNP
rs958321339 2215 dbSNP
rs1476006347 2216 dbSNP
rs1242897289 2225 dbSNP
rs886047175 2227 dbSNP
rs989750440 2238 dbSNP
rs1251869887 2241 dbSNP
rs986479419 2242 dbSNP
rs1445659343 2254 dbSNP
rs914187814 2255 dbSNP
rs758665372 2258 dbSNP
rs967590009 2259 dbSNP
rs977581632 2263 dbSNP
rs977549387 2268 dbSNP
rs553996914 2269 dbSNP
rs572373662 2270 dbSNP
rs936100961 2291 dbSNP
rs545890316 2296 dbSNP
rs1309090544 2300 dbSNP
rs1417708531 2301 dbSNP
rs1389565849 2307 dbSNP
rs938489974 2308 dbSNP
rs915917888 2312 dbSNP
rs1055677426 2313 dbSNP
rs1462546095 2326 dbSNP
rs1391913665 2333 dbSNP
rs1163672461 2334 dbSNP
rs1428152234 2339 dbSNP
rs894318182 2344 dbSNP
rs1171139854 2347 dbSNP
rs1184392524 2347 dbSNP
rs950134386 2348 dbSNP
rs1194425199 2349 dbSNP
rs4148948 2350 dbSNP
rs544408735 2353 dbSNP
rs1004116416 2354 dbSNP
rs1038230857 2358 dbSNP
rs1442465081 2359 dbSNP
rs898295428 2360 dbSNP
rs1382395630 2367 dbSNP
rs373943788 2367 dbSNP
rs548034889 2367 dbSNP
rs1386659798 2370 dbSNP
rs1453184162 2373 dbSNP
rs996599099 2379 dbSNP
rs1418254099 2380 dbSNP
rs1380235280 2381 dbSNP
rs1174752805 2387 dbSNP
rs1455657886 2388 dbSNP
rs116391584 2392 dbSNP
rs955142461 2396 dbSNP
rs1213660976 2407 dbSNP
rs1447848686 2418 dbSNP
rs1264104829 2419 dbSNP
rs4148949 2423 dbSNP
rs781556316 2425 dbSNP
rs1017687348 2443 dbSNP
rs1400142721 2444 dbSNP
rs1222186738 2446 dbSNP
rs1263132849 2450 dbSNP
rs117578356 2465 dbSNP
rs1315709254 2467 dbSNP
rs990108606 2468 dbSNP
rs183032812 2469 dbSNP
rs1240720890 2474 dbSNP
rs1437168394 2498 dbSNP
rs1423655565 2506 dbSNP
rs879744796 2508 dbSNP
rs139186201 2511 dbSNP
rs1485640247 2513 dbSNP
rs1172122511 2515 dbSNP
rs1475780104 2522 dbSNP
rs957495780 2524 dbSNP
rs991671222 2528 dbSNP
rs916015046 2532 dbSNP
rs746330162 2536 dbSNP
rs977140771 2544 dbSNP
rs527242888 2547 dbSNP
rs1421710101 2551 dbSNP
rs187078225 2561 dbSNP
rs779081972 2562 dbSNP
rs571119719 2569 dbSNP
rs938374261 2573 dbSNP
rs1479537900 2574 dbSNP
rs1214655799 2575 dbSNP
rs1299591097 2583 dbSNP
rs991246419 2585 dbSNP
rs908522906 2589 dbSNP
rs915719326 2591 dbSNP
rs191889682 2592 dbSNP
rs886047176 2593 dbSNP
rs1355664408 2595 dbSNP
rs1038252711 2597 dbSNP
rs941893093 2621 dbSNP
rs1428448528 2630 dbSNP
rs1357994748 2640 dbSNP
rs531918105 2645 dbSNP
rs1038004520 2654 dbSNP
rs886047177 2657 dbSNP
rs143743853 2661 dbSNP
rs929289924 2662 dbSNP
rs755645339 2670 dbSNP
rs1477639697 2671 dbSNP
rs768431224 2681 dbSNP
rs1189889970 2686 dbSNP
rs1049567104 2687 dbSNP
rs890458768 2698 dbSNP
rs1205074636 2703 dbSNP
rs1439076241 2708 dbSNP
rs890893894 2713 dbSNP
rs555301573 2718 dbSNP
rs115489836 2719 dbSNP
rs371988923 2726 dbSNP
rs1282105404 2729 dbSNP
rs748988264 2730 dbSNP
rs1377354848 2734 dbSNP
rs999065896 2736 dbSNP
rs1021609861 2737 dbSNP
rs1033264754 2738 dbSNP
rs1338015939 2743 dbSNP
rs147227559 2744 dbSNP
rs1465167010 2745 dbSNP
rs1395502987 2756 dbSNP
rs554201020 2768 dbSNP
rs967028862 2780 dbSNP
rs1412751620 2785 dbSNP
rs982775712 2786 dbSNP
rs1216770188 2791 dbSNP
rs1471148138 2796 dbSNP
rs1035322851 2804 dbSNP
rs1177537491 2806 dbSNP
rs566046898 2809 dbSNP
rs1468483921 2812 dbSNP
rs1274677067 2815 dbSNP
rs1023116442 2817 dbSNP
rs1244116059 2818 dbSNP
rs971909460 2822 dbSNP
rs768318754 2823 dbSNP
rs1224661535 2825 dbSNP
rs114457501 2827 dbSNP
rs1307629116 2827 dbSNP
rs773949378 2828 dbSNP
rs1198705764 2830 dbSNP
rs940040640 2831 dbSNP
rs974060429 2833 dbSNP
rs1480694711 2835 dbSNP
rs919869114 2837 dbSNP
rs140272473 2841 dbSNP
rs886047178 2843 dbSNP
rs932565615 2846 dbSNP
rs1050042966 2850 dbSNP
rs1402228370 2852 dbSNP
rs577193207 2854 dbSNP
rs890933998 2855 dbSNP
rs144248670 2856 dbSNP
rs747937392 2857 dbSNP
rs771840365 2867 dbSNP
rs556516377 2870 dbSNP
rs1422365966 2871 dbSNP
rs1242322878 2895 dbSNP
rs1000522642 2896 dbSNP
rs1345615772 2898 dbSNP
rs182900996 2899 dbSNP
rs893414790 2900 dbSNP
rs1240011153 2910 dbSNP
rs943390469 2912 dbSNP
rs1039075430 2913 dbSNP
rs893918063 2927 dbSNP
rs1367252894 2930 dbSNP
rs1013146677 2937 dbSNP
rs1432652629 2944 dbSNP
rs1358336935 2945 dbSNP
rs1023570647 2952 dbSNP
rs542056241 2957 dbSNP
rs560145890 2958 dbSNP
rs1042524555 2967 dbSNP
rs1173412055 2969 dbSNP
rs573559460 2975 dbSNP
rs902691502 2984 dbSNP
rs1224631004 2988 dbSNP
rs1187860890 2992 dbSNP
rs1288614172 3004 dbSNP
rs1261531655 3006 dbSNP
rs1216316785 3011 dbSNP
rs982011982 3012 dbSNP
rs572091260 3020 dbSNP
rs1035291799 3022 dbSNP
rs145507314 3023 dbSNP
rs563954537 3026 dbSNP
rs974091740 3028 dbSNP
rs1292561706 3037 dbSNP
rs74145519 3040 dbSNP
rs550027128 3041 dbSNP
rs932573838 3052 dbSNP
rs12172746 3054 dbSNP
rs912387007 3057 dbSNP
rs769807215 3065 dbSNP
rs1381973682 3074 dbSNP
rs943926044 3076 dbSNP
rs950620753 3083 dbSNP
rs529402579 3088 dbSNP
rs1042195597 3089 dbSNP
rs76750860 3091 dbSNP
rs1365623843 3094 dbSNP
rs911831901 3099 dbSNP
rs1406660409 3104 dbSNP
rs868390331 3105 dbSNP
rs1422455915 3110 dbSNP
rs1193482374 3111 dbSNP
rs1039042493 3113 dbSNP
rs1258886439 3114 dbSNP
rs1354398677 3118 dbSNP
rs915232825 3120 dbSNP
rs1252006939 3128 dbSNP
rs187587634 3130 dbSNP
rs1200577221 3131 dbSNP
rs577353046 3132 dbSNP
rs763081087 3134 dbSNP
rs902658685 3145 dbSNP
rs1341994177 3147 dbSNP
rs1310528895 3148 dbSNP
rs1003738314 3156 dbSNP
rs1381106337 3158 dbSNP
rs764442442 3160 dbSNP
rs1463603326 3162 dbSNP
rs886047179 3168 dbSNP
rs1013596149 3170 dbSNP
rs566156519 3171 dbSNP
rs751765701 3179 dbSNP
rs1462314405 3193 dbSNP
rs1245481756 3195 dbSNP
rs1316079630 3205 dbSNP
rs1423793909 3225 dbSNP
rs1044689463 3229 dbSNP
rs895434732 3245 dbSNP
rs545967470 3246 dbSNP
rs1022589622 3257 dbSNP
rs762284234 3258 dbSNP
rs1237827167 3259 dbSNP
rs963381667 3263 dbSNP
rs1358700589 3267 dbSNP
rs539580815 3273 dbSNP
rs1243784616 3274 dbSNP
rs148431635 3293 dbSNP
rs1199213572 3294 dbSNP
rs75962504 3302 dbSNP
rs1375450613 3304 dbSNP
rs12250549 3307 dbSNP
rs1388188749 3309 dbSNP
rs1388099324 3326 dbSNP
rs1161888437 3333 dbSNP
rs1018806913 3341 dbSNP
rs964636198 3352 dbSNP
rs1160925811 3353 dbSNP
rs1437939632 3354 dbSNP
rs548082422 3359 dbSNP
rs1194313945 3361 dbSNP
rs193204538 3368 dbSNP
rs1165614747 3379 dbSNP
rs1265535021 3382 dbSNP
rs886047180 3385 dbSNP
rs564572994 3392 dbSNP
rs1486040351 3393 dbSNP
rs1288102648 3397 dbSNP
rs1237815662 3399 dbSNP
rs1352852508 3400 dbSNP
rs1410996965 3401 dbSNP
rs556456859 3408 dbSNP
rs1234766576 3409 dbSNP
rs1329061410 3424 dbSNP
rs1026994719 3431 dbSNP
rs1322390418 3435 dbSNP
rs915219359 3441 dbSNP
rs185581202 3446 dbSNP
rs1404360339 3455 dbSNP
rs535635080 3458 dbSNP
rs1380213235 3464 dbSNP
rs1378435403 3471 dbSNP
rs912515040 3475 dbSNP
rs4148950 3478 dbSNP
rs977919703 3492 dbSNP
rs1376147640 3494 dbSNP
rs923753679 3495 dbSNP
rs936439231 3496 dbSNP
rs1214145402 3501 dbSNP
rs1340204292 3503 dbSNP
rs1039038870 3508 dbSNP
rs867241517 3509 dbSNP
rs916237078 3510 dbSNP
rs142898283 3519 dbSNP
rs1342185490 3530 dbSNP
rs1273899886 3532 dbSNP
rs758010524 3535 dbSNP
rs572087281 3539 dbSNP
rs1280555895 3540 dbSNP
rs1398542647 3544 dbSNP
rs1360460257 3555 dbSNP
rs4148951 3556 dbSNP
rs1026049345 3558 dbSNP
rs151095465 3566 dbSNP
rs886221194 3568 dbSNP
rs1008680658 3571 dbSNP
rs575592721 3572 dbSNP
rs375252560 3574 dbSNP
rs964529359 3583 dbSNP
rs974666065 3598 dbSNP
rs1258152697 3599 dbSNP
rs1477901164 3603 dbSNP
rs1173442838 3604 dbSNP
rs778546338 3607 dbSNP
rs1427740955 3617 dbSNP
rs1440598626 3620 dbSNP
rs1277363955 3621 dbSNP
rs1319643192 3622 dbSNP
rs897293535 3633 dbSNP
rs1217202862 3635 dbSNP
rs995593054 3638 dbSNP
rs1469741835 3647 dbSNP
rs1285337837 3660 dbSNP
rs1450861637 3661 dbSNP
rs1333655865 3662 dbSNP
rs543019822 3662 dbSNP
rs562043425 3665 dbSNP
rs1410947570 3666 dbSNP
rs113342172 3667 dbSNP
rs978533403 3671 dbSNP
rs1464927535 3674 dbSNP
rs547957018 3698 dbSNP
rs1164761399 3701 dbSNP
rs200054447 3701 dbSNP
rs1471803578 3707 dbSNP
rs1178723683 3714 dbSNP
rs992251955 3714 dbSNP
rs1020016495 3722 dbSNP
rs1236008502 3724 dbSNP
rs771825826 3726 dbSNP
rs1197577709 3733 dbSNP
rs1335039500 3734 dbSNP
rs1291097246 3735 dbSNP
rs559723580 3739 dbSNP
rs965343854 3746 dbSNP
rs1230370457 3747 dbSNP
rs533593409 3757 dbSNP
rs1354941087 3759 dbSNP
rs1284052167 3763 dbSNP
rs948218836 3781 dbSNP
rs1447627352 3785 dbSNP
rs1871450 3786 dbSNP
rs1350674672 3787 dbSNP
rs1325358489 3794 dbSNP
rs570170171 3805 dbSNP
rs989263395 3812 dbSNP
rs916359596 3813 dbSNP
rs1321288805 3814 dbSNP
rs1441038735 3830 dbSNP
rs1377994865 3832 dbSNP
rs1047887547 3834 dbSNP
rs1488634956 3848 dbSNP
rs1248084808 3853 dbSNP
rs1224238740 3855 dbSNP
rs886106839 3857 dbSNP
rs537395654 3858 dbSNP
rs1241454505 3862 dbSNP
rs1356427237 3864 dbSNP
rs1040120270 3871 dbSNP
rs1239514405 3874 dbSNP
rs981816953 3875 dbSNP
rs879678320 3881 dbSNP
rs77908871 3885 dbSNP
rs1203001837 3886 dbSNP
rs79559408 3891 dbSNP
rs79037746 3892 dbSNP
rs897409241 3899 dbSNP
rs554057920 3900 dbSNP
rs931503340 3902 dbSNP
rs968410840 3905 dbSNP
rs886047181 3906 dbSNP
rs565702750 3907 dbSNP
rs999452166 3908 dbSNP
rs889901167 3914 dbSNP
rs1284419920 3918 dbSNP
rs539630621 3921 dbSNP
rs190807630 3927 dbSNP
rs1379698418 3932 dbSNP
rs1871451 3933 dbSNP
rs1303723673 3934 dbSNP
rs1019626471 3935 dbSNP
rs1158194636 3942 dbSNP
rs901149711 3944 dbSNP
rs776674536 3948 dbSNP
rs1401611022 3956 dbSNP
rs1421789123 3957 dbSNP
rs1301321687 3965 dbSNP
rs1297438786 3974 dbSNP
rs1466124705 3987 dbSNP
rs56218110 3988 dbSNP
rs1173301863 3994 dbSNP
rs974678715 4007 dbSNP
rs1194854537 4010 dbSNP
rs1301978016 4026 dbSNP
rs1261688752 4033 dbSNP
rs1030918521 4045 dbSNP
rs1186407751 4046 dbSNP
rs1483848664 4047 dbSNP
rs192320139 4050 dbSNP
rs1236542443 4060 dbSNP
rs1259930466 4076 dbSNP
rs1047325656 4077 dbSNP
rs1220247122 4078 dbSNP
rs1338088673 4079 dbSNP
rs907527064 4084 dbSNP
rs1396575430 4089 dbSNP
rs1381225089 4090 dbSNP
rs1300639221 4093 dbSNP
rs1446564262 4094 dbSNP
rs114800040 4096 dbSNP
rs731027 4108 dbSNP
rs541333726 4113 dbSNP
rs969176837 4119 dbSNP
rs1490053905 4126 dbSNP
rs1170165662 4127 dbSNP
rs1424960919 4129 dbSNP
rs1210950928 4139 dbSNP
rs982233347 4141 dbSNP
rs1180194730 4144 dbSNP
rs1417865591 4146 dbSNP
rs1460879406 4152 dbSNP
rs1043911531 4155 dbSNP
rs927653766 4156 dbSNP
rs774773819 4157 dbSNP
rs551591119 4163 dbSNP
rs971715442 4164 dbSNP
rs999820179 4168 dbSNP
rs1161946951 4180 dbSNP
rs1323438445 4186 dbSNP
rs1310421105 4190 dbSNP
rs1244633810 4191 dbSNP
rs1365035826 4193 dbSNP
rs1030941079 4210 dbSNP
rs559945769 4211 dbSNP
rs931535867 4215 dbSNP
rs1013619613 4216 dbSNP
rs1298028783 4217 dbSNP
rs1458669438 4218 dbSNP
rs1370713936 4221 dbSNP
rs1163228537 4236 dbSNP
rs1444116705 4238 dbSNP
rs1295378532 4242 dbSNP
rs1392712112 4252 dbSNP
rs1023715700 4268 dbSNP
rs1250004299 4276 dbSNP
rs1048575341 4277 dbSNP
rs1489313083 4283 dbSNP
rs527566536 4292 dbSNP
rs889924359 4298 dbSNP
rs767819169 4300 dbSNP
rs141062797 4301 dbSNP
rs1312547309 4309 dbSNP
rs1237323878 4314 dbSNP
rs1334804869 4315 dbSNP
rs1301459313 4318 dbSNP
rs1387730042 4319 dbSNP
rs1393272361 4320 dbSNP
rs951599027 4329 dbSNP
rs901265799 4330 dbSNP
rs569758444 4337 dbSNP
rs1030939823 4339 dbSNP
rs12267478 4342 dbSNP
rs563768501 4346 dbSNP
rs1479917823 4347 dbSNP
rs1437844380 4352 dbSNP
rs1363462877 4353 dbSNP
rs1199805417 4356 dbSNP
rs145151652 4360 dbSNP
rs549381802 4364 dbSNP
rs1459427016 4369 dbSNP
rs1221449459 4376 dbSNP
rs1488617203 4387 dbSNP
rs1287985946 4389 dbSNP
rs981964141 4391 dbSNP
rs921617286 4397 dbSNP
rs1034801537 4398 dbSNP
rs961772188 4399 dbSNP
rs931690788 4408 dbSNP
rs754282055 4410 dbSNP
rs920228511 4415 dbSNP
rs730722 4422 dbSNP
rs984739021 4427 dbSNP
rs1871452 4433 dbSNP
rs1460379688 4436 dbSNP
rs1384402738 4441 dbSNP
rs183731077 4451 dbSNP
rs1041212479 4457 dbSNP
rs905199161 4458 dbSNP
rs995975214 4461 dbSNP
rs868839699 4465 dbSNP
rs935392270 4475 dbSNP
rs1448792970 4477 dbSNP
rs1419704605 4478 dbSNP
rs1052406796 4481 dbSNP
rs1334459067 4482 dbSNP
rs1191363739 4486 dbSNP
rs730721 4496 dbSNP
rs552578786 4499 dbSNP
rs373819316 4502 dbSNP
rs577316113 4504 dbSNP
rs146892467 4509 dbSNP
rs781292981 4510 dbSNP
rs557575337 4514 dbSNP
rs1318990235 4521 dbSNP
rs1280459396 4524 dbSNP
rs921567702 4525 dbSNP
rs377159423 4530 dbSNP
rs1326348297 4531 dbSNP
rs730720 4534 dbSNP
rs372116465 4535 dbSNP
rs1404196979 4540 dbSNP
rs1027325252 4546 dbSNP
rs567109960 4556 dbSNP
rs745789120 4557 dbSNP
rs1165915526 4559 dbSNP
rs1242954973 4571 dbSNP
rs935143785 4580 dbSNP
rs1237981753 4581 dbSNP
rs1189023784 4585 dbSNP
rs1440148378 4597 dbSNP
rs1242180575 4601 dbSNP
rs1052303641 4605 dbSNP
rs896319999 4608 dbSNP
rs985804550 4609 dbSNP
rs552018988 4610 dbSNP
rs964317644 4611 dbSNP
rs977340062 4615 dbSNP
rs886047182 4629 dbSNP
rs117714459 4634 dbSNP
rs1424179521 4636 dbSNP
rs1447853923 4638 dbSNP
rs935422016 4640 dbSNP
rs1326682515 4642 dbSNP
rs570437253 4660 dbSNP
rs1052437897 4667 dbSNP
rs1409087120 4677 dbSNP
rs1414461728 4678 dbSNP
rs1027479231 4680 dbSNP
rs576566488 4684 dbSNP
rs536244971 4685 dbSNP
rs1173936486 4687 dbSNP
rs887240834 4699 dbSNP
rs915320263 4702 dbSNP
rs1448261205 4706 dbSNP
rs1304296746 4712 dbSNP
rs546571410 4713 dbSNP
rs1045055446 4716 dbSNP
rs1028596918 4717 dbSNP
rs953148542 4728 dbSNP
rs1357894576 4729 dbSNP
rs1314527407 4738 dbSNP
rs1240958941 4742 dbSNP
rs1379400294 4743 dbSNP
rs553340600 4744 dbSNP
rs1441248155 4745 dbSNP
rs1350295362 4755 dbSNP
rs1325257879 4756 dbSNP
rs1422732295 4759 dbSNP
rs925019419 4762 dbSNP
rs935026470 4770 dbSNP
rs4148953 4771 dbSNP
rs1405377081 4776 dbSNP
rs917725856 4779 dbSNP
rs1478131836 4780 dbSNP
rs1313190848 4785 dbSNP
rs12418 4786 dbSNP
rs1202020256 4790 dbSNP
rs1259243789 4791 dbSNP
rs897621770 4792 dbSNP
rs993252591 4793 dbSNP
rs1217452272 4797 dbSNP
rs1045374186 4800 dbSNP
rs563904964 4808 dbSNP
rs1368560027 4812 dbSNP
rs1276468138 4813 dbSNP
rs1402802761 4814 dbSNP
rs1344822217 4819 dbSNP
rs886047183 4821 dbSNP
rs886047184 4822 dbSNP
rs368751252 4828 dbSNP
rs543111115 4837 dbSNP
rs1007658723 4840 dbSNP
rs772369812 4847 dbSNP
rs1414884827 4848 dbSNP
rs1426821929 4850 dbSNP
rs558360909 4856 dbSNP
rs1179034561 4857 dbSNP
rs140500823 4866 dbSNP
rs1268825888 4867 dbSNP
rs1041129911 4869 dbSNP
rs773240688 4870 dbSNP
rs1029794928 4874 dbSNP
rs1313005145 4876 dbSNP
rs886047185 4885 dbSNP
rs761110067 4887 dbSNP
rs1401818587 4890 dbSNP
rs1359762652 4897 dbSNP
rs1031970427 4901 dbSNP
rs1448036669 4904 dbSNP
rs1274842729 4905 dbSNP
rs766713444 4906 dbSNP
rs915335885 4907 dbSNP
rs946809555 4910 dbSNP
rs1429087468 4912 dbSNP
rs981192852 4914 dbSNP
rs1305315152 4918 dbSNP
rs1171816868 4920 dbSNP
rs777186366 4925 dbSNP
rs1417913596 4928 dbSNP
rs1186020255 4930 dbSNP
rs939267022 4933 dbSNP
rs917704230 4942 dbSNP
rs1056360972 4944 dbSNP
rs867867825 4945 dbSNP
rs528429188 4946 dbSNP
rs970543015 4954 dbSNP
rs555766179 4957 dbSNP
rs574411884 4958 dbSNP
rs887539100 4959 dbSNP
rs926453445 4960 dbSNP
rs1007288912 4969 dbSNP
rs1228418634 4984 dbSNP
rs1380657389 4991 dbSNP
rs1334093283 5003 dbSNP
rs764778577 5037 dbSNP
rs1332467301 5041 dbSNP
rs1400571689 5041 dbSNP
rs752228999 5046 dbSNP
rs1353295616 5061 dbSNP
rs1170315781 5064 dbSNP
rs1246000107 5070 dbSNP
rs1424878120 5070 dbSNP
rs1181810987 5072 dbSNP
rs188494077 5075 dbSNP
rs1444307089 5076 dbSNP
rs71479428 5078 dbSNP
rs145644739 5079 dbSNP
rs537805877 5084 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.651 2.9e-4 -0.704 6.2e-5 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.654 3.6e-4 0.633 5.9e-4 23 Click to see details
GSE28260 Renal cortex and medulla -0.763 1.2e-3 -0.654 7.7e-3 13 Click to see details
GSE21687 Ependynoma primary tumors -0.339 3.1e-3 -0.257 2.0e-2 64 Click to see details
GSE21849 B cell lymphoma -0.377 2.2e-2 0.350 3.1e-2 29 Click to see details
GSE38226 Liver fibrosis -0.415 3.1e-2 -0.433 2.5e-2 21 Click to see details
GSE17498 Multiple myeloma -0.243 6.5e-2 -0.257 5.5e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.201 1.7e-1 0.212 1.5e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.174 2.3e-1 -0.018 4.7e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.147 2.4e-1 0.054 4.0e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.202 2.6e-1 0.101 3.8e-1 12 Click to see details
GSE32688 Pancreatic cancer -0.1 2.9e-1 -0.201 1.3e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.108 3.1e-1 0.044 4.2e-1 24 Click to see details
GSE14794 Lymphoblastoid cells -0.053 3.1e-1 -0.015 4.4e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.058 4.2e-1 0.003 5.0e-1 16 Click to see details
GSE17306 Multiple myeloma 0.031 4.2e-1 0.111 2.2e-1 49 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.11 4.2e-1 0.600 1.0e-1 6 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.598 0 -0.492 0 49 Click to see details
THCA 0.824 0.04 0.400 0.25 5 Click to see details
ESCA -0.721 0.08 -0.700 0.09 5 Click to see details
STAD -0.49 0.11 -0.429 0.14 8 Click to see details
KIRC -0.227 0.12 -0.167 0.19 29 Click to see details
CHOL -0.348 0.18 -0.233 0.27 9 Click to see details
HNSC 0.755 0.23 0.500 0.33 3 Click to see details
KIRP -0.135 0.36 -0.350 0.18 9 Click to see details
KICH -0.025 0.48 -0.095 0.41 8 Click to see details
KICH -0.025 0.48 -0.095 0.41 8 Click to see details
KICH -0.025 0.48 -0.095 0.41 8 Click to see details
KICH -0.025 0.48 -0.095 0.41 8 Click to see details
KICH -0.025 0.48 -0.095 0.41 8 Click to see details
KICH -0.025 0.48 -0.095 0.41 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332