miRTarBase - #MIRT023381 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADO   
Synonyms C10orf22
Description 2-aminoethanethiol dioxygenase
Transcript NM_032804   
Expression
Putative miRNA Targets on ADO
3'UTR of ADO
(miRNA target sites are highlighted)
>ADO|NM_032804|3'UTR
   1 AGCCACTGGCGCCCAGGAGCGGTGGGCCGAAGACGTGCCCTACCCTACCACAAGGGCTGTGTCTCTACCCCCTAGCCTGG
  81 GCGTTGGATCTACTGGAATGAGCAGCAGCCGCTTCCTCGGCAGCCTTGGGAAGCACGGGCGACTGGACAGCAGCCGCCGG
 161 GCACGGTTATGGGGGCGGGGTGGGCGGGGAGGCTAGATTGTTTCCTGGTACTGTCACTGCCACTGGGGCTTTGATTTGGA
 241 GGAATGGGGCAGGGGACTATCTGAAGCGCTTCCATCCTAAAGCCATAATGAAAATATCTTCCTCTCTTCCCCATTCTATA
 321 CAAAATACTAAGTGGTTTTCTTGCTCCCACTCCCTACCCCTTAGTTAAATAGGGTTTATTTTCCACTCATGCCCTTATGC
 401 CTTTTTTTCTTATAGTTTTTTAACTTATTGACTGTGCATGACCCAGTGGTTTGAATTGTTTTTAGTTCAAGTCATTGGTA
 481 AAAACTAGGTTTAAGGAGATGAGCTACTGTTTAAAGTGAGCTGGCCTGCCTAATTAATTCCTTGTGAAAACTAAATGATT
 561 TTTTCAGTTTGGGGATCATTCTCACAACATAACTATGCATGTAGAGGACAAGATTTATTTTCTTTCCTCCCTTTGCCCAG
 641 TAGCCACATCTGGTTTACTCAGGCAGCATCTACTAAGAAATTCAGCACCTGCATATCTCTGTGACATGGTCACTTAGAGC
 721 TTATCTTCCCTATGAATCTCCAGATCTGTGAGTCGAGCAGATTTCATGTTGCAGATTCACCTTTAATGCAAAGACTGTAT
 801 TATCCTCACATGACTTTTTTTCTTGTCTTACTGTACCTTAAAAGGTGATAGAGTAATTCTGTATTTTCTAACGGGAAGAT
 881 TCAAAGGAGCTGAATGTGTTATGCTTCCAAACAACTGAATGTAAAACACTCCTAGCCAGTTGTTGCATTCCCTATATTTA
 961 TTTACTTCCAATATTTTACTGTAAAAGTAGGGAGAAATATTATGTTGATAGTTGTTTCATATTCTCTCAGGAACTTTAAT
1041 GTTCCCGACTCGGGTGATTCCAGCTGTGTTGCTGGCAGTGTTGTCTCAACCCTCTCCCTAAAATGACTGAGCCCTGGGTT
1121 CATCTAATGTGGTTTTCCTTAGGAAGAGATAGAAGGCACAGAAGATCACAGCTAGAGAATTGAGAATTAACTATACTACT
1201 AGCCATTTTAGGGCACCAAAACTTGGGATTAAACACTTCCTACTTCCCACTCCCAACTCCTGAAATGAAGTCTTGCTATC
1281 TGTGACTAGTTTTATTTTTGTGCTTTTAATAGTCCGAGCAGTCTTACCTTGTTTACACATGTATTGACACCATTTGCTTC
1361 AGGCCATGGAGCACTGTTTCTCCCTTTTTACTATTTATAGGATTCCGTTTTTTCACAAGACTTTTAATAAAAAGAAATTG
1441 TAGAAATAAACACATTAAAATTTGCCCAGCTGTCGTCTAAGCCCTCTTGATTGACTTGCCCAAGTGGCAATAGAGTTCTA
1521 ATATCTATAATAAAGGGAGATTTGCTATTATTAGTGGAATGTTGACCCCGTATGTAGAGAAACAGTACGTGCCTTTGCCT
1601 CTTTATGCACACAGAGACCCAGGGTGAGGGAGTATTTGTTCCCAGTTTTTAAGATAGTATAAAAAAGCAAATACTTGGTG
1681 AGTGATTTAAAAATAAAACCAAAACAAAACACAAAAAGATATTCCACAGGACATGCCACTTTATTATAAAACCTGACACA
1761 GGCATAGTACCAAGTATTTCCTGCATTGTTGCTAAAATTGTTTTATTGTAGCTCCACATTCTGGTGTAGTTTAAAATGCC
1841 TTTGGGGGCAGTTTGAAGCAGTTCTTCATGCCACTTAGTTTGAAAATAAAATTCTAGATATGCAAATGATTTTCTTAGAA
1921 AACTTCACAAAATAAAAGATCTTGTTTTTTTTTCCATAGCACAGTAATGAATGTGGTTATCAATCACATACTTTTTTGGA
2001 TTATATTGTAGCAAAAAGTTGATTAGCTTACCAAGATTATTAATAGCAATGTATGTGTTATAATACAACTTAGTACATTA
2081 AAGCTACGAAAACTCATCCTGGCTGTAGGATAGTAATAAAGGAAGAATTATGACTTCATTATGAAAAAAAGAAGTTTTAA
2161 AGTTTTCAATTACGAGCAATTTGGAAGAAAAAACCTAAGGTGCTTTTCAAAAGAGTAACTGAAATTGTTGCAGGCCAAAA
2241 CAGCAATATGATATCTCAGATTTAGTTCAATAAGAACAGTGAAACTTTTGGTTCACTAATAAATTCTGAGTAAATTAGTG
2321 GTGAAGACAAAATATAACTTGTTTTAGTGAGCCACTGAGGAAAGAATATGCTTATTACAAAGACAAAATGTGGTGCAGAA
2401 ACTATCTTGCACCTGTGTGCATAAACTGTTAGTCGTGACTGACTTGGTGTGTTGCTATTGTGTTTCTATATACTCCGTCC
2481 AATATAGATAATGTTTTAATAACAACTGTGGGATAAAAGTTATCTTCCCCTTGGAAAGACTAATGAGCACAATGATATTA
2561 ATCACTTTTATGGTGAATAATAAATGCAATAATTGCCTCATGGGTGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGG--UAACA--GUGUGAGGu 5'
            |||| |  | |||   ||||||| 
Target 5' caAACAACTGAATGTAAAACACTCCt 3'
908 - 933 156.00 -16.20
2
miRNA  3' guuuGUGGUAACA-------GUGUGAGGu 5'
              ::|:|||||       :|:||||| 
Target 5' gtgtTGCTATTGTGTTTCTATATACTCCg 3'
2449 - 2477 138.00 -16.11
3
miRNA  3' guUUGUGGU----AAC---AG--UGUGAGGu 5'
            ::|||||    |||   |:  |||||:| 
Target 5' agGGCACCAAAACTTGGGATTAAACACTTCc 3'
1210 - 1240 136.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30122647 58 COSMIC
COSN30512928 89 COSMIC
COSN30143059 167 COSMIC
COSN19655324 177 COSMIC
COSN5880633 317 COSMIC
COSN5880634 328 COSMIC
COSN30511455 441 COSMIC
COSN21318254 474 COSMIC
COSN30530385 525 COSMIC
COSN28794010 627 COSMIC
COSN31550041 631 COSMIC
COSN31550332 638 COSMIC
COSN31550934 648 COSMIC
COSN31523230 695 COSMIC
COSN30134355 747 COSMIC
COSN30120917 763 COSMIC
COSN31537897 794 COSMIC
COSN31568285 794 COSMIC
COSN31588279 799 COSMIC
COSN23012267 822 COSMIC
COSN31522305 822 COSMIC
COSN31513766 824 COSMIC
COSN30544557 844 COSMIC
COSN6978412 919 COSMIC
COSN30530679 1002 COSMIC
COSN31521819 1031 COSMIC
COSN31515168 1120 COSMIC
COSN15623062 1123 COSMIC
COSN15623063 1125 COSMIC
COSN30123847 1178 COSMIC
COSN31546791 1305 COSMIC
COSN31539445 1307 COSMIC
COSN30116558 1349 COSMIC
COSN31571363 1423 COSMIC
COSN29590568 1425 COSMIC
COSN31585744 1431 COSMIC
COSN31607613 1435 COSMIC
COSN19655528 1450 COSMIC
COSN17153744 1529 COSMIC
COSN27522172 1544 COSMIC
COSN30139518 1589 COSMIC
COSN30140103 1590 COSMIC
COSN30114161 1604 COSMIC
COSN10070967 1765 COSMIC
COSN30137338 1770 COSMIC
COSN30123641 1777 COSMIC
COSN8640386 1812 COSMIC
COSN24146205 1868 COSMIC
COSN31524115 1881 COSMIC
COSN30538054 1922 COSMIC
COSN5880635 1981 COSMIC
COSN24303537 1982 COSMIC
COSN24303425 2010 COSMIC
COSN29974749 2030 COSMIC
COSN8716301 2043 COSMIC
COSN31553330 2054 COSMIC
COSN10070968 2094 COSMIC
COSN15623064 2096 COSMIC
COSN30538707 2099 COSMIC
COSN31567983 2126 COSMIC
COSN31517989 2133 COSMIC
COSN30132540 2151 COSMIC
COSN30114489 2303 COSMIC
COSN15662969 2307 COSMIC
COSN26555250 2455 COSMIC
COSN31555783 2477 COSMIC
COSN30123098 2503 COSMIC
COSN26563387 2509 COSMIC
COSN20857298 2513 COSMIC
COSN26640423 2548 COSMIC
COSN30531320 2581 COSMIC
rs224082 627 GWAS
rs10995312 941 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1032788042 2 dbSNP
rs1416718240 10 dbSNP
rs1469538436 12 dbSNP
rs1402922831 13 dbSNP
rs1199083187 16 dbSNP
rs1247681687 19 dbSNP
rs749071752 22 dbSNP
rs1032043304 23 dbSNP
rs1041726218 24 dbSNP
rs1189503687 26 dbSNP
rs1171179189 27 dbSNP
rs1414909495 28 dbSNP
rs770725712 29 dbSNP
rs778561789 30 dbSNP
rs1158527413 39 dbSNP
rs1386487487 40 dbSNP
rs745541069 43 dbSNP
rs200590234 44 dbSNP
rs370368392 45 dbSNP
rs1442945233 48 dbSNP
rs1434119329 49 dbSNP
rs374421085 50 dbSNP
rs987898256 51 dbSNP
rs868297916 53 dbSNP
rs536540618 58 dbSNP
rs913614189 62 dbSNP
rs971724620 62 dbSNP
rs1268793738 64 dbSNP
rs548116560 66 dbSNP
rs943906588 66 dbSNP
rs1341616578 70 dbSNP
rs182229037 72 dbSNP
rs1481633290 73 dbSNP
rs921093197 83 dbSNP
rs1034306148 84 dbSNP
rs1429350442 88 dbSNP
rs1388025877 91 dbSNP
rs537211733 93 dbSNP
rs958722618 95 dbSNP
rs1423353712 103 dbSNP
rs1048297092 104 dbSNP
rs558697932 108 dbSNP
rs1236798653 109 dbSNP
rs1185393029 113 dbSNP
rs1483741415 119 dbSNP
rs139039523 120 dbSNP
rs920017047 126 dbSNP
rs930135287 137 dbSNP
rs983356952 144 dbSNP
rs1339653342 147 dbSNP
rs1271264149 155 dbSNP
rs1172738103 156 dbSNP
rs939989264 157 dbSNP
rs1357548050 159 dbSNP
rs912778440 162 dbSNP
rs1284106743 166 dbSNP
rs1413539614 171 dbSNP
rs1352409141 177 dbSNP
rs1348235910 182 dbSNP
rs1409383826 183 dbSNP
rs1368978490 185 dbSNP
rs1457409292 186 dbSNP
rs1037131575 187 dbSNP
rs1412872485 192 dbSNP
rs1161386828 194 dbSNP
rs895864697 196 dbSNP
rs1411983297 200 dbSNP
rs944261933 204 dbSNP
rs1040016568 206 dbSNP
rs374313894 209 dbSNP
rs371718588 212 dbSNP
rs1280395709 216 dbSNP
rs1248064738 219 dbSNP
rs1221914481 224 dbSNP
rs1452541292 228 dbSNP
rs1289702515 230 dbSNP
rs1231931734 245 dbSNP
rs1331863473 248 dbSNP
rs1406690553 250 dbSNP
rs1276114459 251 dbSNP
rs1023582060 252 dbSNP
rs552928669 256 dbSNP
rs572689382 260 dbSNP
rs543285353 262 dbSNP
rs752490079 272 dbSNP
rs1010033079 273 dbSNP
rs554937386 277 dbSNP
rs747858441 286 dbSNP
rs143067597 297 dbSNP
rs1323663628 302 dbSNP
rs1458703888 304 dbSNP
rs576245773 305 dbSNP
rs1319409529 307 dbSNP
rs1158389733 311 dbSNP
rs1220113938 312 dbSNP
rs543569257 313 dbSNP
rs988189227 318 dbSNP
rs1002743537 319 dbSNP
rs1491004316 321 dbSNP
rs1020600330 323 dbSNP
rs965534218 329 dbSNP
rs976523445 333 dbSNP
rs1246438320 334 dbSNP
rs186878959 335 dbSNP
rs958670116 337 dbSNP
rs1269293496 341 dbSNP
rs1188507740 349 dbSNP
rs932449932 360 dbSNP
rs984010100 363 dbSNP
rs974062809 365 dbSNP
rs1165652826 371 dbSNP
rs1027029893 372 dbSNP
rs951553179 375 dbSNP
rs1365727046 384 dbSNP
rs1319795538 389 dbSNP
rs532469665 390 dbSNP
rs541109577 400 dbSNP
rs1360328115 401 dbSNP
rs1176179630 402 dbSNP
rs982920140 409 dbSNP
rs1422579061 410 dbSNP
rs867137074 414 dbSNP
rs1451700784 426 dbSNP
rs191593518 429 dbSNP
rs1431111815 432 dbSNP
rs529970793 433 dbSNP
rs769563752 443 dbSNP
rs1210952178 444 dbSNP
rs1311720093 449 dbSNP
rs1227384633 465 dbSNP
rs940041496 473 dbSNP
rs1037460842 474 dbSNP
rs895803363 476 dbSNP
rs1380403142 478 dbSNP
rs921528770 485 dbSNP
rs931614596 490 dbSNP
rs1303395282 505 dbSNP
rs1446620425 507 dbSNP
rs1044483218 510 dbSNP
rs1170087879 515 dbSNP
rs1430004280 517 dbSNP
rs1170218431 522 dbSNP
rs1391106793 522 dbSNP
rs1360952337 526 dbSNP
rs1054533389 542 dbSNP
rs553248530 568 dbSNP
rs1000337667 575 dbSNP
rs1482961009 576 dbSNP
rs1054731412 577 dbSNP
rs1488827409 578 dbSNP
rs746180057 579 dbSNP
rs150862464 590 dbSNP
rs1483070516 594 dbSNP
rs772661504 597 dbSNP
rs965072944 605 dbSNP
rs1437863993 606 dbSNP
rs1156782394 610 dbSNP
rs1309331444 614 dbSNP
rs1410002984 617 dbSNP
rs907031364 618 dbSNP
rs224082 627 dbSNP
rs866575444 630 dbSNP
rs1370620802 632 dbSNP
rs894398803 637 dbSNP
rs1166108121 659 dbSNP
rs1475171635 662 dbSNP
rs1357185521 676 dbSNP
rs1415699850 676 dbSNP
rs1184471250 678 dbSNP
rs1483443640 680 dbSNP
rs530734208 692 dbSNP
rs1250051046 693 dbSNP
rs1194348723 698 dbSNP
rs1489336174 700 dbSNP
rs1265813514 706 dbSNP
rs1220663451 707 dbSNP
rs995432019 709 dbSNP
rs1027390855 711 dbSNP
rs951449941 724 dbSNP
rs748810398 726 dbSNP
rs1336929273 729 dbSNP
rs1349393895 731 dbSNP
rs1004684683 733 dbSNP
rs1443860545 737 dbSNP
rs953892257 738 dbSNP
rs1393247324 739 dbSNP
rs1294506581 742 dbSNP
rs1461338868 745 dbSNP
rs1392874734 747 dbSNP
rs1162055757 748 dbSNP
rs1019726692 749 dbSNP
rs983894099 751 dbSNP
rs185025282 756 dbSNP
rs975599455 761 dbSNP
rs554324560 767 dbSNP
rs921477964 770 dbSNP
rs570605762 775 dbSNP
rs1277009457 781 dbSNP
rs1311924156 785 dbSNP
rs1211123175 810 dbSNP
rs958284791 812 dbSNP
rs768667674 826 dbSNP
rs1467002360 831 dbSNP
rs534696271 832 dbSNP
rs189948695 834 dbSNP
rs1456513529 836 dbSNP
rs139346675 837 dbSNP
rs1258439769 838 dbSNP
rs535072571 839 dbSNP
rs1238865349 845 dbSNP
rs989783228 848 dbSNP
rs1331353405 852 dbSNP
rs1160205993 853 dbSNP
rs1440596344 854 dbSNP
rs574697370 860 dbSNP
rs1323130456 864 dbSNP
rs776681251 865 dbSNP
rs950040111 866 dbSNP
rs555254351 869 dbSNP
rs1413628639 873 dbSNP
rs1176721918 876 dbSNP
rs747109275 878 dbSNP
rs1041830907 881 dbSNP
rs928405587 891 dbSNP
rs149623368 892 dbSNP
rs76511847 899 dbSNP
rs1249733003 901 dbSNP
rs1189064287 903 dbSNP
rs765384863 904 dbSNP
rs1335809946 913 dbSNP
rs1201711747 915 dbSNP
rs1345166273 918 dbSNP
rs12779224 920 dbSNP
rs1279141530 924 dbSNP
rs1445015571 930 dbSNP
rs745560942 936 dbSNP
rs10995312 941 dbSNP
rs1300280518 946 dbSNP
rs1436396824 952 dbSNP
rs995824817 955 dbSNP
rs1316890887 972 dbSNP
rs1224444967 986 dbSNP
rs1265370236 987 dbSNP
rs1403077092 988 dbSNP
rs144345885 990 dbSNP
rs1433101586 998 dbSNP
rs1391726933 1000 dbSNP
rs1048329131 1001 dbSNP
rs541490917 1002 dbSNP
rs866423277 1007 dbSNP
rs1198217872 1015 dbSNP
rs1428717716 1020 dbSNP
rs887093033 1025 dbSNP
rs1371240399 1027 dbSNP
rs1004232850 1028 dbSNP
rs1019688957 1029 dbSNP
rs75351521 1031 dbSNP
rs530119955 1037 dbSNP
rs1208206040 1038 dbSNP
rs1028489653 1039 dbSNP
rs1483843719 1040 dbSNP
rs1477648206 1042 dbSNP
rs766166376 1046 dbSNP
rs1005243835 1047 dbSNP
rs1016757751 1048 dbSNP
rs1247714379 1049 dbSNP
rs1341073539 1050 dbSNP
rs1476663559 1052 dbSNP
rs990121548 1053 dbSNP
rs1021236550 1055 dbSNP
rs973062677 1057 dbSNP
rs1308912862 1058 dbSNP
rs1409137688 1060 dbSNP
rs1417206007 1061 dbSNP
rs541815751 1062 dbSNP
rs1473091396 1065 dbSNP
rs971823071 1071 dbSNP
rs1185199318 1072 dbSNP
rs1473309349 1075 dbSNP
rs1252058697 1078 dbSNP
rs193201560 1080 dbSNP
rs185388793 1083 dbSNP
rs1349871524 1095 dbSNP
rs928352683 1102 dbSNP
rs1406086921 1108 dbSNP
rs1285631068 1125 dbSNP
rs938425082 1129 dbSNP
rs980123785 1132 dbSNP
rs927266396 1137 dbSNP
rs751497077 1142 dbSNP
rs1352426875 1144 dbSNP
rs1280296570 1151 dbSNP
rs552440622 1153 dbSNP
rs570643934 1157 dbSNP
rs775738319 1164 dbSNP
rs1441845415 1171 dbSNP
rs1054544145 1176 dbSNP
rs754926988 1187 dbSNP
rs913407154 1194 dbSNP
rs915724464 1198 dbSNP
rs1162733585 1199 dbSNP
rs1041040818 1203 dbSNP
rs1458306610 1204 dbSNP
rs931188056 1205 dbSNP
rs140167418 1208 dbSNP
rs1048762681 1220 dbSNP
rs531044630 1226 dbSNP
rs1231507560 1227 dbSNP
rs1201513024 1237 dbSNP
rs887050489 1241 dbSNP
rs1273047821 1242 dbSNP
rs1212377218 1256 dbSNP
rs1331321878 1257 dbSNP
rs932205492 1258 dbSNP
rs1049412007 1286 dbSNP
rs1490176611 1304 dbSNP
rs889439408 1306 dbSNP
rs1005297876 1307 dbSNP
rs15173 1310 dbSNP
rs543015325 1316 dbSNP
rs1369995239 1317 dbSNP
rs1323734090 1324 dbSNP
rs568023145 1325 dbSNP
rs896987361 1328 dbSNP
rs1270807985 1351 dbSNP
rs535436389 1353 dbSNP
rs1426779893 1362 dbSNP
rs1172818732 1367 dbSNP
rs1454932105 1386 dbSNP
rs752190646 1390 dbSNP
rs1041075368 1391 dbSNP
rs1192486056 1394 dbSNP
rs554061412 1399 dbSNP
rs1373230485 1401 dbSNP
rs971369190 1407 dbSNP
rs570057358 1408 dbSNP
rs752851586 1422 dbSNP
rs143900399 1425 dbSNP
rs1346876648 1435 dbSNP
rs558752339 1441 dbSNP
rs957321038 1449 dbSNP
rs1362620261 1456 dbSNP
rs577042359 1457 dbSNP
rs1288245170 1471 dbSNP
rs996932570 1473 dbSNP
rs913288828 1476 dbSNP
rs1313111864 1480 dbSNP
rs190684719 1482 dbSNP
rs893953473 1485 dbSNP
rs923418227 1491 dbSNP
rs1011091994 1496 dbSNP
rs1399715182 1510 dbSNP
rs553439409 1511 dbSNP
rs769047720 1519 dbSNP
rs777216478 1522 dbSNP
rs1319371931 1523 dbSNP
rs1420789194 1526 dbSNP
rs180744896 1529 dbSNP
rs1484896285 1531 dbSNP
rs1239353638 1533 dbSNP
rs78951580 1536 dbSNP
rs185407235 1541 dbSNP
rs1038097272 1545 dbSNP
rs896927919 1554 dbSNP
rs982804869 1562 dbSNP
rs1283719943 1563 dbSNP
rs994310499 1568 dbSNP
rs1294693365 1570 dbSNP
rs1360193932 1571 dbSNP
rs1212737942 1572 dbSNP
rs1246658616 1573 dbSNP
rs1035315133 1575 dbSNP
rs1313013361 1583 dbSNP
rs1487193170 1586 dbSNP
rs1204395298 1590 dbSNP
rs907028204 1599 dbSNP
rs1262162996 1600 dbSNP
rs1448413874 1609 dbSNP
rs959720985 1612 dbSNP
rs1034236555 1613 dbSNP
rs1355485892 1613 dbSNP
rs375555384 1615 dbSNP
rs957373284 1618 dbSNP
rs575643060 1622 dbSNP
rs369367430 1623 dbSNP
rs1236412886 1631 dbSNP
rs931118700 1632 dbSNP
rs983975226 1639 dbSNP
rs1480795899 1640 dbSNP
rs908422923 1645 dbSNP
rs1202333530 1646 dbSNP
rs1444677692 1655 dbSNP
rs564339739 1660 dbSNP
rs1020684834 1672 dbSNP
rs1353038517 1683 dbSNP
rs1289761012 1694 dbSNP
rs1166027266 1700 dbSNP
rs967515457 1705 dbSNP
rs1298012961 1706 dbSNP
rs528298416 1716 dbSNP
rs1460889529 1720 dbSNP
rs976563563 1723 dbSNP
rs1055963681 1724 dbSNP
rs1509964 1733 dbSNP
rs772363305 1734 dbSNP
rs1041023641 1736 dbSNP
rs1159547241 1738 dbSNP
rs1419953459 1764 dbSNP
rs1249525271 1765 dbSNP
rs188386742 1772 dbSNP
rs747529316 1776 dbSNP
rs1273673891 1780 dbSNP
rs1049813324 1789 dbSNP
rs986353127 1790 dbSNP
rs1332026970 1801 dbSNP
rs1269537523 1802 dbSNP
rs1394530928 1811 dbSNP
rs1239285205 1819 dbSNP
rs577951319 1819 dbSNP
rs893893487 1830 dbSNP
rs909439227 1833 dbSNP
rs769202824 1835 dbSNP
rs1373660603 1836 dbSNP
rs1327080690 1837 dbSNP
rs1307162689 1841 dbSNP
rs1440902226 1841 dbSNP
rs377593874 1846 dbSNP
rs902717951 1866 dbSNP
rs1261144876 1868 dbSNP
rs918240365 1869 dbSNP
rs776703758 1874 dbSNP
rs1003731016 1891 dbSNP
rs1467120630 1897 dbSNP
rs796455913 1898 dbSNP
rs1263181721 1901 dbSNP
rs550198698 1906 dbSNP
rs1352517876 1907 dbSNP
rs1198406906 1911 dbSNP
rs1035261391 1924 dbSNP
rs1258519502 1927 dbSNP
rs959668992 1931 dbSNP
rs1242075317 1937 dbSNP
rs1234965427 1940 dbSNP
rs1045853781 1945 dbSNP
rs907045250 1945 dbSNP
rs1012557009 1946 dbSNP
rs1461391139 1954 dbSNP
rs1023099756 1955 dbSNP
rs952503958 1957 dbSNP
rs568493992 1961 dbSNP
rs1419052194 1964 dbSNP
rs1384354497 1979 dbSNP
rs1183099603 1980 dbSNP
rs1436880992 1991 dbSNP
rs545906921 2012 dbSNP
rs539015716 2013 dbSNP
rs1365943815 2015 dbSNP
rs368737869 2016 dbSNP
rs1452375713 2017 dbSNP
rs984313416 2022 dbSNP
rs761830820 2025 dbSNP
rs1172225862 2034 dbSNP
rs575265000 2037 dbSNP
rs1212559954 2053 dbSNP
rs1485819769 2063 dbSNP
rs1471076501 2068 dbSNP
rs1020315681 2069 dbSNP
rs961528310 2077 dbSNP
rs967777673 2084 dbSNP
rs1228878144 2085 dbSNP
rs562897878 2088 dbSNP
rs997612411 2089 dbSNP
rs1293585131 2096 dbSNP
rs1416821267 2097 dbSNP
rs1390772845 2101 dbSNP
rs1312519300 2104 dbSNP
rs1432567813 2111 dbSNP
rs1398368242 2113 dbSNP
rs1168418091 2114 dbSNP
rs1475074079 2121 dbSNP
rs559433736 2122 dbSNP
rs932599111 2127 dbSNP
rs1049765325 2135 dbSNP
rs915260751 2138 dbSNP
rs552464454 2143 dbSNP
rs35356507 2144 dbSNP
rs1256298624 2145 dbSNP
rs1208288655 2149 dbSNP
rs953558741 2170 dbSNP
rs986238455 2174 dbSNP
rs946817973 2175 dbSNP
rs1042887232 2176 dbSNP
rs1337319145 2177 dbSNP
rs1256750209 2181 dbSNP
rs1235161069 2189 dbSNP
rs902666187 2196 dbSNP
rs181199169 2211 dbSNP
rs186716659 2215 dbSNP
rs895407656 2216 dbSNP
rs1337293372 2220 dbSNP
rs866711620 2230 dbSNP
rs553287204 2233 dbSNP
rs1022623787 2234 dbSNP
rs1394193428 2242 dbSNP
rs952526307 2244 dbSNP
rs1255629377 2246 dbSNP
rs1416616699 2251 dbSNP
rs1185331082 2260 dbSNP
rs918262273 2272 dbSNP
rs1005283799 2280 dbSNP
rs1234929629 2289 dbSNP
rs1015788957 2297 dbSNP
rs763208742 2304 dbSNP
rs9990 2307 dbSNP
rs1216101668 2317 dbSNP
rs1335539542 2322 dbSNP
rs1272683380 2324 dbSNP
rs766586066 2329 dbSNP
rs8331 2334 dbSNP
rs1226797381 2335 dbSNP
rs1045501000 2337 dbSNP
rs752442563 2339 dbSNP
rs1441141080 2342 dbSNP
rs1199231361 2346 dbSNP
rs937057468 2352 dbSNP
rs1327840052 2356 dbSNP
rs535562581 2359 dbSNP
rs557418322 2365 dbSNP
rs146409918 2368 dbSNP
rs953935692 2372 dbSNP
rs985819655 2376 dbSNP
rs1011529796 2378 dbSNP
rs1408199403 2384 dbSNP
rs1354046184 2391 dbSNP
rs377479963 2394 dbSNP
rs1469886627 2403 dbSNP
rs915225855 2405 dbSNP
rs1298697460 2408 dbSNP
rs1041983715 2411 dbSNP
rs1384972401 2413 dbSNP
rs1219408884 2419 dbSNP
rs139832965 2422 dbSNP
rs1285143257 2427 dbSNP
rs997897367 2435 dbSNP
rs1224996534 2436 dbSNP
rs1351216873 2447 dbSNP
rs569376242 2449 dbSNP
rs1042443701 2458 dbSNP
rs564376134 2469 dbSNP
rs1291737352 2471 dbSNP
rs939484151 2477 dbSNP
rs759393943 2478 dbSNP
rs1317190082 2480 dbSNP
rs963474876 2485 dbSNP
rs1378826108 2499 dbSNP
rs972352358 2501 dbSNP
rs1487815552 2510 dbSNP
rs1394949885 2521 dbSNP
rs895353824 2524 dbSNP
rs1012451842 2528 dbSNP
rs1189989730 2531 dbSNP
rs919475960 2545 dbSNP
rs1049802535 2549 dbSNP
rs951099677 2553 dbSNP
rs981539664 2555 dbSNP
rs888107911 2556 dbSNP
rs1222369834 2558 dbSNP
rs1282778695 2569 dbSNP
rs1005642893 2581 dbSNP
rs1015320379 2582 dbSNP
rs1346898248 2587 dbSNP
rs1299019845 2590 dbSNP
rs1216326948 2600 dbSNP
rs1269124744 2604 dbSNP
rs896914610 2605 dbSNP
rs1397709531 2607 dbSNP
rs997968423 2608 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*