miRTarBase - #MIRT023380 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HECW2   
Synonyms NDHSAL, NEDL2
Description HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Transcript NM_020760   
Expression
Putative miRNA Targets on HECW2
3'UTR of HECW2
(miRNA target sites are highlighted)
>HECW2|NM_020760|3'UTR
   1 CCTGGAAGCTGAATGCCCATCTCTGTGGACAGGCAGGTTCAGAAGCTGCCTTCTAGAAGAATGATTGAACATTGGAAGTT
  81 TCAAGAGGATGCTTCCTTTAGGATAAAGCTATGTGCTGTTGTTTTCCAGGAACAAGTGCTCTGTCACATTTGGGGACTGG
 161 AGATGAGTCCTCTTGGAAGGATTTGGGTGAGCTTGATGCCCAGGGAACAACCCAACCGTCTTTCAATCAACAGTTCTTGA
 241 CTGCCAAACTTTTTCCATTTGTTATGTTCCAAGACAAAGATGAACCCATACATGATCAGCTCCACGGTAATTTTTAGGGA
 321 CTCAGGAGAATCTTGAAACTTACCCTTGAACGTGGTTCAAGCCAAACTGGCAGCATTTGGCCCAATCTCCAAATTAGAGC
 401 AAGTTAAATAATATAATAAAAGTAAATATATTTCCTGAAAGTACATTCATTTAAGCCCTAAGTTATAACAGAATATTCAT
 481 TTCTTGCTTATGAGTGCCTGCATGGTGTGCACCATAGGTTTCCGCTTTCATGGGACATGAGTGAAAATGAAACCAAGTCA
 561 ATATGAGGTACCTTTACAGATTTGCAATAAGATGGTCTGTGACAATGTATATGCAAGTGGTATGTGTGTAATTATGGCTA
 641 AAGACAAACCATTATTCAGTGAATTACTAATGACAGATTTTATGCTTTATAATGCATGAAAACAATTTTAAAATAACTAG
 721 CAATTAATCACAGCATATCAGGAAAAAGTACACAGTGAGTTCTGTTTATTTTTTGTAGGTTCATTATGTTTATGTTCTTT
 801 AAGATGTATATAAGAACCTACCTATCATGCTGTATGTATCACTCATTCCATTTTCATGTTCCATGCATACTCGGGCATCA
 881 TGCTAATATGTATCCTTTTAAGCACTCTCAAGGAAACAAAAGGGCCTTTTATTTTTATAAAGGTAAAAAAAATTCCCCAA
 961 ATATTTTGCACTGAATGTACCAAAGGTGAAGGGACATTACAATATGACTAACAGCAACTCCATCACTTGAGAAGTATAAT
1041 AGAAAATAGCTTCTAAATCAAACTTCCTTCACAGTGCCGTGTCTACCACTACAAGGACTGTGCATCTAAGTAATAATTTT
1121 TTAAGATTCACTATATGTGATAGTATGATATGCATTTATTTAAAATGCATTAGACTCTCTTCCATCCATCAAATACTTTA
1201 CAGGATGGCATTTAATACAGATATTTCGTATTTCCCCCACTGCTTTTTATTTGTACAGCATCATTAAACACTAAGCTCAG
1281 TTAAGGAGCCATCAGCAACACTGAAGAGATCAGTAGTAAGAATTCCATTTTCCCTCATCAGTGAAGACACCACAAATTGA
1361 AACTCAGAACTATATTTCTAAGCCTGCATTTTCACTGATGCATAATTTTCTTATTAATATTAAGAGACAGTTTTTCTATG
1441 GCATCTCCAAAACTGCATGACATCACTAGTCTTACTTCTGCTTAATTTTATGAGAAGGTATTCTTCATTTTAATTGCTTT
1521 TGGGATTACTCCACATCTTTGTTTATTTCTTGACTAATCAGATTTTCAATAGAGTGAAGTTAAATTGGGGGTCATAAAAG
1601 CATTGGATTGACATATGGTTTGCCAGCCTATGGGTTTACAGGCATTGCCCAAACATTTCTTTGAGATCTATATTTATAAG
1681 CAGCCATGGAATTCCTATTATGGGATGTTGGCAATCTTACATTTTATAGAGGTCATATGCATAGTTTTCATAGGTGTTTT
1761 GTAAGAACTGATTGCTCTCCTGTGAGTTAAGCTATGTTTACTACTGGGACCCTCAAGAGGAATACCACTTATGTTACACT
1841 CCTGCACTAAAGGCACGTACTGCAGTGTGAAGAAATGTTCTGAAAAAGGGTTATAGAAATCTGGAAATAAGAAAGGAAGA
1921 GCTCTCTGTATTCTATAATTGGAAGAGAAAAAAAGAAAAACTTTTAACTGGAAATGTTAGTTTGTACTTATTGATCATGA
2001 ATACAAGTATATATTTAATTTTGCAAACTTTTCACTTGTTTGTATTCTTTTCATTATAAGGAAAAGTAGTATAACACACT
2081 TTTTTTTAAGTCACATATTTGATGGTATACAAGATGTTTCAGGGCTGGCATTCTCCAAGCAGCAGATAAAGGTTGCATTT
2161 CTTTCAAAAATACATTCAAAGACCATGTTATCCTTCATTTTGGTTTGAGACATTTAGTTATGGTATTTCATATTATTAGG
2241 TAAAAGATATTTGAAATAAAATGTATCTCTTTAATTATTTCTAACAAATATATTTCTTTATTAAGGCATCCAACTTTTTC
2321 CCAAATAACAGTACACTTTAATGTATGTAGACATTCTTAATTAGTATAATCATCTAGTTGATACTGTTCTCAGATTGGGA
2401 ATTATCAAAGATGTACTTATCATATCAGAACACCATGCTAACTTATCTATTATTCTTTCTTAGTAAAACAAAACAGCCAG
2481 TAATAACTATATAAAATATTAAATAACATTTCCACAGAATAAATTAGACTTTCATGTACTCTACAATTAGAAATATCCAT
2561 AAATATTTTCTTCTGGACTGTGAACCCAGATAACTAGGCTTTCTGGTCTTATTTTAAGTGATGCTCTTTATACTATAGAA
2641 GACACTCTTAATACATCATATATGTATGCAGAACATCTCTTAGATGAGAGAACAAGCACATCATTGGCATTCCCTCTGTG
2721 CCAGTTTGATGTTTGTTTGACGATGGAGCTACAAGAGTCTAAATCTGCCTTTGAAAAGCTCAGCTCACAGTGTAGTAGAG
2801 TAGACTCCAAGGTTCAAAAAAGTGTTTTTAATAAAATTTGGTAAGTTCTACAATCAAGGAATGAAGAGAGAAGAGAACAG
2881 CTTTTTCCATCTGGGAGATTCAATAATGGCTTCATATATAGATGATAGTGTGGCTAAAAAAAATTACATCAATGCTGTTT
2961 CTATTGGGAAGCAATGGCAAGTAATAGTATGTCAATACTGGTCAAGTGTTGAAGCCAGGATGCACTTACACAACGAGAGT
3041 GTAAAGTGTGTAGGGAGCTGATCTGTGAAGGAGCAACTCAAAGATTTTGAAATTATCAGTGAAATGCCAAAACAGGGAAA
3121 GTTTCCCTGTTTCCCTTCATCTATTCTACAATGCACCATTGGTTTTCAGTGTGAAAAATCCCAATCCCTGAGCCCAAACC
3201 ACTTCTGGGGTCAAAACATTTTTCTTGTGCACAAAATGAATGGATCTTGGTCAAAGAAGTATGGTCACAATTTTCTAGCA
3281 TATATTGCGTTTATAATTTAGCAGAAATTCTGCAATAAATAAAGGAAAATCTGTTTTACCTGTGCAACAATCAGAAATGG
3361 TAAAAATGCATTCAAGTGTTTGAAAGAAATGGTAGAATATGCTTGCATAGTGCTTTATAGTTTCAAAGTGCTGTCAGGTA
3441 CATCGTCCGTTTAGCTCCTCACGCACTTTGTAGGGTACAAGCATCATGTTCCATCTGGGTTGTGGCTGATTTTCATGGAT
3521 GGCTTGTGGCATCAGTTTCATTACTTCATAGTCACAATTCTGTGTTTCATCTTGAGAAATGTGGAGACTAATGTTTGTAC
3601 CAGTATATTCCACATTCAGTGAGGTTTCCAAGATGCTTCCTCCAAACTCTCACTTTCTTAAACAGATACATTTAAAATAT
3681 GACACCTTCTGAAAAGTCCATAAAGAAATTAGTATATTCATGGAAAAAATTTCCCCGTAGACTTATTTGCATTTCATGAC
3761 TTGACATGAGAAATTTAAAAAACAGAAGGCAAAATGTGATTGCTTTTGATGGATTTATACAGAATAGTCATTTAATTTTC
3841 TCAAGTATTATTTGGAAACAAGATAATGGAAAACATTAATCAGAAGCCTTATTTTATTTTTAAATTTTTAATAGGGATGG
3921 ATCTAGTAAGCCCTAATAGCTGAGTTCCAGTGATAAAATTCACAAATTTTATTTATGATTGGACCACTTCTAACAAGGCA
4001 AATATCTTATAATGAAGATAGGAGTCTGTTCAATTTAACCTTATTCAGGAAACTCCGTATTTATGTGAAATGATGCAATG
4081 CCATTATTAAGAGGTATCTGTAACCCTGCATAATAAAAACATGCATAAGAAGAATGTGGTCTAATCTCCAAACTGAGTCT
4161 CAGTTTCAGGGCCTTTTGCTTTCTTTGTTTGTTTGTTTGAGACAGTCTGGCTCTGTCATCCAGGCTGGAGTGCAGTGGCA
4241 CATGAGCTCACTGCAACCTCCACCTCCCAGGCTCAAGCGATCCTCCCACCTCAGCCTCCTGAGTAACTGGGACTACAGGC
4321 GCATACCACCACACCTGGCTAATTTTTGTATTTTTGTAGAGACAAGGCCCAGGCACGTCTCAAACTCTTGAGCTCAAGCG
4401 ATCCGCCCGCCTTGGCCTCCCAAAGTGCTAGGAGTAATTATAGGTGTGAGCCACCATGCTGGCAGTTGTTTTTGTTTATT
4481 TGTGATAAGGTCTGGCTGTCACCCATGCTGGAGTGCAGTGGCATGATCTTGGCTCACTGCAACCTCTGCCTTCCAGGCTC
4561 AAGCCAGCCTCCCACCTCAGCCTCCGAGTAGCTAGGACTACAGGCATGCACCACCATGCCCAGCTAATTTTTTTATATTT
4641 TTTGTAGACACAGGGTTTTGCCACGTTGCCCAGGCTGGTCTTGAACTCCTGAGCTCAAGCAGTCCTCCCACCTTGGCCTC
4721 CCGAAGTGCTGGGATTACAGACGTGAGCCTCTGGGCCTTGCTCTGTTTTGTCTGCTTTCTGATTTAGTAGGTGAGGGACA
4801 GCACTCTGGACCTTAGCCATTTTACTTCCATCTTACTGCCGTGAGTTTGATGAGAATGTCACTTTTAGACTCTAATTTTC
4881 AAAAACTTAGTTTCTTTCCCATTCATTTGTGTTTTCCAAATTAATTTGTTTGTCTAGTATGGATGCAAAGGAATGCTGAA
4961 GACATTAAAGCTTTCTGAATTGTGGCTTAAGGCCAGCTACTGCCCACTGAAAGGATGATAAAAATAAAAAAGGAGGAAAG
5041 AGGAGCCCAGCAGTTGTGCCACCCCGCAAGAATATAATGCTAATTATTGACCAACTGTCAAGATTCAGAGTGGTAACTGC
5121 ATTCCGAGGAGCTGTCAGGAAGGATGACCGTGTGTGTGCTGTCCATATCATAGCCATCTGGGTCAGAAGGAGCGAAAGGA
5201 TGGTTAGGACAGGAGTGTAGTGGAGGGAAAGTTAAAACAACGGTAGATGGATCATCTTAGGGCTTGCTGGTGGGGGTAGG
5281 AACATACTTCAATTTGGTTTCAGACTGAGAAGAAGAAAGCTATGCTCCCTGATGAAGGCACAGTTTGATCTACTAGATGG
5361 GAAATACCCTCATTTTATAACTTCAGTAATTTAACATTTTCTGTATTGCAAAGTGGAATTTAGTCCCAAAGTATTAAAGC
5441 TAACCATAGCTTGATCAGGAGATTTGACAATTTAGCATAAAATTATGTTGTGGATTTTTTTATTTAAGAATTATTGTTAC
5521 TATTATTGAACACCATGTATGAAATGAAAGAAAGGGTGCTTTTATTTCATTATACTTATTTGGTTTTTTTAGCGGACATC
5601 CCTTGACATTAGAATAGCATTTGAGACATTTTCATGATTTCTAAAGATAACTTAAATGCTCTCTGTTAATCTGGAAAGTG
5681 AAATCCTAAGAGTGAGGTTGCAAATGGAGACTAAATTAGTGTTTCCAAGTCAGGAAGTTAATCAAGACCGGAAATAGATT
5761 TGCTTAGATTTTATCTGCAGAGTCGTTTATTTGGCTTTCGTAATTGAACAGCTCAGCAGAATAAGATGGCCCTAGTTGTA
5841 TGGTTTCTGGGGAACACAGGAGAATTAAATTTATATATGTGATTTTTATGTGTAGTGCCCTTGGGCAGGTGATATCTTTC
5921 TATATGACTTTTAAGATATTACAACCTGAGGAGTGTGGATAGCCGTGTTGTGTGATTCAAACTGAATCAGCTATTACTGA
6001 TGCAGGTAAGGAACCATCAGTCAACTTCTGGTTACTATCACCTTCATAAAAAAGAATGGATGATGTTCAGGAATTACCTT
6081 GGAAGGATTAACCAGGAATTAACACAGAATGGGATGTTCTTTTAGGACCCTAATGCTCTAAAAGATAAAATTACAACCTA
6161 TTTTTCTTTATATGATAGCATAAGTAAAATTTGGGGCTGTTAATATGTTGGAAAGTGCTTAAAATTACATGTTTTTATAA
6241 TAGGGATGCAGGCATTCCAAAATAAATGAATAAAAATACATGCATCTCTCTCGCCTCTTACTGAAAGTATTAATCTAATT
6321 TTATAGTAATGATTACTTTTTAATATTAAGGCTCTGTAAAAAAATTATTTCTAAGATTTCAGTAGAACACAGGTGGTGTA
6401 TTTTTTTAAGCTTTTAATTTCTCTTCACCAACCTCAGTCATTACGTTCACCACACAGTGTGTCACAGTTAATAGTGGTAT
6481 TTCAGTTTTTGCGTTGATTTAAGCTTCATATTTATTTAATGTGACTTTTGATGGAGAATAATAATGGGAGATGCTTGCTG
6561 TTAGCATTAAGGTTATACAGCTCTCACTTCACCTTATATGTAATTTTTTTTTCAAAGTAAATAATGCAGATTGTTGACAT
6641 CCTAGAAATGGTTTCTGGGTGGTATTATATGGGGCCTAGGACTCTGAACTGGGACTAGTTGTTTATTTTCTGGGAAGTCT
6721 GTATTCTTATTCTCAACTGAACCCCTGACTCTTTTGTTGTATTTTTTATGATTCCGAAATGCTTTGAGGGAAAGATATTT
6801 TAATGTGTACAATTTGTTTTATTTTCATACTGATCTCTATTTTTGTTTAAAACCATGTTGCATCATGAAATCACTTAATC
6881 CAAAATAAATCTTCTTTAAAAAAAATAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGU--A-ACAGUGUGAGGu 5'
            ||:||||  | |||:||||||| 
Target 5' ggAATACCACTTATGTTACACTCCt 3'
1819 - 1843 174.00 -22.90
2
miRNA  3' guuUGUGGUAAC-AGUGUGAGGu 5'
             |:||:|| |   ||||||: 
Target 5' tttATACTATAGAAGACACTCTt 3'
2627 - 2649 139.00 -12.00
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||:|||||  :||:||| 
Target 5' agcACATCATTG--GCATTCCc 3'
2695 - 2714 139.00 -17.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26548666 2 COSMIC
COSN30114439 21 COSMIC
COSN30169984 42 COSMIC
COSN30162175 56 COSMIC
COSN30459447 75 COSMIC
COSN30471377 82 COSMIC
COSN30471428 85 COSMIC
COSN26897822 87 COSMIC
COSN30161346 157 COSMIC
COSN21009330 269 COSMIC
COSN30538382 282 COSMIC
COSN20756866 439 COSMIC
COSN15090522 461 COSMIC
COSN31561761 487 COSMIC
COSN16051947 494 COSMIC
COSN17996073 723 COSMIC
COSN31588533 794 COSMIC
COSN28753602 822 COSMIC
COSN26671225 866 COSMIC
COSN31540844 912 COSMIC
COSN31540833 955 COSMIC
COSN26553308 1077 COSMIC
COSN16897447 1097 COSMIC
COSN31484689 1303 COSMIC
COSN25862838 1336 COSMIC
COSN16752627 1387 COSMIC
COSN8608287 1610 COSMIC
COSN31582587 1659 COSMIC
COSN6162644 1702 COSMIC
COSN31483167 1771 COSMIC
COSN31571042 1851 COSMIC
COSN25492961 1943 COSMIC
COSN26575072 1951 COSMIC
COSN31490484 1996 COSMIC
COSN28788001 2170 COSMIC
COSN20129395 2477 COSMIC
COSN6162643 2594 COSMIC
COSN24937395 3050 COSMIC
COSN29290743 3078 COSMIC
COSN17054854 3106 COSMIC
COSN20601452 3246 COSMIC
COSN5128560 3735 COSMIC
COSN1816943 4026 COSMIC
COSN24722209 4627 COSMIC
COSN15858049 4665 COSMIC
COSN26477971 4743 COSMIC
COSN5787012 5006 COSMIC
COSN1816942 5396 COSMIC
COSN21440410 5663 COSMIC
COSN16501834 5853 COSMIC
COSN14550007 5857 COSMIC
COSN8764347 5900 COSMIC
COSN1816941 5964 COSMIC
COSN6162642 6111 COSMIC
COSN9870765 6276 COSMIC
COSN6556246 6293 COSMIC
COSN20289932 6303 COSMIC
COSN6162641 6396 COSMIC
COSN23148679 6503 COSMIC
COSN29442088 6533 COSMIC
COSN17362277 6609 COSMIC
COSN24682901 6921 COSMIC
COSN29198674 6927 COSMIC
COSN23603174 7084 COSMIC
COSN9302173 7131 COSMIC
rs55889195 5875 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752677277 2 dbSNP
rs1010360843 3 dbSNP
rs765451411 8 dbSNP
rs1244965722 10 dbSNP
rs1437753911 13 dbSNP
rs754946786 14 dbSNP
rs1012679169 15 dbSNP
rs1301722806 16 dbSNP
rs1322410200 18 dbSNP
rs1273960790 19 dbSNP
rs34473667 21 dbSNP
rs753888043 26 dbSNP
rs766272827 28 dbSNP
rs1298604966 31 dbSNP
rs1386623166 34 dbSNP
rs760320142 35 dbSNP
rs3820908 37 dbSNP
rs966108803 38 dbSNP
rs1336478058 44 dbSNP
rs1365688174 50 dbSNP
rs1306929444 51 dbSNP
rs1234301227 53 dbSNP
rs1271242354 71 dbSNP
rs1373848306 72 dbSNP
rs1054595956 80 dbSNP
rs1484999786 82 dbSNP
rs756870481 82 dbSNP
rs1346127417 87 dbSNP
rs936172669 105 dbSNP
rs1258384321 108 dbSNP
rs1476305766 109 dbSNP
rs3795921 112 dbSNP
rs989178923 113 dbSNP
rs779838136 114 dbSNP
rs1248088113 115 dbSNP
rs1172324709 116 dbSNP
rs1413011171 117 dbSNP
rs947712466 119 dbSNP
rs929345861 125 dbSNP
rs1434091509 127 dbSNP
rs1312952493 128 dbSNP
rs149492177 132 dbSNP
rs556823641 140 dbSNP
rs1174353007 144 dbSNP
rs560148338 158 dbSNP
rs1037713600 160 dbSNP
rs992308877 166 dbSNP
rs929705944 167 dbSNP
rs753861187 170 dbSNP
rs1275611880 171 dbSNP
rs1346322632 172 dbSNP
rs1210875323 177 dbSNP
rs1281042589 185 dbSNP
rs973908186 189 dbSNP
rs1186559045 191 dbSNP
rs183993655 193 dbSNP
rs987351937 199 dbSNP
rs542170695 204 dbSNP
rs985398308 208 dbSNP
rs955356834 213 dbSNP
rs553942077 215 dbSNP
rs534064267 217 dbSNP
rs1010661650 218 dbSNP
rs968339822 220 dbSNP
rs565516709 223 dbSNP
rs1440345904 225 dbSNP
rs956112228 226 dbSNP
rs1033530552 229 dbSNP
rs1432526623 238 dbSNP
rs1272279471 239 dbSNP
rs1369241885 241 dbSNP
rs1234123467 243 dbSNP
rs760902912 247 dbSNP
rs1350734570 249 dbSNP
rs752852037 253 dbSNP
rs1349416663 254 dbSNP
rs1283727560 255 dbSNP
rs1447794612 261 dbSNP
rs1013057177 264 dbSNP
rs1250846413 265 dbSNP
rs1000294842 266 dbSNP
rs1396775840 269 dbSNP
rs767901593 271 dbSNP
rs1157468462 292 dbSNP
rs1272291867 299 dbSNP
rs201371397 305 dbSNP
rs906072772 306 dbSNP
rs1323492363 309 dbSNP
rs1392672545 318 dbSNP
rs1440593248 328 dbSNP
rs1327056627 331 dbSNP
rs1034248701 339 dbSNP
rs1340155765 344 dbSNP
rs1044623035 351 dbSNP
rs191734148 352 dbSNP
rs1047999094 354 dbSNP
rs1368759709 359 dbSNP
rs1167980910 362 dbSNP
rs1351512198 369 dbSNP
rs1409339821 373 dbSNP
rs1225634726 392 dbSNP
rs1271541750 395 dbSNP
rs1420064998 404 dbSNP
rs993716253 409 dbSNP
rs759771515 416 dbSNP
rs774962685 428 dbSNP
rs1436001254 445 dbSNP
rs1037680949 453 dbSNP
rs1256451908 465 dbSNP
rs538536673 474 dbSNP
rs137886626 481 dbSNP
rs896077897 494 dbSNP
rs1162223840 497 dbSNP
rs762581128 502 dbSNP
rs574855700 503 dbSNP
rs188446847 512 dbSNP
rs1249013422 518 dbSNP
rs1203125964 522 dbSNP
rs567286690 523 dbSNP
rs933202730 524 dbSNP
rs182398203 539 dbSNP
rs924447641 555 dbSNP
rs527427971 556 dbSNP
rs1328802834 568 dbSNP
rs1227029251 572 dbSNP
rs1444426972 581 dbSNP
rs1334576922 584 dbSNP
rs918313014 585 dbSNP
rs3748876 586 dbSNP
rs545574803 592 dbSNP
rs941154555 593 dbSNP
rs1234203393 594 dbSNP
rs911097608 595 dbSNP
rs1307508928 605 dbSNP
rs968641206 611 dbSNP
rs538062458 613 dbSNP
rs955241390 620 dbSNP
rs1256278609 621 dbSNP
rs529522362 625 dbSNP
rs914211267 628 dbSNP
rs768617136 630 dbSNP
rs991198472 631 dbSNP
rs1460817318 637 dbSNP
rs145296439 651 dbSNP
rs956250025 658 dbSNP
rs1403439529 659 dbSNP
rs1432232158 671 dbSNP
rs577551041 680 dbSNP
rs1354905600 681 dbSNP
rs763976078 682 dbSNP
rs541001090 707 dbSNP
rs1165318699 709 dbSNP
rs1315132656 710 dbSNP
rs1475985911 714 dbSNP
rs1249091546 720 dbSNP
rs982677950 723 dbSNP
rs1251736106 729 dbSNP
rs1176180439 731 dbSNP
rs1208651621 748 dbSNP
rs1278919377 752 dbSNP
rs1480670419 776 dbSNP
rs1000262367 779 dbSNP
rs4850680 780 dbSNP
rs1259195831 789 dbSNP
rs1427606455 794 dbSNP
rs1026462286 797 dbSNP
rs1192903459 797 dbSNP
rs993684987 804 dbSNP
rs899455225 806 dbSNP
rs1374873336 808 dbSNP
rs1435447216 810 dbSNP
rs1023052975 815 dbSNP
rs1304700315 816 dbSNP
rs1383059921 821 dbSNP
rs3748875 822 dbSNP
rs1274229263 824 dbSNP
rs780108574 829 dbSNP
rs896044499 832 dbSNP
rs1048459844 834 dbSNP
rs1306548128 840 dbSNP
rs1051823652 842 dbSNP
rs199529726 849 dbSNP
rs374518980 849 dbSNP
rs554168171 851 dbSNP
rs1258493814 858 dbSNP
rs540326982 860 dbSNP
rs993834453 867 dbSNP
rs758257816 872 dbSNP
rs896837872 881 dbSNP
rs757257374 884 dbSNP
rs1299868819 886 dbSNP
rs1438652936 887 dbSNP
rs941124844 888 dbSNP
rs745762233 902 dbSNP
rs190123969 904 dbSNP
rs1178322925 908 dbSNP
rs754943845 924 dbSNP
rs557839389 927 dbSNP
rs1462806707 938 dbSNP
rs72921163 942 dbSNP
rs1289692484 944 dbSNP
rs1390519983 947 dbSNP
rs1325033686 953 dbSNP
rs1371619898 953 dbSNP
rs1438405951 953 dbSNP
rs1157875047 960 dbSNP
rs922517778 961 dbSNP
rs1419198862 968 dbSNP
rs937055068 976 dbSNP
rs1269662895 977 dbSNP
rs77988795 978 dbSNP
rs981173355 986 dbSNP
rs934663097 999 dbSNP
rs1252839549 1002 dbSNP
rs1469251128 1004 dbSNP
rs116591890 1009 dbSNP
rs978737490 1015 dbSNP
rs1418614404 1018 dbSNP
rs1159980533 1022 dbSNP
rs972229646 1037 dbSNP
rs1460127868 1040 dbSNP
rs1163937738 1050 dbSNP
rs970075906 1051 dbSNP
rs1394945179 1057 dbSNP
rs1438446286 1059 dbSNP
rs1296401477 1061 dbSNP
rs1371932836 1071 dbSNP
rs1391433306 1075 dbSNP
rs75220993 1078 dbSNP
rs567146780 1079 dbSNP
rs1008234028 1091 dbSNP
rs140396906 1093 dbSNP
rs750025789 1101 dbSNP
rs1272883713 1102 dbSNP
rs1318909449 1103 dbSNP
rs755437742 1112 dbSNP
rs1224382122 1118 dbSNP
rs1250098525 1131 dbSNP
rs547455494 1133 dbSNP
rs751855678 1136 dbSNP
rs1254152635 1139 dbSNP
rs1026548386 1143 dbSNP
rs75012642 1145 dbSNP
rs766706692 1147 dbSNP
rs533778213 1151 dbSNP
rs1418240008 1162 dbSNP
rs994194188 1163 dbSNP
rs1168106217 1166 dbSNP
rs1353834080 1169 dbSNP
rs571313868 1171 dbSNP
rs1462482602 1181 dbSNP
rs997572575 1184 dbSNP
rs896811138 1195 dbSNP
rs763371998 1201 dbSNP
rs185662649 1203 dbSNP
rs1016576723 1205 dbSNP
rs1041553738 1208 dbSNP
rs1005226559 1220 dbSNP
rs1382478870 1227 dbSNP
rs889517692 1228 dbSNP
rs1049519807 1230 dbSNP
rs1276788216 1239 dbSNP
rs1484742854 1253 dbSNP
rs1210384295 1257 dbSNP
rs1238238154 1258 dbSNP
rs1473925261 1271 dbSNP
rs893033798 1276 dbSNP
rs531909236 1284 dbSNP
rs138764990 1299 dbSNP
rs1228408771 1300 dbSNP
rs1170439097 1309 dbSNP
rs1053043175 1318 dbSNP
rs928294356 1321 dbSNP
rs981545928 1336 dbSNP
rs568863553 1341 dbSNP
rs1313013288 1345 dbSNP
rs549392314 1346 dbSNP
rs1453258044 1351 dbSNP
rs1268715039 1352 dbSNP
rs918376498 1363 dbSNP
rs773812965 1364 dbSNP
rs1300481133 1365 dbSNP
rs1346390755 1373 dbSNP
rs180809062 1379 dbSNP
rs1279493194 1382 dbSNP
rs972198553 1383 dbSNP
rs963481254 1402 dbSNP
rs1261501386 1403 dbSNP
rs1465208070 1411 dbSNP
rs1190317667 1416 dbSNP
rs144728792 1420 dbSNP
rs762507251 1424 dbSNP
rs1453787827 1426 dbSNP
rs550610930 1428 dbSNP
rs1172653960 1430 dbSNP
rs1426675138 1431 dbSNP
rs1398532530 1440 dbSNP
rs909375055 1441 dbSNP
rs986376329 1447 dbSNP
rs978707926 1451 dbSNP
rs1436231290 1456 dbSNP
rs953771896 1465 dbSNP
rs1486975246 1474 dbSNP
rs948733802 1475 dbSNP
rs1347247974 1478 dbSNP
rs1222238460 1479 dbSNP
rs1283790023 1484 dbSNP
rs540194027 1492 dbSNP
rs915981479 1498 dbSNP
rs3762475 1503 dbSNP
rs967451299 1511 dbSNP
rs960231635 1517 dbSNP
rs1281012747 1518 dbSNP
rs1467927431 1528 dbSNP
rs1199504850 1538 dbSNP
rs1011674498 1541 dbSNP
rs1026932167 1552 dbSNP
rs761381021 1561 dbSNP
rs1001448792 1562 dbSNP
rs116640233 1569 dbSNP
rs1161818244 1574 dbSNP
rs1363714027 1590 dbSNP
rs1386658018 1591 dbSNP
rs1045372092 1592 dbSNP
rs190918273 1598 dbSNP
rs918261839 1600 dbSNP
rs753161532 1610 dbSNP
rs187282776 1614 dbSNP
rs1005195565 1616 dbSNP
rs1038046463 1627 dbSNP
rs889485790 1628 dbSNP
rs768193496 1631 dbSNP
rs941132800 1633 dbSNP
rs1028059712 1634 dbSNP
rs998384939 1650 dbSNP
rs1171578863 1652 dbSNP
rs1180448689 1656 dbSNP
rs1251990141 1659 dbSNP
rs1044148 1661 dbSNP
rs765810996 1666 dbSNP
rs909353142 1667 dbSNP
rs900926655 1679 dbSNP
rs556369873 1680 dbSNP
rs1416094106 1683 dbSNP
rs1457693493 1714 dbSNP
rs767097408 1724 dbSNP
rs1266625482 1731 dbSNP
rs1053320840 1738 dbSNP
rs1393504562 1739 dbSNP
rs1408788792 1745 dbSNP
rs934527977 1751 dbSNP
rs536145108 1752 dbSNP
rs1411843799 1771 dbSNP
rs1187463650 1772 dbSNP
rs1291696792 1773 dbSNP
rs182181336 1775 dbSNP
rs923557328 1777 dbSNP
rs976072252 1782 dbSNP
rs375663596 1784 dbSNP
rs1337364655 1787 dbSNP
rs554107656 1794 dbSNP
rs1274655032 1796 dbSNP
rs1203023918 1800 dbSNP
rs533738519 1800 dbSNP
rs571280779 1803 dbSNP
rs1208158499 1806 dbSNP
rs1256339992 1825 dbSNP
rs1424091284 1829 dbSNP
rs948704008 1832 dbSNP
rs141855178 1843 dbSNP
rs1020296878 1852 dbSNP
rs1250682428 1852 dbSNP
rs1011642003 1854 dbSNP
rs151265443 1856 dbSNP
rs10782 1857 dbSNP
rs1034170939 1865 dbSNP
rs1001814994 1870 dbSNP
rs1335864027 1875 dbSNP
rs1413813512 1876 dbSNP
rs907112206 1882 dbSNP
rs1298205583 1889 dbSNP
rs919351640 1894 dbSNP
rs1344294672 1895 dbSNP
rs1231425240 1901 dbSNP
rs1279076210 1916 dbSNP
rs1483337099 1917 dbSNP
rs1355654032 1922 dbSNP
rs1045590961 1924 dbSNP
rs771834423 1934 dbSNP
rs972618986 1935 dbSNP
rs1391296343 1936 dbSNP
rs745838821 1939 dbSNP
rs1171841769 1955 dbSNP
rs560819642 1968 dbSNP
rs1377144812 1969 dbSNP
rs1466690429 1986 dbSNP
rs1168966021 1991 dbSNP
rs373852413 2007 dbSNP
rs963592308 2016 dbSNP
rs1463895770 2018 dbSNP
rs190079843 2023 dbSNP
rs941106150 2046 dbSNP
rs1164605776 2056 dbSNP
rs1475658358 2061 dbSNP
rs986406221 2066 dbSNP
rs1438635288 2071 dbSNP
rs373618484 2072 dbSNP
rs1239025144 2074 dbSNP
rs1258546397 2088 dbSNP
rs140831433 2088 dbSNP
rs953692859 2090 dbSNP
rs867424154 2092 dbSNP
rs778773336 2095 dbSNP
rs1196287072 2096 dbSNP
rs1249103816 2105 dbSNP
rs1466587478 2106 dbSNP
rs1192321772 2107 dbSNP
rs1266698743 2109 dbSNP
rs1433874406 2110 dbSNP
rs184542531 2114 dbSNP
rs932174503 2116 dbSNP
rs923440177 2124 dbSNP
rs1232382047 2127 dbSNP
rs142328555 2128 dbSNP
rs1459768708 2130 dbSNP
rs1294732250 2140 dbSNP
rs1236301838 2146 dbSNP
rs965475198 2154 dbSNP
rs1368260744 2171 dbSNP
rs181748354 2172 dbSNP
rs1328890209 2179 dbSNP
rs913204773 2183 dbSNP
rs1031430998 2187 dbSNP
rs1228628319 2188 dbSNP
rs999080265 2191 dbSNP
rs1269099800 2201 dbSNP
rs533140044 2202 dbSNP
rs1219954444 2206 dbSNP
rs1265350965 2222 dbSNP
rs1042950544 2223 dbSNP
rs1192991354 2230 dbSNP
rs188631833 2237 dbSNP
rs1462280441 2241 dbSNP
rs980220183 2247 dbSNP
rs894405212 2251 dbSNP
rs1183191092 2253 dbSNP
rs1413857872 2271 dbSNP
rs1157017094 2273 dbSNP
rs1474087597 2278 dbSNP
rs756235792 2288 dbSNP
rs971600391 2306 dbSNP
rs1024110798 2307 dbSNP
rs994016891 2311 dbSNP
rs1057431750 2315 dbSNP
rs1469739837 2319 dbSNP
rs544297054 2320 dbSNP
rs897107052 2322 dbSNP
rs1353220562 2325 dbSNP
rs1364484612 2326 dbSNP
rs748221519 2330 dbSNP
rs1016536423 2334 dbSNP
rs1322779927 2337 dbSNP
rs1184032898 2347 dbSNP
rs938714514 2351 dbSNP
rs575733701 2385 dbSNP
rs1224450035 2388 dbSNP
rs369095311 2395 dbSNP
rs1441472406 2405 dbSNP
rs1272512620 2406 dbSNP
rs766426537 2414 dbSNP
rs184288850 2416 dbSNP
rs1206012362 2419 dbSNP
rs1212901594 2424 dbSNP
rs1468725164 2428 dbSNP
rs1036478805 2433 dbSNP
rs1471964008 2434 dbSNP
rs567058211 2438 dbSNP
rs909422049 2449 dbSNP
rs1425425658 2462 dbSNP
rs1049909160 2469 dbSNP
rs1377329128 2473 dbSNP
rs139871156 2474 dbSNP
rs986376606 2475 dbSNP
rs1429790128 2478 dbSNP
rs1309381738 2486 dbSNP
rs1203029900 2489 dbSNP
rs953568821 2498 dbSNP
rs879453085 2514 dbSNP
rs933757388 2523 dbSNP
rs901986146 2534 dbSNP
rs376542920 2546 dbSNP
rs192632310 2553 dbSNP
rs946265153 2573 dbSNP
rs1296012746 2574 dbSNP
rs554072486 2578 dbSNP
rs1342140501 2581 dbSNP
rs913528229 2586 dbSNP
rs990159786 2587 dbSNP
rs1240485106 2591 dbSNP
rs36065828 2599 dbSNP
rs976794280 2599 dbSNP
rs935967283 2602 dbSNP
rs1484129322 2604 dbSNP
rs534118084 2605 dbSNP
rs1303303336 2606 dbSNP
rs980571517 2607 dbSNP
rs971519765 2613 dbSNP
rs965099921 2623 dbSNP
rs577693213 2626 dbSNP
rs1031818085 2628 dbSNP
rs1316623743 2629 dbSNP
rs972564015 2630 dbSNP
rs116174109 2631 dbSNP
rs1385860677 2635 dbSNP
rs968514796 2640 dbSNP
rs1436468474 2643 dbSNP
rs1342988063 2645 dbSNP
rs1218824893 2646 dbSNP
rs1005475365 2650 dbSNP
rs1314213343 2658 dbSNP
rs1206586521 2663 dbSNP
rs1021379504 2664 dbSNP
rs537534906 2672 dbSNP
rs1160385028 2674 dbSNP
rs1012706169 2681 dbSNP
rs894374195 2690 dbSNP
rs187662098 2715 dbSNP
rs1432931168 2720 dbSNP
rs1028006339 2722 dbSNP
rs1003273850 2724 dbSNP
rs1426818495 2729 dbSNP
rs555174507 2730 dbSNP
rs1455373941 2734 dbSNP
rs1157307156 2739 dbSNP
rs1388379691 2741 dbSNP
rs1458180479 2742 dbSNP
rs371486491 2746 dbSNP
rs16846841 2751 dbSNP
rs1435819959 2756 dbSNP
rs536999507 2758 dbSNP
rs546866237 2767 dbSNP
rs1275574536 2778 dbSNP
rs1248273269 2786 dbSNP
rs1226811488 2794 dbSNP
rs1267206372 2796 dbSNP
rs1040563862 2804 dbSNP
rs1210404152 2805 dbSNP
rs1287618494 2806 dbSNP
rs1451029277 2809 dbSNP
rs946234074 2821 dbSNP
rs1190668126 2838 dbSNP
rs942128444 2839 dbSNP
rs1446075648 2840 dbSNP
rs1284499485 2842 dbSNP
rs1411636362 2845 dbSNP
rs185560134 2850 dbSNP
rs569666280 2853 dbSNP
rs1345084206 2854 dbSNP
rs1280303996 2875 dbSNP
rs1389188732 2877 dbSNP
rs1405296705 2880 dbSNP
rs1324222360 2883 dbSNP
rs780310438 2888 dbSNP
rs16846830 2889 dbSNP
rs1408191109 2901 dbSNP
rs1287932677 2909 dbSNP
rs1351392320 2916 dbSNP
rs1229993578 2918 dbSNP
rs936286443 2919 dbSNP
rs193111188 2921 dbSNP
rs1355467154 2923 dbSNP
rs1373783697 2926 dbSNP
rs1291338107 2928 dbSNP
rs1481803173 2932 dbSNP
rs927257541 2934 dbSNP
rs1044431636 2944 dbSNP
rs111381980 2944 dbSNP
rs1483864842 2944 dbSNP
rs917371330 2950 dbSNP
rs1327309916 2951 dbSNP
rs932149374 2952 dbSNP
rs1164376612 2955 dbSNP
rs961159646 2956 dbSNP
rs879411359 2968 dbSNP
rs1371711341 2969 dbSNP
rs530811764 2972 dbSNP
rs909717808 2974 dbSNP
rs1320529780 2981 dbSNP
rs761561130 2995 dbSNP
rs751011762 3004 dbSNP
rs1413064220 3006 dbSNP
rs976384314 3008 dbSNP
rs1331883691 3010 dbSNP
rs943698825 3021 dbSNP
rs1245374463 3022 dbSNP
rs1285846110 3024 dbSNP
rs924333996 3025 dbSNP
rs953998209 3030 dbSNP
rs1028391414 3034 dbSNP
rs977064500 3048 dbSNP
rs1198394344 3052 dbSNP
rs1254462288 3058 dbSNP
rs1435265322 3063 dbSNP
rs968399271 3064 dbSNP
rs1021348289 3066 dbSNP
rs1188744512 3069 dbSNP
rs149177323 3083 dbSNP
rs1165995928 3084 dbSNP
rs1448277195 3090 dbSNP
rs541971394 3098 dbSNP
rs1390877030 3112 dbSNP
rs1242376942 3118 dbSNP
rs188481174 3129 dbSNP
rs1036000132 3135 dbSNP
rs1002833665 3138 dbSNP
rs1484459368 3143 dbSNP
rs897815382 3146 dbSNP
rs1014895072 3151 dbSNP
rs1362937347 3154 dbSNP
rs1434286990 3162 dbSNP
rs1297632786 3164 dbSNP
rs1256237659 3166 dbSNP
rs79951667 3203 dbSNP
rs1054643949 3207 dbSNP
rs887830815 3208 dbSNP
rs1345354315 3211 dbSNP
rs1271487723 3213 dbSNP
rs1201389383 3214 dbSNP
rs1265394041 3216 dbSNP
rs1463892410 3217 dbSNP
rs1188507230 3222 dbSNP
rs1248676697 3231 dbSNP
rs1214419062 3259 dbSNP
rs1430349765 3264 dbSNP
rs1340460185 3275 dbSNP
rs1280435693 3282 dbSNP
rs906139158 3284 dbSNP
rs1231717396 3285 dbSNP
rs1044789137 3288 dbSNP
rs760250599 3289 dbSNP
rs1386212336 3291 dbSNP
rs4524133 3294 dbSNP
rs1321106427 3298 dbSNP
rs1416680244 3301 dbSNP
rs1364052796 3313 dbSNP
rs74824897 3315 dbSNP
rs1300078013 3331 dbSNP
rs1326731125 3337 dbSNP
rs558094508 3347 dbSNP
rs1224983607 3349 dbSNP
rs1285526377 3359 dbSNP
rs1327560000 3367 dbSNP
rs1208537119 3370 dbSNP
rs771786655 3380 dbSNP
rs1269294513 3386 dbSNP
rs1041019069 3399 dbSNP
rs1172506737 3403 dbSNP
rs759304845 3409 dbSNP
rs1208130131 3435 dbSNP
rs935562895 3437 dbSNP
rs1433928662 3439 dbSNP
rs544148479 3440 dbSNP
rs1201901989 3442 dbSNP
rs113563109 3444 dbSNP
rs947067832 3445 dbSNP
rs145354931 3448 dbSNP
rs914311257 3449 dbSNP
rs954078785 3460 dbSNP
rs555407732 3462 dbSNP
rs1406357459 3463 dbSNP
rs1305768595 3465 dbSNP
rs1349549879 3467 dbSNP
rs991224075 3470 dbSNP
rs1308245674 3476 dbSNP
rs1483945403 3479 dbSNP
rs1264897442 3481 dbSNP
rs958783702 3481 dbSNP
rs1035565071 3487 dbSNP
rs1490525168 3488 dbSNP
rs1224880051 3493 dbSNP
rs1249871481 3500 dbSNP
rs774339108 3505 dbSNP
rs1482889137 3516 dbSNP
rs1182543388 3523 dbSNP
rs74469762 3524 dbSNP
rs961951664 3531 dbSNP
rs976674621 3535 dbSNP
rs1014860104 3538 dbSNP
rs749164746 3548 dbSNP
rs1425983721 3553 dbSNP
rs1369557499 3555 dbSNP
rs1410061984 3563 dbSNP
rs1299043759 3564 dbSNP
rs965005707 3565 dbSNP
rs1438857757 3572 dbSNP
rs1394694335 3585 dbSNP
rs1260401419 3594 dbSNP
rs952047713 3603 dbSNP
rs1020653258 3611 dbSNP
rs1029078734 3612 dbSNP
rs1360865266 3618 dbSNP
rs1334507600 3621 dbSNP
rs996294672 3623 dbSNP
rs1009291903 3630 dbSNP
rs1272575133 3632 dbSNP
rs113705198 3635 dbSNP
rs1205512699 3647 dbSNP
rs1040506514 3648 dbSNP
rs1482138260 3663 dbSNP
rs1033577838 3664 dbSNP
rs182883572 3666 dbSNP
rs190663387 3671 dbSNP
rs144786878 3676 dbSNP
rs13019587 3682 dbSNP
rs530898024 3685 dbSNP
rs895796211 3688 dbSNP
rs1037005058 3689 dbSNP
rs186955971 3698 dbSNP
rs1464845950 3700 dbSNP
rs548643805 3705 dbSNP
rs59936062 3712 dbSNP
rs937074677 3721 dbSNP
rs1384090233 3736 dbSNP
rs182633375 3737 dbSNP
rs981266830 3739 dbSNP
rs1295428195 3746 dbSNP
rs932469397 3747 dbSNP
rs1215286675 3754 dbSNP
rs1425091738 3758 dbSNP
rs780296644 3768 dbSNP
rs1310726876 3774 dbSNP
rs1209162656 3789 dbSNP
rs907773455 3794 dbSNP
rs780876853 3796 dbSNP
rs1470806090 3797 dbSNP
rs984743634 3799 dbSNP
rs952016687 3808 dbSNP
rs372758406 3811 dbSNP
rs540389943 3812 dbSNP
rs1186621639 3815 dbSNP
rs1246834336 3829 dbSNP
rs976644828 3835 dbSNP
rs1187822436 3837 dbSNP
rs533164603 3845 dbSNP
rs564379405 3846 dbSNP
rs758871590 3850 dbSNP
rs146261789 3873 dbSNP
rs73050320 3876 dbSNP
rs1471217975 3883 dbSNP
rs987830059 3883 dbSNP
rs1212280033 3886 dbSNP
rs1388617812 3888 dbSNP
rs958026010 3905 dbSNP
rs575154810 3907 dbSNP
rs757854685 3910 dbSNP
rs1218878548 3911 dbSNP
rs367891489 3913 dbSNP
rs1224082734 3917 dbSNP
rs370311888 3919 dbSNP
rs1283662559 3922 dbSNP
rs1224357084 3928 dbSNP
rs1267412322 3928 dbSNP
rs1011148698 3929 dbSNP
rs895412577 3930 dbSNP
rs1217224128 3932 dbSNP
rs1377630598 3934 dbSNP
rs1244487945 3947 dbSNP
rs1477461261 3948 dbSNP
rs1199730390 3964 dbSNP
rs373744797 3975 dbSNP
rs1431021350 3977 dbSNP
rs1481612989 3990 dbSNP
rs1157483753 3994 dbSNP
rs1407891937 4000 dbSNP
rs1401804316 4004 dbSNP
rs1023107123 4011 dbSNP
rs60275204 4014 dbSNP
rs1435977371 4021 dbSNP
rs568875478 4029 dbSNP
rs937023698 4033 dbSNP
rs1347682523 4042 dbSNP
rs572562241 4056 dbSNP
rs139862071 4057 dbSNP
rs1343014992 4059 dbSNP
rs1157806127 4063 dbSNP
rs940529739 4065 dbSNP
rs1287077228 4071 dbSNP
rs907750579 4078 dbSNP
rs1450501685 4089 dbSNP
rs1048436443 4100 dbSNP
rs1270582850 4104 dbSNP
rs932749440 4107 dbSNP
rs760186010 4112 dbSNP
rs899638717 4118 dbSNP
rs951909576 4120 dbSNP
rs539613363 4131 dbSNP
rs943918430 4137 dbSNP
rs974748035 4139 dbSNP
rs1164369627 4140 dbSNP
rs752342235 4142 dbSNP
rs1454179891 4144 dbSNP
rs966464230 4154 dbSNP
rs1327881272 4158 dbSNP
rs913860353 4159 dbSNP
rs767168404 4160 dbSNP
rs1485025717 4171 dbSNP
rs1260355252 4177 dbSNP
rs57518059 4183 dbSNP
rs1355909764 4186 dbSNP
rs1246074860 4187 dbSNP
rs550257813 4200 dbSNP
rs980523391 4200 dbSNP
rs966845899 4201 dbSNP
rs1288139533 4204 dbSNP
rs12472336 4208 dbSNP
rs1011035898 4214 dbSNP
rs1438721179 4218 dbSNP
rs895370341 4221 dbSNP
rs537374241 4222 dbSNP
rs1023074171 4223 dbSNP
rs1034372963 4228 dbSNP
rs1001197006 4233 dbSNP
rs906899137 4235 dbSNP
rs1045484993 4239 dbSNP
rs1301732875 4244 dbSNP
rs1428016550 4251 dbSNP
rs960276126 4252 dbSNP
rs1388281443 4256 dbSNP
rs867624458 4257 dbSNP
rs568441266 4260 dbSNP
rs1332028149 4261 dbSNP
rs1048898148 4278 dbSNP
rs548336800 4279 dbSNP
rs535029095 4283 dbSNP
rs975094397 4288 dbSNP
rs867289738 4289 dbSNP
rs770643850 4297 dbSNP
rs190457158 4301 dbSNP
rs1251506231 4310 dbSNP
rs1178769711 4313 dbSNP
rs1427106220 4320 dbSNP
rs944715613 4321 dbSNP
rs10190625 4324 dbSNP
rs1489366696 4329 dbSNP
rs1040897435 4332 dbSNP
rs141682405 4333 dbSNP
rs892311645 4335 dbSNP
rs1476518054 4337 dbSNP
rs1170536663 4341 dbSNP
rs1210179969 4354 dbSNP
rs1405114852 4359 dbSNP
rs966729290 4360 dbSNP
rs1338591885 4372 dbSNP
rs1022347139 4373 dbSNP
rs1386422821 4375 dbSNP
rs989581460 4376 dbSNP
rs546851321 4377 dbSNP
rs114178910 4383 dbSNP
rs1033929339 4387 dbSNP
rs768665421 4388 dbSNP
rs1230635389 4390 dbSNP
rs1281728234 4390 dbSNP
rs1323234319 4396 dbSNP
rs906788292 4399 dbSNP
rs1024357462 4400 dbSNP
rs111332158 4402 dbSNP
rs1204567037 4403 dbSNP
rs59700057 4404 dbSNP
rs1310560194 4405 dbSNP
rs1413618962 4408 dbSNP
rs539184008 4409 dbSNP
rs78205432 4410 dbSNP
rs772414261 4416 dbSNP
rs117991615 4423 dbSNP
rs185989534 4427 dbSNP
rs1386536502 4428 dbSNP
rs1315671210 4434 dbSNP
rs1038947172 4435 dbSNP
rs953107789 4438 dbSNP
rs545527047 4440 dbSNP
rs1345810889 4441 dbSNP
rs944580363 4444 dbSNP
rs370832083 4451 dbSNP
rs1315598092 4458 dbSNP
rs779427818 4465 dbSNP
rs556862760 4467 dbSNP
rs1261347575 4469 dbSNP
rs1352893121 4471 dbSNP
rs1372893853 4472 dbSNP
rs945395698 4472 dbSNP
rs915315641 4480 dbSNP
rs964118496 4487 dbSNP
rs1490594397 4489 dbSNP
rs141536851 4490 dbSNP
rs1019677468 4503 dbSNP
rs1201240896 4503 dbSNP
rs989560155 4504 dbSNP
rs1418390579 4510 dbSNP
rs959530963 4517 dbSNP
rs926746623 4519 dbSNP
rs1365511004 4531 dbSNP
rs1415937122 4532 dbSNP
rs1455918364 4536 dbSNP
rs1162447320 4540 dbSNP
rs1187395838 4547 dbSNP
rs1486022494 4548 dbSNP
rs1256832440 4552 dbSNP
rs867070304 4554 dbSNP
rs182207763 4557 dbSNP
rs1250556355 4565 dbSNP
rs1305291569 4566 dbSNP
rs1198981203 4567 dbSNP
rs1391223720 4568 dbSNP
rs537741724 4568 dbSNP
rs1229428956 4575 dbSNP
rs1319314064 4576 dbSNP
rs971359839 4582 dbSNP
rs1319631850 4585 dbSNP
rs56685988 4586 dbSNP
rs1360377492 4588 dbSNP
rs749784518 4591 dbSNP
rs1232197855 4594 dbSNP
rs1000775099 4596 dbSNP
rs1340531593 4597 dbSNP
rs555248232 4603 dbSNP
rs778320741 4604 dbSNP
rs528223170 4611 dbSNP
rs1421988873 4614 dbSNP
rs1044731964 4616 dbSNP
rs1385340843 4621 dbSNP
rs373537408 4623 dbSNP
rs1166302285 4624 dbSNP
rs1353612022 4627 dbSNP
rs947756332 4631 dbSNP
rs755620717 4636 dbSNP
rs917587354 4639 dbSNP
rs34143708 4644 dbSNP
rs144899496 4648 dbSNP
rs201158096 4650 dbSNP
rs950391791 4660 dbSNP
rs1248323175 4662 dbSNP
rs191950054 4664 dbSNP
rs1307197812 4665 dbSNP
rs994627746 4679 dbSNP
rs1252865453 4680 dbSNP
rs900251262 4682 dbSNP
rs186560374 4694 dbSNP
rs1008742612 4699 dbSNP
rs570614384 4705 dbSNP
rs1042306068 4707 dbSNP
rs945374409 4711 dbSNP
rs181541557 4717 dbSNP
rs189174746 4718 dbSNP
rs1468606274 4722 dbSNP
rs754627890 4723 dbSNP
rs184041941 4735 dbSNP
rs952990312 4738 dbSNP
rs926742784 4742 dbSNP
rs982666148 4743 dbSNP
rs1268494748 4749 dbSNP
rs114487072 4754 dbSNP
rs533482531 4756 dbSNP
rs908774983 4768 dbSNP
rs1400963634 4772 dbSNP
rs983065586 4782 dbSNP
rs963999607 4785 dbSNP
rs1179094995 4788 dbSNP
rs1458903027 4792 dbSNP
rs950360861 4798 dbSNP
rs376866316 4801 dbSNP
rs1212711004 4810 dbSNP
rs1462649668 4811 dbSNP
rs1212956814 4824 dbSNP
rs1356566536 4826 dbSNP
rs1266707137 4830 dbSNP
rs994511822 4833 dbSNP
rs1426829331 4838 dbSNP
rs986853992 4840 dbSNP
rs181341645 4841 dbSNP
rs1430521060 4843 dbSNP
rs4850679 4849 dbSNP
rs1009126182 4851 dbSNP
rs1001143808 4852 dbSNP
rs1310587836 4856 dbSNP
rs1431629924 4859 dbSNP
rs1290837703 4865 dbSNP
rs1343938598 4880 dbSNP
rs903759330 4880 dbSNP
rs1449524717 4883 dbSNP
rs1325526177 4888 dbSNP
rs1222030182 4905 dbSNP
rs536374428 4909 dbSNP
rs1369269709 4915 dbSNP
rs1217383110 4928 dbSNP
rs766179903 4930 dbSNP
rs1023937439 4932 dbSNP
rs1490084441 4934 dbSNP
rs545492546 4939 dbSNP
rs1325601464 4940 dbSNP
rs1406176901 4945 dbSNP
rs372909028 4958 dbSNP
rs762711584 4970 dbSNP
rs1270075231 4974 dbSNP
rs576908163 4975 dbSNP
rs1156961430 4985 dbSNP
rs189308106 4998 dbSNP
rs1479268887 5000 dbSNP
rs1453141422 5002 dbSNP
rs543608813 5012 dbSNP
rs574999115 5014 dbSNP
rs1157310512 5022 dbSNP
rs1407960305 5026 dbSNP
rs547902434 5031 dbSNP
rs1042284367 5042 dbSNP
rs1009401826 5045 dbSNP
rs184369956 5054 dbSNP
rs1250946274 5062 dbSNP
rs1197821568 5065 dbSNP
rs940428171 5066 dbSNP
rs1269011895 5067 dbSNP
rs886227410 5070 dbSNP
rs1374052632 5089 dbSNP
rs1224896580 5095 dbSNP
rs1288971497 5102 dbSNP
rs1358219962 5103 dbSNP
rs1222808047 5124 dbSNP
rs1047219753 5125 dbSNP
rs9288255 5126 dbSNP
rs920109828 5129 dbSNP
rs773058878 5146 dbSNP
rs1180523559 5149 dbSNP
rs765212431 5150 dbSNP
rs572451572 5156 dbSNP
rs1424216791 5158 dbSNP
rs1164425628 5161 dbSNP
rs1393217145 5162 dbSNP
rs926682757 5164 dbSNP
rs1327939773 5165 dbSNP
rs868067122 5167 dbSNP
rs1444317137 5170 dbSNP
rs1312228246 5176 dbSNP
rs1046505311 5193 dbSNP
rs559032326 5194 dbSNP
rs1316708155 5198 dbSNP
rs908749635 5199 dbSNP
rs7562562 5208 dbSNP
rs1437616832 5211 dbSNP
rs1333114887 5216 dbSNP
rs931517989 5226 dbSNP
rs72613709 5234 dbSNP
rs1381772660 5235 dbSNP
rs1361278147 5238 dbSNP
rs1160495172 5239 dbSNP
rs149545585 5241 dbSNP
rs774667507 5242 dbSNP
rs1474555007 5243 dbSNP
rs1031536505 5246 dbSNP
rs1419999425 5249 dbSNP
rs115694582 5264 dbSNP
rs546127452 5270 dbSNP
rs1379055306 5274 dbSNP
rs987279766 5284 dbSNP
rs138033333 5285 dbSNP
rs1487735040 5287 dbSNP
rs1020711844 5297 dbSNP
rs1413891973 5299 dbSNP
rs565352795 5307 dbSNP
rs1269939808 5316 dbSNP
rs762766510 5318 dbSNP
rs1218092202 5330 dbSNP
rs1485009545 5337 dbSNP
rs192813202 5341 dbSNP
rs1220907366 5345 dbSNP
rs896432483 5356 dbSNP
rs528414425 5358 dbSNP
rs1204315195 5361 dbSNP
rs1258375418 5362 dbSNP
rs1032245599 5364 dbSNP
rs1373907009 5367 dbSNP
rs756657984 5373 dbSNP
rs1002601990 5383 dbSNP
rs1428435271 5396 dbSNP
rs905227089 5410 dbSNP
rs565329376 5415 dbSNP
rs1049250495 5429 dbSNP
rs1227013349 5430 dbSNP
rs930427875 5459 dbSNP
rs1381202617 5462 dbSNP
rs1341291649 5480 dbSNP
rs1046914753 5482 dbSNP
rs1342058631 5483 dbSNP
rs949458275 5487 dbSNP
rs1402164174 5489 dbSNP
rs1281786468 5493 dbSNP
rs748536837 5497 dbSNP
rs1047232900 5501 dbSNP
rs1234638894 5502 dbSNP
rs1258328056 5507 dbSNP
rs1348599147 5519 dbSNP
rs1204691859 5522 dbSNP
rs879922439 5534 dbSNP
rs1262694670 5535 dbSNP
rs1489398567 5536 dbSNP
rs1196950819 5541 dbSNP
rs189291393 5555 dbSNP
rs920154912 5557 dbSNP
rs532138716 5571 dbSNP
rs184825405 5572 dbSNP
rs1333400205 5574 dbSNP
rs912855600 5583 dbSNP
rs1414917927 5593 dbSNP
rs943019813 5594 dbSNP
rs780709946 5597 dbSNP
rs1362000906 5599 dbSNP
rs1422385976 5614 dbSNP
rs540834534 5617 dbSNP
rs987552927 5620 dbSNP
rs923965903 5634 dbSNP
rs1195302410 5636 dbSNP
rs954458498 5641 dbSNP
rs543520563 5646 dbSNP
rs990655065 5647 dbSNP
rs573435858 5649 dbSNP
rs960603754 5654 dbSNP
rs1220581420 5674 dbSNP
rs1444599855 5677 dbSNP
rs1192770176 5678 dbSNP
rs957894510 5683 dbSNP
rs1271335050 5690 dbSNP
rs1032213048 5695 dbSNP
rs150360563 5701 dbSNP
rs1198348488 5703 dbSNP
rs1034867194 5709 dbSNP
rs1318944181 5710 dbSNP
rs751258938 5723 dbSNP
rs1280299467 5731 dbSNP
rs1458732793 5743 dbSNP
rs1295658788 5746 dbSNP
rs950412520 5749 dbSNP
rs1002165721 5750 dbSNP
rs1310030761 5755 dbSNP
rs1378558002 5765 dbSNP
rs1379172331 5783 dbSNP
rs1243939654 5784 dbSNP
rs1314618070 5786 dbSNP
rs10178810 5799 dbSNP
rs112684451 5800 dbSNP
rs1039890340 5801 dbSNP
rs543352836 5810 dbSNP
rs1014016612 5821 dbSNP
rs1464902945 5824 dbSNP
rs1199160025 5826 dbSNP
rs1239996995 5831 dbSNP
rs887165001 5840 dbSNP
rs1459580507 5853 dbSNP
rs1007096517 5874 dbSNP
rs55889195 5875 dbSNP
rs931454024 5876 dbSNP
rs1167287501 5888 dbSNP
rs935611918 5894 dbSNP
rs1412489572 5903 dbSNP
rs1461835255 5904 dbSNP
rs1332609750 5912 dbSNP
rs1403160883 5922 dbSNP
rs898697376 5924 dbSNP
rs1474068567 5929 dbSNP
rs1040281277 5936 dbSNP
rs140968135 5944 dbSNP
rs750216030 5964 dbSNP
rs946790467 5965 dbSNP
rs1458475689 5982 dbSNP
rs912821227 5985 dbSNP
rs1293754171 5987 dbSNP
rs764886207 5990 dbSNP
rs1219072327 5993 dbSNP
rs933011778 5998 dbSNP
rs1321277490 6008 dbSNP
rs913641542 6010 dbSNP
rs1290697263 6011 dbSNP
rs1202424575 6021 dbSNP
rs987885355 6035 dbSNP
rs957863837 6038 dbSNP
rs1484006686 6039 dbSNP
rs1381330383 6041 dbSNP
rs1184380350 6042 dbSNP
rs1306950474 6046 dbSNP
rs1260670046 6048 dbSNP
rs1477693517 6065 dbSNP
rs1171917925 6071 dbSNP
rs1426335503 6078 dbSNP
rs1468720218 6079 dbSNP
rs925100794 6084 dbSNP
rs1445839725 6086 dbSNP
rs981021241 6091 dbSNP
rs776396177 6092 dbSNP
rs1287318868 6101 dbSNP
rs1361606112 6120 dbSNP
rs1400314477 6124 dbSNP
rs115599173 6127 dbSNP
rs1321275253 6128 dbSNP
rs1222861006 6129 dbSNP
rs1279298906 6135 dbSNP
rs556932159 6137 dbSNP
rs983301866 6140 dbSNP
rs1013567595 6144 dbSNP
rs1488419678 6146 dbSNP
rs543922014 6153 dbSNP
rs866817311 6160 dbSNP
rs1194776695 6161 dbSNP
rs951387350 6172 dbSNP
rs1479681867 6174 dbSNP
rs187452837 6175 dbSNP
rs995627560 6180 dbSNP
rs183107625 6181 dbSNP
rs1406482723 6186 dbSNP
rs1158595373 6193 dbSNP
rs1344773602 6206 dbSNP
rs1420565292 6229 dbSNP
rs1027715125 6238 dbSNP
rs1343379464 6243 dbSNP
rs1440801313 6258 dbSNP
rs898591519 6260 dbSNP
rs192713112 6266 dbSNP
rs1369727286 6283 dbSNP
rs1221509947 6288 dbSNP
rs767728230 6292 dbSNP
rs1282967928 6293 dbSNP
rs1353920857 6301 dbSNP
rs1218298215 6307 dbSNP
rs891360766 6310 dbSNP
rs1489958075 6317 dbSNP
rs1221379161 6324 dbSNP
rs1247504095 6330 dbSNP
rs1051813129 6351 dbSNP
rs932980504 6362 dbSNP
rs1008652177 6365 dbSNP
rs1479298464 6365 dbSNP
rs913610279 6365 dbSNP
rs538218222 6366 dbSNP
rs1440443425 6370 dbSNP
rs1285341956 6377 dbSNP
rs1160662034 6380 dbSNP
rs1052052704 6390 dbSNP
rs936390149 6402 dbSNP
rs1354250861 6403 dbSNP
rs891274511 6408 dbSNP
rs536779239 6416 dbSNP
rs1351494157 6419 dbSNP
rs1439970077 6421 dbSNP
rs188447652 6430 dbSNP
rs969649058 6432 dbSNP
rs1241758335 6434 dbSNP
rs1384851659 6437 dbSNP
rs1366552423 6442 dbSNP
rs1358289929 6443 dbSNP
rs917826715 6444 dbSNP
rs1000169869 6445 dbSNP
rs992107695 6459 dbSNP
rs1458262154 6460 dbSNP
rs951356345 6461 dbSNP
rs113589110 6467 dbSNP
rs1383552836 6468 dbSNP
rs759666923 6493 dbSNP
rs1296964802 6496 dbSNP
rs995522811 6508 dbSNP
rs1408044406 6514 dbSNP
rs1330573457 6523 dbSNP
rs1401026383 6525 dbSNP
rs2889153 6530 dbSNP
rs1381522422 6531 dbSNP
rs1448344006 6536 dbSNP
rs946705047 6538 dbSNP
rs1285636198 6540 dbSNP
rs1358883640 6567 dbSNP
rs780635470 6571 dbSNP
rs1018800609 6572 dbSNP
rs1319220423 6576 dbSNP
rs1007046784 6578 dbSNP
rs1241389501 6590 dbSNP
rs1441954361 6593 dbSNP
rs1188475054 6596 dbSNP
rs1432934172 6599 dbSNP
rs891323619 6600 dbSNP
rs1051350368 6603 dbSNP
rs534519917 6611 dbSNP
rs1169701497 6613 dbSNP
rs552608028 6613 dbSNP
rs1010405808 6615 dbSNP
rs1193165963 6618 dbSNP
rs1467139702 6640 dbSNP
rs1484992981 6647 dbSNP
rs1173583234 6652 dbSNP
rs892054403 6673 dbSNP
rs1396156761 6674 dbSNP
rs1052022047 6697 dbSNP
rs1324397108 6703 dbSNP
rs939452852 6704 dbSNP
rs936358725 6705 dbSNP
rs903583914 6719 dbSNP
rs746605742 6721 dbSNP
rs1344379000 6723 dbSNP
rs1201170568 6730 dbSNP
rs1280919160 6734 dbSNP
rs1230850656 6735 dbSNP
rs1045244819 6736 dbSNP
rs79965688 6745 dbSNP
rs1220599795 6750 dbSNP
rs964332738 6754 dbSNP
rs1337879496 6756 dbSNP
rs879451699 6763 dbSNP
rs1277083109 6770 dbSNP
rs74337281 6775 dbSNP
rs531978020 6776 dbSNP
rs1363047254 6785 dbSNP
rs918528182 6804 dbSNP
rs974052475 6812 dbSNP
rs1173830143 6813 dbSNP
rs963063556 6825 dbSNP
rs1382254472 6828 dbSNP
rs1465938246 6832 dbSNP
rs569667949 6837 dbSNP
rs1178600243 6839 dbSNP
rs954470135 6846 dbSNP
rs1331037999 6855 dbSNP
rs1233984576 6858 dbSNP
rs985987856 6877 dbSNP
rs1276710861 6887 dbSNP
rs955486786 6889 dbSNP
rs770014183 6892 dbSNP
rs1209883268 6895 dbSNP
rs1331731114 6897 dbSNP
rs1423172106 6898 dbSNP
rs1029836215 6906 dbSNP
rs1220065254 6906 dbSNP
rs55956544 6906 dbSNP
rs199712529 6907 dbSNP
rs1194564089 6909 dbSNP
rs529845513 6913 dbSNP
rs892022280 6920 dbSNP
rs560973237 6921 dbSNP
rs1433718837 6936 dbSNP
rs1022507207 6954 dbSNP
rs1000472635 6958 dbSNP
rs1438589456 6961 dbSNP
rs1158858884 6963 dbSNP
rs1198690839 6965 dbSNP
rs1421831150 6969 dbSNP
rs1482845711 6985 dbSNP
rs1271666293 6992 dbSNP
rs1244448199 6994 dbSNP
rs1339532101 6997 dbSNP
rs903550047 6998 dbSNP
rs1044816099 7001 dbSNP
rs1256376812 7004 dbSNP
rs1211956544 7018 dbSNP
rs1326157570 7029 dbSNP
rs947754407 7030 dbSNP
rs896251840 7041 dbSNP
rs1056288116 7047 dbSNP
rs1310261853 7048 dbSNP
rs1011594095 7053 dbSNP
rs1218761090 7065 dbSNP
rs1242268173 7065 dbSNP
rs1341860308 7076 dbSNP
rs1488746071 7077 dbSNP
rs201092108 7078 dbSNP
rs929821361 7078 dbSNP
rs1395963758 7087 dbSNP
rs918496974 7090 dbSNP
rs974021151 7093 dbSNP
rs1055076751 7097 dbSNP
rs1456925279 7098 dbSNP
rs1178715990 7101 dbSNP
rs1381714878 7112 dbSNP
rs941368081 7114 dbSNP
rs911175482 7122 dbSNP
rs1163072607 7128 dbSNP
rs985487098 7148 dbSNP
rs1458781476 7150 dbSNP
rs1165495028 7154 dbSNP
rs1464393113 7159 dbSNP
rs1398826673 7167 dbSNP
rs1446045922 7168 dbSNP
rs548880101 7169 dbSNP
rs1332145172 7173 dbSNP
rs1379336464 7174 dbSNP
rs541590119 7179 dbSNP
rs1029719559 7189 dbSNP
rs988920066 7196 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.64 3.8e-4 0.705 6.0e-5 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.275 1.0e-1 0.010 4.8e-1 23 Click to see details
GSE17306 Multiple myeloma -0.157 1.4e-1 -0.065 3.3e-1 49 Click to see details
GSE21849 B cell lymphoma -0.17 1.9e-1 -0.170 1.9e-1 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.184 1.9e-1 0.218 1.5e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.223 2.0e-1 0.224 2.0e-1 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.169 2.1e-1 -0.126 2.7e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.11 2.7e-1 -0.065 3.6e-1 32 Click to see details
GSE21687 Ependynoma primary tumors 0.066 3.0e-1 0.061 3.2e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.16 3.1e-1 0.535 3.7e-2 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.1 3.2e-1 -0.054 4.0e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.178 3.7e-1 -0.314 2.7e-1 6 Click to see details
GSE14794 Lymphoblastoid cells 0.033 3.8e-1 0.005 4.8e-1 90 Click to see details
GSE28260 Renal cortex and medulla -0.061 4.2e-1 0.137 3.3e-1 13 Click to see details
GSE38226 Liver fibrosis 0.03 4.5e-1 -0.035 4.4e-1 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.005 4.9e-1 -0.149 2.7e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.772 0.06 -0.300 0.31 5 Click to see details
CHOL 0.502 0.08 0.333 0.19 9 Click to see details
KICH 0.48 0.11 0.429 0.14 8 Click to see details
ESCA 0.569 0.16 0.800 0.05 5 Click to see details
KIRC 0.171 0.19 0.181 0.17 29 Click to see details
HNSC 0.709 0.25 0.500 0.33 3 Click to see details
STAD 0.249 0.28 0.143 0.37 8 Click to see details
LIHC -0.066 0.33 -0.140 0.17 49 Click to see details
KIRP -0.034 0.47 -0.083 0.42 9 Click to see details
KIRP -0.034 0.47 -0.083 0.42 9 Click to see details
KIRP -0.034 0.47 -0.083 0.42 9 Click to see details
KIRP -0.034 0.47 -0.083 0.42 9 Click to see details
KIRP -0.034 0.47 -0.083 0.42 9 Click to see details
KIRP -0.034 0.47 -0.083 0.42 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1