miRTarBase - #MIRT023383 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CHST12   
Synonyms C4S-2, C4ST-2, C4ST2
Description carbohydrate sulfotransferase 12
Transcript NM_018641   
Expression
Putative miRNA Targets on CHST12
3'UTR of CHST12
(miRNA target sites are highlighted)
>CHST12|NM_018641|3'UTR
   1 AAGCTTTCGCGTTGCTTTTTCTCGCGTGCCTGGAACCTGACGCACGCGCACTCCAGTTTTTTTATGACCTACGATTTTGC
  81 AATCTGGGCTTCTTGTTCACTCCACTGCCTCTATCCATTGAGTACTGTATCGATATTGTTTTTTAAGATTAATATATTTC
 161 AGGTATTTAATACGAAATGTGGAAGGGAATGCTGGAGTAAAATATCCCCTCTCCCCTCCGCCCGCCCACCCGCCCGCCCG
 241 CTCGCCCGCTCGCCCGCTCCTGTGGTTTTTCTGAGCGTGCGGGCGCCGGGAGGGGATGCTGAGGCTGATGGAGCTGCCTC
 321 CAGGGCTAGGGCCACTCACCGGAGGAGGGCGGGGCCTGCACTTGAAGTCAGGCCGCACCTGTCTGTTTTTGGAAGGGTAG
 401 CCGACAAATCCTTCCAGAGGGAAAGTTCTTTGTTTAAGTGTTGTACTTGAAAAGGTCAATCTTCAGGGCTTCCTGTTTGA
 481 AGTCAAGTCAGAGGTAAACCGGTCAGTTACAGAAGCAGGATTTCTAGGATTTCTAACTCCAGCTGTTCCCATACTGTCTA
 561 GTTTAAATTATGGCTGTTAAGGCCGGGCGGGTGACTCAGGCAGGTAATCCCAGAACTTTGGGAGGCCCAGACAGAAGGAT
 641 CGCTTGAGGTCAGGAATTTGAGACCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAAAAAAAAAAAAAAAAAAAAAA
 721 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUG---UG-GUAACAGUGUGAGGu 5'
            |||   || ||  | |:|||||| 
Target 5' ggAACCTGACGCA-CG-CGCACTCCa 3'
32 - 55 130.00 -18.20
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::| :| ||||  |||||| 
Target 5' tgGGCTTC-TTGT-TCACTCCa 3'
85 - 104 122.00 -15.50
3
miRNA  3' guUUGUGGU-AACA---GUGUGAggu 5'
            ||| |||  |||   ||:|||   
Target 5' ctAACTCCAGCTGTTCCCATACTgtc 3'
533 - 558 108.00 -11.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30175297 7 COSMIC
COSN30119990 12 COSMIC
COSN30477848 17 COSMIC
COSN26970745 26 COSMIC
COSN30672979 30 COSMIC
COSN26970742 42 COSMIC
COSN26970744 43 COSMIC
COSN30452356 46 COSMIC
COSN14281411 47 COSMIC
COSN14281412 49 COSMIC
COSN31532763 88 COSMIC
COSN31499197 89 COSMIC
COSN19657581 96 COSMIC
COSN31536264 97 COSMIC
COSN30148828 112 COSMIC
COSN31612922 123 COSMIC
COSN31536922 175 COSMIC
COSN31588651 188 COSMIC
COSN20103681 229 COSMIC
COSN32064718 235 COSMIC
COSN20091494 239 COSMIC
COSN30534721 243 COSMIC
COSN20091495 245 COSMIC
COSN15663400 260 COSMIC
COSN31531325 295 COSMIC
COSN15623653 343 COSMIC
COSN31518421 350 COSMIC
COSN31603259 404 COSMIC
COSN26670608 420 COSMIC
COSN31547880 458 COSMIC
COSN31576040 489 COSMIC
COSN31534586 586 COSMIC
COSN31563315 596 COSMIC
COSN31538101 642 COSMIC
COSN28724785 663 COSMIC
COSN30133513 670 COSMIC
COSN22901189 997 COSMIC
COSN29770766 1685 COSMIC
COSN7975516 1917 COSMIC
COSN15067687 2541 COSMIC
COSN7975521 2668 COSMIC
COSN21841719 2842 COSMIC
COSN14445679 3193 COSMIC
COSN16023492 3393 COSMIC
COSN29281000 3409 COSMIC
COSN8299484 3525 COSMIC
COSN21629280 3760 COSMIC
COSN20473353 3845 COSMIC
COSN20431929 3851 COSMIC
COSN30550246 3871 COSMIC
COSN30566005 3871 COSMIC
COSN19019491 3879 COSMIC
COSN30759901 4043 COSMIC
COSN24033515 4755 COSMIC
COSN32224302 4868 COSMIC
COSN22717556 5169 COSMIC
COSN20661590 5779 COSMIC
COSN26656739 5785 COSMIC
COSN30717361 6005 COSMIC
COSN24169417 6071 COSMIC
COSN30681263 6116 COSMIC
COSN4868738 6117 COSMIC
COSN26241878 6246 COSMIC
COSN19747298 6444 COSMIC
COSN20065147 6444 COSMIC
COSN26437120 6445 COSMIC
COSN7975534 6501 COSMIC
COSN15188681 6693 COSMIC
COSN7975536 6755 COSMIC
COSN30717268 6769 COSMIC
COSN22515189 6914 COSMIC
COSN30740327 7210 COSMIC
COSN27850581 7363 COSMIC
COSN8299490 7396 COSMIC
COSN30550036 7539 COSMIC
COSN5654766 7555 COSMIC
COSN30715847 7855 COSMIC
COSN30572325 7856 COSMIC
COSN30628476 7946 COSMIC
COSN20681805 8173 COSMIC
COSN27132640 8180 COSMIC
COSN30645398 8180 COSMIC
COSN30732078 8180 COSMIC
COSN30217360 8785 COSMIC
COSN20717528 9028 COSMIC
COSN4932896 9465 COSMIC
COSN30655660 9712 COSMIC
COSN29901162 9766 COSMIC
COSN30763169 9803 COSMIC
COSN30728129 9852 COSMIC
COSN30565524 9897 COSMIC
COSN19590997 10252 COSMIC
COSN9940098 10863 COSMIC
COSN9983340 11752 COSMIC
COSN27289669 11983 COSMIC
COSN30609879 12095 COSMIC
COSN8516308 12232 COSMIC
COSN30575851 12294 COSMIC
COSN1347643 12318 COSMIC
COSN31660769 12333 COSMIC
COSN31660770 12334 COSMIC
COSN31660771 12336 COSMIC
COSN30176975 12347 COSMIC
COSN31532355 12436 COSMIC
COSN26556290 12474 COSMIC
COSN30624464 12539 COSMIC
COSN5852182 12584 COSMIC
COSN1085462 12669 COSMIC
COSN30737662 12718 COSMIC
COSN26563238 12755 COSMIC
COSN30538729 12820 COSMIC
COSN17225777 12945 COSMIC
COSN30629047 12964 COSMIC
COSN30608420 13131 COSMIC
COSN22722596 13149 COSMIC
COSN30659838 13379 COSMIC
COSN30724317 13380 COSMIC
COSN17222584 13768 COSMIC
COSN1347647 13909 COSMIC
COSN27221805 13909 COSMIC
COSN30622939 13918 COSMIC
COSN1347649 13930 COSMIC
COSN23656584 13944 COSMIC
COSN23759355 14007 COSMIC
COSN30668822 14030 COSMIC
COSN30756014 14036 COSMIC
COSN28215271 14085 COSMIC
COSN6876473 14177 COSMIC
COSN30743659 14272 COSMIC
COSN4932899 14330 COSMIC
COSN30610295 14441 COSMIC
rs2969076 229 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767830389 3 dbSNP
rs1024983404 4 dbSNP
rs750792963 5 dbSNP
rs1251495674 9 dbSNP
rs375240882 11 dbSNP
rs753984671 12 dbSNP
rs1261646634 15 dbSNP
rs956368270 16 dbSNP
rs1427347786 17 dbSNP
rs989073734 18 dbSNP
rs755069272 21 dbSNP
rs777856139 22 dbSNP
rs746883850 24 dbSNP
rs1310848361 25 dbSNP
rs370596350 27 dbSNP
rs1244411907 29 dbSNP
rs745655711 31 dbSNP
rs769354570 37 dbSNP
rs1293976049 38 dbSNP
rs1309752665 40 dbSNP
rs111791292 41 dbSNP
rs762459051 42 dbSNP
rs374203000 44 dbSNP
rs1341258508 45 dbSNP
rs1057460330 46 dbSNP
rs1232847773 47 dbSNP
rs762371293 48 dbSNP
rs1337318806 49 dbSNP
rs1214720544 51 dbSNP
rs768033769 52 dbSNP
rs1367241560 57 dbSNP
rs569356981 57 dbSNP
rs1291854244 64 dbSNP
rs760449439 64 dbSNP
rs1444507923 66 dbSNP
rs1355015450 67 dbSNP
rs1167829584 68 dbSNP
rs868441735 73 dbSNP
rs908340836 81 dbSNP
rs1174041381 82 dbSNP
rs576749513 87 dbSNP
rs769245312 90 dbSNP
rs1372461040 92 dbSNP
rs539315666 93 dbSNP
rs1264729174 94 dbSNP
rs1204994709 96 dbSNP
rs890283891 97 dbSNP
rs1282896464 101 dbSNP
rs553167921 103 dbSNP
rs1311796013 105 dbSNP
rs932350202 109 dbSNP
rs1325956880 110 dbSNP
rs1008683485 112 dbSNP
rs1374096303 114 dbSNP
rs1233648847 127 dbSNP
rs116786548 128 dbSNP
rs956420243 132 dbSNP
rs1313252855 133 dbSNP
rs925744640 143 dbSNP
rs1357239617 151 dbSNP
rs774994937 155 dbSNP
rs989126207 157 dbSNP
rs1184007421 159 dbSNP
rs1410510687 166 dbSNP
rs878864530 171 dbSNP
rs935720886 174 dbSNP
rs1260279044 175 dbSNP
rs1053966451 179 dbSNP
rs1200626208 180 dbSNP
rs1254658804 182 dbSNP
rs892598084 192 dbSNP
rs372295935 193 dbSNP
rs1046714127 195 dbSNP
rs541957821 197 dbSNP
rs1175261740 201 dbSNP
rs111274349 205 dbSNP
rs1002231342 207 dbSNP
rs1411171023 209 dbSNP
rs749136766 210 dbSNP
rs907976449 211 dbSNP
rs1290426948 212 dbSNP
rs1001186562 213 dbSNP
rs1453986644 213 dbSNP
rs1156277774 214 dbSNP
rs1326205728 215 dbSNP
rs1034071928 216 dbSNP
rs1417981057 216 dbSNP
rs1188803625 217 dbSNP
rs1423747550 217 dbSNP
rs1034045928 218 dbSNP
rs1211788607 218 dbSNP
rs575367473 219 dbSNP
rs544228651 220 dbSNP
rs199654852 221 dbSNP
rs1285014296 222 dbSNP
rs1297456911 223 dbSNP
rs1343406976 224 dbSNP
rs1363983396 225 dbSNP
rs1015678666 227 dbSNP
rs1318063571 227 dbSNP
rs898291695 227 dbSNP
rs796078489 228 dbSNP
rs1184487997 229 dbSNP
rs1209388507 229 dbSNP
rs1268131859 229 dbSNP
rs2969076 229 dbSNP
rs890346387 229 dbSNP
rs1221974875 230 dbSNP
rs1354130382 230 dbSNP
rs1229080833 231 dbSNP
rs1341146906 231 dbSNP
rs1442577213 231 dbSNP
rs558342050 231 dbSNP
rs1274498619 233 dbSNP
rs536255692 234 dbSNP
rs1205701725 235 dbSNP
rs373186005 235 dbSNP
rs56115960 235 dbSNP
rs779052191 235 dbSNP
rs1197658744 236 dbSNP
rs1272193090 236 dbSNP
rs1270904573 238 dbSNP
rs1236301277 239 dbSNP
rs1273927207 239 dbSNP
rs540553689 239 dbSNP
rs953942473 240 dbSNP
rs1021953384 241 dbSNP
rs1223835666 242 dbSNP
rs1472219807 243 dbSNP
rs55702312 243 dbSNP
rs61141946 243 dbSNP
rs758487486 243 dbSNP
rs560765272 244 dbSNP
rs369530773 245 dbSNP
rs549515447 246 dbSNP
rs1198318672 247 dbSNP
rs1199083812 249 dbSNP
rs1268208591 251 dbSNP
rs867127975 251 dbSNP
rs1373298991 252 dbSNP
rs1476167684 253 dbSNP
rs1286947612 254 dbSNP
rs1450855569 255 dbSNP
rs935766042 256 dbSNP
rs1165674030 257 dbSNP
rs1412967692 260 dbSNP
rs1418141115 260 dbSNP
rs1391193407 272 dbSNP
rs960295120 274 dbSNP
rs993417298 276 dbSNP
rs989005972 277 dbSNP
rs1425268741 278 dbSNP
rs912977143 281 dbSNP
rs1236669180 282 dbSNP
rs1185236380 284 dbSNP
rs945555673 285 dbSNP
rs2969077 286 dbSNP
rs1404114969 288 dbSNP
rs906800267 289 dbSNP
rs1326415595 295 dbSNP
rs938230935 296 dbSNP
rs1230468456 308 dbSNP
rs1055138025 311 dbSNP
rs888486428 312 dbSNP
rs1005545838 315 dbSNP
rs531666806 316 dbSNP
rs897229498 317 dbSNP
rs997993632 319 dbSNP
rs1341544385 320 dbSNP
rs573149216 324 dbSNP
rs1294607632 326 dbSNP
rs953995111 336 dbSNP
rs1329367153 338 dbSNP
rs985742715 339 dbSNP
rs1451045985 340 dbSNP
rs1248447694 342 dbSNP
rs1187469742 346 dbSNP
rs1463277898 351 dbSNP
rs1209652879 352 dbSNP
rs1032926486 355 dbSNP
rs1262808591 356 dbSNP
rs1247932830 360 dbSNP
rs1452660867 364 dbSNP
rs551377357 364 dbSNP
rs957297602 367 dbSNP
rs17151773 369 dbSNP
rs988481017 371 dbSNP
rs571294226 374 dbSNP
rs913008373 375 dbSNP
rs73673834 376 dbSNP
rs1344706202 379 dbSNP
rs982289042 380 dbSNP
rs1246941898 381 dbSNP
rs552992710 382 dbSNP
rs1227931849 384 dbSNP
rs558062589 386 dbSNP
rs928080830 394 dbSNP
rs1295334904 399 dbSNP
rs938277198 401 dbSNP
rs1055822029 402 dbSNP
rs1010643304 403 dbSNP
rs904901305 404 dbSNP
rs1158976782 406 dbSNP
rs373435238 422 dbSNP
rs1447279312 423 dbSNP
rs1426877877 430 dbSNP
rs1191243705 431 dbSNP
rs1487842906 436 dbSNP
rs1244505775 450 dbSNP
rs377572222 452 dbSNP
rs1484357793 455 dbSNP
rs535297774 460 dbSNP
rs896085112 465 dbSNP
rs1305966620 470 dbSNP
rs941383963 474 dbSNP
rs1316479984 481 dbSNP
rs1220066360 487 dbSNP
rs555489388 492 dbSNP
rs1273168749 495 dbSNP
rs192249071 501 dbSNP
rs1371160317 502 dbSNP
rs1317204569 505 dbSNP
rs1357956212 507 dbSNP
rs1427635382 511 dbSNP
rs1360703109 513 dbSNP
rs1176279110 517 dbSNP
rs1432237566 519 dbSNP
rs1244673428 522 dbSNP
rs1548593 525 dbSNP
rs1261722463 527 dbSNP
rs1353285491 528 dbSNP
rs998190708 538 dbSNP
rs1050887662 540 dbSNP
rs1247036626 543 dbSNP
rs889657050 544 dbSNP
rs879244348 546 dbSNP
rs1258138428 549 dbSNP
rs962198162 550 dbSNP
rs1033371595 554 dbSNP
rs558606042 572 dbSNP
rs1261330122 577 dbSNP
rs957291620 579 dbSNP
rs1240696236 583 dbSNP
rs181009329 585 dbSNP
rs973535654 585 dbSNP
rs148369933 586 dbSNP
rs1303221405 589 dbSNP
rs1465232719 589 dbSNP
rs1182429453 590 dbSNP
rs1160717833 597 dbSNP
rs971142464 603 dbSNP
rs1451379037 605 dbSNP
rs1410626924 609 dbSNP
rs767343627 617 dbSNP
rs981147949 620 dbSNP
rs944657150 623 dbSNP
rs1388225110 628 dbSNP
rs1470397616 633 dbSNP
rs1182872826 639 dbSNP
rs577690840 640 dbSNP
rs913785361 643 dbSNP
rs540968050 649 dbSNP
rs1329885382 653 dbSNP
rs1267585179 662 dbSNP
rs1380637981 665 dbSNP
rs1313124398 666 dbSNP
rs1380340669 667 dbSNP
rs959836837 667 dbSNP
rs1322095739 669 dbSNP
rs1308354781 670 dbSNP
rs1337982249 689 dbSNP
rs946553655 690 dbSNP
rs1459374497 695 dbSNP
rs1170933943 696 dbSNP
rs1191337068 696 dbSNP
rs1203514779 696 dbSNP
rs1209107723 696 dbSNP
rs1228666704 696 dbSNP
rs1244018542 696 dbSNP
rs1247474853 696 dbSNP
rs1251484741 696 dbSNP
rs1265912924 696 dbSNP
rs1268157662 696 dbSNP
rs1276508384 696 dbSNP
rs1299563748 696 dbSNP
rs1315571276 696 dbSNP
rs1356923268 696 dbSNP
rs1364099509 696 dbSNP
rs1370742555 696 dbSNP
rs1383705045 696 dbSNP
rs1388059059 696 dbSNP
rs1389838969 696 dbSNP
rs1390854486 696 dbSNP
rs1424585051 696 dbSNP
rs1434945212 696 dbSNP
rs1438554822 696 dbSNP
rs1450316658 696 dbSNP
rs1489412096 696 dbSNP
rs1489856146 696 dbSNP
rs869123293 696 dbSNP
rs990987473 697 dbSNP
rs1267842660 701 dbSNP
rs1323870488 702 dbSNP
rs1205135708 706 dbSNP
rs1260775493 710 dbSNP
rs1267993625 712 dbSNP
rs1482634557 712 dbSNP
rs1195814710 713 dbSNP
rs1252587232 714 dbSNP
rs1234999884 715 dbSNP
rs910145464 717 dbSNP
rs1043516082 719 dbSNP
rs1404859996 720 dbSNP
rs1364322534 722 dbSNP
rs1310218650 724 dbSNP
rs1430750042 725 dbSNP
rs1417196512 728 dbSNP
rs1181219675 729 dbSNP
rs1429706576 730 dbSNP
rs1480910055 731 dbSNP
rs904953452 731 dbSNP
rs1178847617 732 dbSNP
rs1198333837 732 dbSNP
rs1182837897 733 dbSNP
rs13242378 733 dbSNP
rs1482582569 733 dbSNP
rs796182900 734 dbSNP
rs941592985 735 dbSNP
rs1419032272 737 dbSNP
rs1399286354 738 dbSNP
rs1037001908 739 dbSNP
rs140607708 740 dbSNP
rs1221194749 743 dbSNP
rs933990997 744 dbSNP
rs1290716229 759 dbSNP
rs377657907 763 dbSNP
rs1410981458 790 dbSNP
rs1346532681 799 dbSNP
rs1327338868 800 dbSNP
rs772931522 809 dbSNP
rs1403233688 810 dbSNP
rs577046183 812 dbSNP
rs761067133 821 dbSNP
rs1468252226 822 dbSNP
rs1311185590 827 dbSNP
rs1204649958 828 dbSNP
rs1414320516 829 dbSNP
rs1159726936 833 dbSNP
rs766681596 838 dbSNP
rs1230946234 840 dbSNP
rs185082200 850 dbSNP
rs1014548879 852 dbSNP
rs1442607471 860 dbSNP
rs1479645624 863 dbSNP
rs147085326 866 dbSNP
rs1201424322 868 dbSNP
rs1054271356 869 dbSNP
rs893053731 881 dbSNP
rs1350671657 884 dbSNP
rs555026507 884 dbSNP
rs767011997 884 dbSNP
rs1450695771 897 dbSNP
rs138508108 913 dbSNP
rs115076985 918 dbSNP
rs1390853483 920 dbSNP
rs1450728525 920 dbSNP
rs1321364147 924 dbSNP
rs953618984 925 dbSNP
rs971089116 927 dbSNP
rs1432769170 928 dbSNP
rs1472981806 929 dbSNP
rs986227412 932 dbSNP
rs551442302 933 dbSNP
rs966023640 934 dbSNP
rs1171283370 940 dbSNP
rs1446910526 943 dbSNP
rs1002528625 945 dbSNP
rs1282713920 950 dbSNP
rs988060808 953 dbSNP
rs913837835 956 dbSNP
rs1314807914 962 dbSNP
rs1034539659 967 dbSNP
rs1244038766 968 dbSNP
rs1367701767 972 dbSNP
rs958461207 973 dbSNP
rs991411759 974 dbSNP
rs1374830169 977 dbSNP
rs1017068679 984 dbSNP
rs1428452994 986 dbSNP
rs1307942674 989 dbSNP
rs1405896903 992 dbSNP
rs1364720657 993 dbSNP
rs1161519750 994 dbSNP
rs962935919 1003 dbSNP
rs754344723 1008 dbSNP
rs1450914658 1011 dbSNP
rs1390459034 1017 dbSNP
rs973000233 1019 dbSNP
rs1366668745 1021 dbSNP
rs946606134 1025 dbSNP
rs1474116792 1029 dbSNP
rs1247949638 1030 dbSNP
rs1490671766 1031 dbSNP
rs1220769671 1032 dbSNP
rs1407154972 1035 dbSNP
rs979262388 1036 dbSNP
rs918830189 1051 dbSNP
rs571357673 1055 dbSNP
rs753358443 1057 dbSNP
rs911314148 1058 dbSNP
rs1276747843 1059 dbSNP
rs926459345 1064 dbSNP
rs937797862 1067 dbSNP
rs1056209330 1070 dbSNP
rs1431353846 1073 dbSNP
rs1366502122 1081 dbSNP
rs896191653 1090 dbSNP
rs143496959 1093 dbSNP
rs1054701422 1103 dbSNP
rs1169224811 1103 dbSNP
rs1407869628 1114 dbSNP
rs1426644047 1125 dbSNP
rs1191337949 1127 dbSNP
rs547726556 1130 dbSNP
rs892930382 1131 dbSNP
rs1297152662 1132 dbSNP
rs566653641 1137 dbSNP
rs1268859082 1141 dbSNP
rs1305254148 1144 dbSNP
rs945858114 1145 dbSNP
rs1041687688 1146 dbSNP
rs1292429255 1149 dbSNP
rs898094217 1150 dbSNP
rs758878945 1153 dbSNP
rs554610182 1154 dbSNP
rs147174804 1156 dbSNP
rs1488301733 1158 dbSNP
rs555614199 1167 dbSNP
rs1264014146 1174 dbSNP
rs1411588566 1177 dbSNP
rs1005930305 1182 dbSNP
rs189548962 1189 dbSNP
rs537965999 1190 dbSNP
rs962886097 1191 dbSNP
rs1439559735 1197 dbSNP
rs1167969939 1200 dbSNP
rs879740072 1201 dbSNP
rs1360578125 1202 dbSNP
rs972861390 1204 dbSNP
rs1176128927 1210 dbSNP
rs1025875135 1213 dbSNP
rs1386446279 1215 dbSNP
rs1468321899 1225 dbSNP
rs1427059741 1226 dbSNP
rs1473892041 1227 dbSNP
rs1163184116 1239 dbSNP
rs955598232 1241 dbSNP
rs866440237 1247 dbSNP
rs1479770048 1248 dbSNP
rs1239386507 1251 dbSNP
rs987218928 1257 dbSNP
rs557883680 1258 dbSNP
rs942779788 1263 dbSNP
rs1322833307 1267 dbSNP
rs1261352432 1268 dbSNP
rs1463418365 1269 dbSNP
rs1317513972 1280 dbSNP
rs1305981139 1284 dbSNP
rs1221908823 1287 dbSNP
rs990288749 1288 dbSNP
rs1451481027 1292 dbSNP
rs577752887 1294 dbSNP
rs1020898287 1302 dbSNP
rs1290256045 1309 dbSNP
rs914650717 1310 dbSNP
rs1364932443 1313 dbSNP
rs1159051193 1318 dbSNP
rs1362510854 1323 dbSNP
rs1184376579 1326 dbSNP
rs1416420556 1326 dbSNP
rs1461081823 1332 dbSNP
rs967961115 1339 dbSNP
rs945888861 1341 dbSNP
rs979370821 1341 dbSNP
rs1486140964 1343 dbSNP
rs1260022709 1344 dbSNP
rs1041550616 1350 dbSNP
rs764653093 1354 dbSNP
rs751937803 1358 dbSNP
rs992362883 1359 dbSNP
rs907134020 1361 dbSNP
rs138739151 1364 dbSNP
rs938547248 1366 dbSNP
rs1382252768 1372 dbSNP
rs1383662183 1379 dbSNP
rs1288732620 1381 dbSNP
rs1317278237 1383 dbSNP
rs1452282723 1386 dbSNP
rs139606110 1391 dbSNP
rs1351968269 1397 dbSNP
rs757553654 1409 dbSNP
rs1036729549 1423 dbSNP
rs781402579 1428 dbSNP
rs758468566 1429 dbSNP
rs1188032012 1430 dbSNP
rs930913863 1436 dbSNP
rs553700731 1441 dbSNP
rs778036378 1444 dbSNP
rs747236983 1445 dbSNP
rs1292190930 1451 dbSNP
rs1221534282 1467 dbSNP
rs1357042669 1474 dbSNP
rs757038721 1478 dbSNP
rs1276290784 1481 dbSNP
rs1180624486 1482 dbSNP
rs1325297525 1483 dbSNP
rs780987946 1485 dbSNP
rs1401667035 1486 dbSNP
rs994314136 1488 dbSNP
rs1386022897 1492 dbSNP
rs1304105321 1494 dbSNP
rs1040912927 1498 dbSNP
rs1424369099 1498 dbSNP
rs901963010 1501 dbSNP
rs1456356264 1503 dbSNP
rs1336860147 1504 dbSNP
rs1025737855 1505 dbSNP
rs955627649 1509 dbSNP
rs1434813743 1514 dbSNP
rs1269452075 1517 dbSNP
rs1198647046 1527 dbSNP
rs574268953 1533 dbSNP
rs745748598 1535 dbSNP
rs1196007228 1537 dbSNP
rs1338417994 1539 dbSNP
rs1283540499 1546 dbSNP
rs769717902 1547 dbSNP
rs1020950647 1550 dbSNP
rs1323648294 1554 dbSNP
rs964109156 1579 dbSNP
rs1001240305 1582 dbSNP
rs1033605140 1583 dbSNP
rs959528536 1586 dbSNP
rs1286174180 1588 dbSNP
rs1396106202 1598 dbSNP
rs990539944 1600 dbSNP
rs914680141 1609 dbSNP
rs1430083328 1614 dbSNP
rs775463398 1632 dbSNP
rs1479450533 1637 dbSNP
rs1253694262 1670 dbSNP
rs1182303738 1680 dbSNP
rs977262327 1683 dbSNP
rs748807815 1685 dbSNP
rs1247916440 1687 dbSNP
rs576379132 1690 dbSNP
rs972467312 1692 dbSNP
rs543291538 1693 dbSNP
rs1261978424 1698 dbSNP
rs1462703793 1699 dbSNP
rs562771552 1703 dbSNP
rs1322085417 1704 dbSNP
rs931004914 1705 dbSNP
rs1237417516 1708 dbSNP
rs1470769317 1709 dbSNP
rs1179366772 1713 dbSNP
rs1055750826 1719 dbSNP
rs915802092 1720 dbSNP
rs867406302 1722 dbSNP
rs1472096350 1727 dbSNP
rs1327024716 1728 dbSNP
rs1176690942 1729 dbSNP
rs910824707 1731 dbSNP
rs1336242421 1736 dbSNP
rs943600713 1736 dbSNP
rs1407769873 1742 dbSNP
rs1040576714 1748 dbSNP
rs941727582 1758 dbSNP
rs1332883970 1760 dbSNP
rs1159092887 1762 dbSNP
rs115673792 1765 dbSNP
rs897591955 1766 dbSNP
rs993172028 1769 dbSNP
rs1444922162 1770 dbSNP
rs1047220351 1772 dbSNP
rs774013175 1776 dbSNP
rs1008802387 1782 dbSNP
rs1034071976 1783 dbSNP
rs1286909876 1791 dbSNP
rs1206249078 1792 dbSNP
rs1350345129 1793 dbSNP
rs1278208626 1797 dbSNP
rs1248443133 1801 dbSNP
rs565050870 1805 dbSNP
rs866531510 1817 dbSNP
rs964623721 1818 dbSNP
rs527735733 1822 dbSNP
rs1349648713 1824 dbSNP
rs371169393 1826 dbSNP
rs1400052823 1832 dbSNP
rs1228082306 1833 dbSNP
rs1165309436 1847 dbSNP
rs1424878880 1849 dbSNP
rs1384168078 1850 dbSNP
rs1181405604 1854 dbSNP
rs1284183441 1857 dbSNP
rs1476071436 1860 dbSNP
rs114037031 1861 dbSNP
rs561298912 1863 dbSNP
rs1021604352 1865 dbSNP
rs972529581 1874 dbSNP
rs1282563469 1876 dbSNP
rs1225243219 1878 dbSNP
rs1026750683 1879 dbSNP
rs952547531 1890 dbSNP
rs1244057305 1892 dbSNP
rs1476220324 1901 dbSNP
rs910866513 1902 dbSNP
rs367629918 1907 dbSNP
rs543717654 1909 dbSNP
rs1429933911 1912 dbSNP
rs967460809 1913 dbSNP
rs529206792 1915 dbSNP
rs1438937469 1916 dbSNP
rs182576814 1917 dbSNP
rs928697054 1926 dbSNP
rs1411366388 1927 dbSNP
rs569119262 1927 dbSNP
rs1419611839 1928 dbSNP
rs1482941033 1928 dbSNP
rs1166854441 1932 dbSNP
rs991712519 1933 dbSNP
rs1042504306 1937 dbSNP
rs1202262411 1941 dbSNP
rs1268642195 1954 dbSNP
rs1490595722 1954 dbSNP
rs376161943 1956 dbSNP
rs1476808278 1958 dbSNP
rs1171538737 1962 dbSNP
rs1419569538 1963 dbSNP
rs1285044057 1964 dbSNP
rs1405498512 1966 dbSNP
rs188159052 1974 dbSNP
rs149237532 1975 dbSNP
rs1369815738 1979 dbSNP
rs1354806155 1980 dbSNP
rs766788758 1986 dbSNP
rs191711107 1990 dbSNP
rs1037337013 1996 dbSNP
rs563048748 1999 dbSNP
rs928969270 2000 dbSNP
rs1179134335 2003 dbSNP
rs1481082931 2008 dbSNP
rs1333093911 2011 dbSNP
rs1434538942 2018 dbSNP
rs1189881337 2026 dbSNP
rs1051493445 2030 dbSNP
rs890187353 2042 dbSNP
rs1008415508 2052 dbSNP
rs1230628185 2055 dbSNP
rs1040250132 2066 dbSNP
rs1265144420 2068 dbSNP
rs1273112050 2075 dbSNP
rs900092424 2079 dbSNP
rs576996234 2080 dbSNP
rs1322790248 2081 dbSNP
rs1298897347 2089 dbSNP
rs1021882502 2113 dbSNP
rs183609556 2118 dbSNP
rs118012183 2127 dbSNP
rs1035801234 2129 dbSNP
rs377761502 2133 dbSNP
rs960375328 2141 dbSNP
rs765829664 2148 dbSNP
rs1406054687 2156 dbSNP
rs1476118761 2174 dbSNP
rs1023184889 2175 dbSNP
rs965419291 2180 dbSNP
rs963328143 2182 dbSNP
rs1176824659 2190 dbSNP
rs1438140948 2193 dbSNP
rs1327784725 2195 dbSNP
rs1204447113 2199 dbSNP
rs1460948506 2201 dbSNP
rs1254128386 2206 dbSNP
rs976354423 2214 dbSNP
rs536592678 2216 dbSNP
rs1306092014 2220 dbSNP
rs923537209 2223 dbSNP
rs1384593373 2227 dbSNP
rs1315110699 2229 dbSNP
rs973331174 2230 dbSNP
rs978253067 2232 dbSNP
rs4721709 2238 dbSNP
rs1346157382 2244 dbSNP
rs936802938 2244 dbSNP
rs1158890856 2245 dbSNP
rs758475549 2249 dbSNP
rs764112864 2250 dbSNP
rs1184470384 2257 dbSNP
rs911659863 2263 dbSNP
rs943080504 2264 dbSNP
rs1327178773 2266 dbSNP
rs1437407293 2271 dbSNP
rs751758529 2272 dbSNP
rs576290449 2273 dbSNP
rs949380682 2275 dbSNP
rs1486190915 2285 dbSNP
rs1046409433 2289 dbSNP
rs1039877995 2292 dbSNP
rs1244809063 2299 dbSNP
rs1291968149 2299 dbSNP
rs1354672322 2305 dbSNP
rs1297187001 2306 dbSNP
rs560134607 2310 dbSNP
rs1384390830 2311 dbSNP
rs545197578 2324 dbSNP
rs1209560403 2325 dbSNP
rs900042008 2330 dbSNP
rs947528865 2332 dbSNP
rs565105261 2333 dbSNP
rs1367849239 2366 dbSNP
rs1164384659 2367 dbSNP
rs1246840851 2373 dbSNP
rs1445233146 2374 dbSNP
rs1366790303 2375 dbSNP
rs1172670881 2378 dbSNP
rs1295032347 2386 dbSNP
rs888274624 2398 dbSNP
rs749365143 2401 dbSNP
rs572461241 2404 dbSNP
rs903418750 2405 dbSNP
rs998875491 2408 dbSNP
rs1191456518 2412 dbSNP
rs1490762800 2413 dbSNP
rs1269407910 2415 dbSNP
rs1221274995 2422 dbSNP
rs1353872459 2424 dbSNP
rs1252534608 2425 dbSNP
rs1035662591 2429 dbSNP
rs1006685296 2435 dbSNP
rs541497057 2435 dbSNP
rs1457220765 2436 dbSNP
rs1278044997 2439 dbSNP
rs1018448510 2443 dbSNP
rs188949063 2455 dbSNP
rs530101268 2456 dbSNP
rs1386394823 2460 dbSNP
rs1019887524 2461 dbSNP
rs1462525240 2463 dbSNP
rs1372592500 2466 dbSNP
rs1168432836 2471 dbSNP
rs1023044341 2472 dbSNP
rs978303880 2486 dbSNP
rs925511792 2492 dbSNP
rs1449680576 2498 dbSNP
rs1454037550 2499 dbSNP
rs2906179 2505 dbSNP
rs780898203 2509 dbSNP
rs1026210919 2513 dbSNP
rs548936055 2515 dbSNP
rs115924307 2518 dbSNP
rs755951542 2520 dbSNP
rs1330838121 2522 dbSNP
rs1217329359 2523 dbSNP
rs911510497 2524 dbSNP
rs779932920 2525 dbSNP
rs1206431496 2530 dbSNP
rs1232926811 2533 dbSNP
rs943049133 2537 dbSNP
rs1329742382 2538 dbSNP
rs1309340454 2540 dbSNP
rs192509317 2541 dbSNP
rs1461385702 2542 dbSNP
rs914984589 2546 dbSNP
rs560960016 2547 dbSNP
rs947560914 2550 dbSNP
rs768160298 2556 dbSNP
rs564139974 2567 dbSNP
rs73673835 2576 dbSNP
rs1413861982 2581 dbSNP
rs1473734294 2582 dbSNP
rs934865460 2588 dbSNP
rs1057134247 2589 dbSNP
rs1007148784 2593 dbSNP
rs1157204446 2598 dbSNP
rs533679716 2600 dbSNP
rs1411437239 2602 dbSNP
rs531549439 2609 dbSNP
rs1304623749 2611 dbSNP
rs1044901511 2613 dbSNP
rs1307379801 2613 dbSNP
rs1454613243 2617 dbSNP
rs1383626992 2618 dbSNP
rs997877322 2626 dbSNP
rs1330048503 2634 dbSNP
rs899236012 2635 dbSNP
rs1412742308 2637 dbSNP
rs1019941591 2638 dbSNP
rs1158968577 2644 dbSNP
rs1418691345 2653 dbSNP
rs1378044419 2668 dbSNP
rs144442924 2671 dbSNP
rs1444642084 2679 dbSNP
rs1236398361 2686 dbSNP
rs1187457194 2687 dbSNP
rs1287323664 2694 dbSNP
rs373101570 2695 dbSNP
rs1206041724 2696 dbSNP
rs999776452 2698 dbSNP
rs1026071775 2709 dbSNP
rs567193027 2710 dbSNP
rs958293213 2718 dbSNP
rs1360236003 2724 dbSNP
rs1283745102 2727 dbSNP
rs148470833 2729 dbSNP
rs1018858196 2730 dbSNP
rs1196302986 2738 dbSNP
rs964761562 2739 dbSNP
rs974418280 2741 dbSNP
rs568160607 2746 dbSNP
rs967763063 2747 dbSNP
rs1212261664 2772 dbSNP
rs555695321 2773 dbSNP
rs570032908 2775 dbSNP
rs978932183 2777 dbSNP
rs538908881 2778 dbSNP
rs773060339 2779 dbSNP
rs934813219 2782 dbSNP
rs374588496 2785 dbSNP
rs770324543 2786 dbSNP
rs1261549020 2790 dbSNP
rs1225006068 2791 dbSNP
rs558917539 2797 dbSNP
rs984109681 2800 dbSNP
rs572577465 2808 dbSNP
rs541212427 2809 dbSNP
rs1169795275 2810 dbSNP
rs1270631069 2816 dbSNP
rs1217952026 2821 dbSNP
rs555037388 2828 dbSNP
rs917492299 2829 dbSNP
rs141809542 2830 dbSNP
rs1044377591 2834 dbSNP
rs1307757558 2843 dbSNP
rs1348887335 2845 dbSNP
rs1345806321 2849 dbSNP
rs1388116883 2851 dbSNP
rs1298642678 2852 dbSNP
rs901004053 2853 dbSNP
rs543859505 2855 dbSNP
rs899265360 2860 dbSNP
rs933779890 2864 dbSNP
rs1202110982 2891 dbSNP
rs994844240 2905 dbSNP
rs763394620 2906 dbSNP
rs1339928853 2907 dbSNP
rs1047802530 2930 dbSNP
rs1269308953 2931 dbSNP
rs886311021 2932 dbSNP
rs563640182 2936 dbSNP
rs531671644 2940 dbSNP
rs964635882 2945 dbSNP
rs996258709 2954 dbSNP
rs1021933308 2964 dbSNP
rs1366647996 2965 dbSNP
rs747166431 2966 dbSNP
rs1443996276 2968 dbSNP
rs1354603649 2971 dbSNP
rs1432672783 2977 dbSNP
rs967792583 2978 dbSNP
rs1398681545 2980 dbSNP
rs1179251801 2981 dbSNP
rs1424924599 2982 dbSNP
rs970889786 2987 dbSNP
rs977875166 2995 dbSNP
rs76815042 2996 dbSNP
rs368379099 2999 dbSNP
rs183220214 3001 dbSNP
rs992990717 3006 dbSNP
rs1264852959 3007 dbSNP
rs372158946 3014 dbSNP
rs564982311 3015 dbSNP
rs1276322702 3016 dbSNP
rs1225087746 3019 dbSNP
rs917506375 3019 dbSNP
rs535785296 3020 dbSNP
rs1384371826 3021 dbSNP
rs1459176153 3023 dbSNP
rs980514251 3030 dbSNP
rs920637714 3033 dbSNP
rs930639885 3034 dbSNP
rs1381107002 3038 dbSNP
rs922482685 3039 dbSNP
rs933831661 3040 dbSNP
rs1245099816 3043 dbSNP
rs1041500320 3054 dbSNP
rs1047834178 3055 dbSNP
rs1235504882 3056 dbSNP
rs1299121582 3060 dbSNP
rs1363009212 3065 dbSNP
rs935752884 3066 dbSNP
rs1054565995 3067 dbSNP
rs372611160 3069 dbSNP
rs1012958833 3071 dbSNP
rs1312896028 3074 dbSNP
rs886509282 3076 dbSNP
rs527474523 3077 dbSNP
rs186827582 3079 dbSNP
rs1361586464 3080 dbSNP
rs567360738 3082 dbSNP
rs1418170180 3083 dbSNP
rs1165630476 3084 dbSNP
rs951574526 3088 dbSNP
rs984213778 3093 dbSNP
rs529710246 3104 dbSNP
rs549379060 3105 dbSNP
rs1262280981 3110 dbSNP
rs1017387690 3112 dbSNP
rs995741635 3119 dbSNP
rs1265686657 3120 dbSNP
rs527556316 3121 dbSNP
rs1022217244 3126 dbSNP
rs145999729 3128 dbSNP
rs1311132264 3129 dbSNP
rs566886559 3132 dbSNP
rs1398355798 3136 dbSNP
rs1348966346 3138 dbSNP
rs924440723 3143 dbSNP
rs767704803 3144 dbSNP
rs1054215134 3145 dbSNP
rs915612495 3146 dbSNP
rs960463029 3148 dbSNP
rs750682058 3149 dbSNP
rs1385805020 3156 dbSNP
rs755861649 3158 dbSNP
rs538972743 3160 dbSNP
rs144278250 3166 dbSNP
rs970628814 3167 dbSNP
rs1003784278 3179 dbSNP
rs1252619748 3184 dbSNP
rs1201037437 3185 dbSNP
rs980414137 3196 dbSNP
rs1047293384 3204 dbSNP
rs887280007 3206 dbSNP
rs760444235 3208 dbSNP
rs566182164 3209 dbSNP
rs1217144114 3211 dbSNP
rs558643077 3213 dbSNP
rs1006092734 3229 dbSNP
rs1302177409 3231 dbSNP
rs754871817 3232 dbSNP
rs1321389478 3235 dbSNP
rs1209591974 3236 dbSNP
rs920833128 3239 dbSNP
rs1466056231 3248 dbSNP
rs1399405607 3271 dbSNP
rs1168450639 3277 dbSNP
rs548022233 3278 dbSNP
rs1470799294 3279 dbSNP
rs1463612040 3287 dbSNP
rs778972503 3288 dbSNP
rs930671113 3295 dbSNP
rs983395113 3296 dbSNP
rs1208112908 3297 dbSNP
rs964444890 3302 dbSNP
rs1178659369 3307 dbSNP
rs1456958012 3311 dbSNP
rs1257908659 3313 dbSNP
rs1197320069 3316 dbSNP
rs1347569233 3326 dbSNP
rs996819029 3338 dbSNP
rs554818518 3339 dbSNP
rs1232770394 3343 dbSNP
rs907980749 3346 dbSNP
rs1029606948 3348 dbSNP
rs1484498130 3351 dbSNP
rs1447522456 3353 dbSNP
rs1204018453 3356 dbSNP
rs1329207794 3359 dbSNP
rs575001800 3364 dbSNP
rs1413490376 3373 dbSNP
rs1464373768 3378 dbSNP
rs747602563 3386 dbSNP
rs771761285 3388 dbSNP
rs900370732 3393 dbSNP
rs1438485843 3394 dbSNP
rs113856334 3395 dbSNP
rs977307861 3396 dbSNP
rs1409222956 3398 dbSNP
rs1444676368 3400 dbSNP
rs1456274031 3405 dbSNP
rs931798448 3414 dbSNP
rs957236790 3415 dbSNP
rs1288355303 3417 dbSNP
rs1241220116 3418 dbSNP
rs117378597 3419 dbSNP
rs557420293 3424 dbSNP
rs1450098351 3427 dbSNP
rs999208837 3433 dbSNP
rs1333459730 3435 dbSNP
rs368626979 3436 dbSNP
rs565735102 3440 dbSNP
rs915682303 3448 dbSNP
rs545017141 3449 dbSNP
rs1418785718 3461 dbSNP
rs565196299 3462 dbSNP
rs1290449871 3463 dbSNP
rs1472854067 3469 dbSNP
rs527548702 3470 dbSNP
rs1265877075 3471 dbSNP
rs1013377957 3479 dbSNP
rs541245171 3480 dbSNP
rs1488112951 3481 dbSNP
rs1284169518 3488 dbSNP
rs1047345096 3489 dbSNP
rs970281004 3503 dbSNP
rs1283470307 3508 dbSNP
rs1005729129 3514 dbSNP
rs560882696 3516 dbSNP
rs1342141606 3517 dbSNP
rs1278653746 3522 dbSNP
rs1314510585 3529 dbSNP
rs1398985673 3531 dbSNP
rs1358182968 3537 dbSNP
rs1208638051 3538 dbSNP
rs1325155079 3541 dbSNP
rs146567990 3544 dbSNP
rs1038918193 3547 dbSNP
rs899945589 3554 dbSNP
rs996881476 3556 dbSNP
rs980222398 3560 dbSNP
rs1163183764 3577 dbSNP
rs1027883150 3581 dbSNP
rs1237329639 3587 dbSNP
rs952271517 3597 dbSNP
rs1184731343 3598 dbSNP
rs759086442 3609 dbSNP
rs1289335162 3611 dbSNP
rs1474092443 3611 dbSNP
rs998779646 3611 dbSNP
rs1472046164 3614 dbSNP
rs1172694992 3617 dbSNP
rs1031602625 3618 dbSNP
rs1412746676 3627 dbSNP
rs957492476 3632 dbSNP
rs990023685 3641 dbSNP
rs1023206160 3642 dbSNP
rs969829410 3645 dbSNP
rs1175287293 3661 dbSNP
rs1276236059 3668 dbSNP
rs1436835985 3669 dbSNP
rs1329970555 3676 dbSNP
rs1321065725 3681 dbSNP
rs549442235 3684 dbSNP
rs1172014018 3694 dbSNP
rs928329343 3698 dbSNP
rs1417890774 3700 dbSNP
rs1305903781 3703 dbSNP
rs1193136101 3709 dbSNP
rs1478504872 3711 dbSNP
rs928962154 3713 dbSNP
rs1191772446 3715 dbSNP
rs538049973 3717 dbSNP
rs868469820 3724 dbSNP
rs1258559537 3728 dbSNP
rs1197995624 3732 dbSNP
rs1348919396 3733 dbSNP
rs569357602 3739 dbSNP
rs531971268 3744 dbSNP
rs1275587060 3745 dbSNP
rs1280520583 3751 dbSNP
rs1219425934 3752 dbSNP
rs1347205174 3761 dbSNP
rs551846704 3771 dbSNP
rs976224343 3773 dbSNP
rs1217493723 3775 dbSNP
rs921995677 3783 dbSNP
rs931857221 3789 dbSNP
rs1043554969 3796 dbSNP
rs1446784477 3797 dbSNP
rs1353092216 3801 dbSNP
rs566365471 3815 dbSNP
rs1178756344 3827 dbSNP
rs1177897421 3830 dbSNP
rs1238939695 3830 dbSNP
rs1239157232 3830 dbSNP
rs1415426109 3830 dbSNP
rs1441561242 3830 dbSNP
rs1479645580 3830 dbSNP
rs199719351 3830 dbSNP
rs756486272 3830 dbSNP
rs771154841 3830 dbSNP
rs908809919 3831 dbSNP
rs1441633026 3832 dbSNP
rs1277676090 3833 dbSNP
rs925203088 3836 dbSNP
rs935200669 3838 dbSNP
rs1418481961 3839 dbSNP
rs1240033530 3840 dbSNP
rs1343433036 3841 dbSNP
rs1305144503 3843 dbSNP
rs34859483 3843 dbSNP
rs1052349861 3844 dbSNP
rs1158072560 3845 dbSNP
rs1380975516 3845 dbSNP
rs200457153 3845 dbSNP
rs1013656793 3846 dbSNP
rs111807242 3847 dbSNP
rs1182387296 3847 dbSNP
rs1218305151 3847 dbSNP
rs766837016 3847 dbSNP
rs769953794 3847 dbSNP
rs796648293 3847 dbSNP
rs112669708 3848 dbSNP
rs10583722 3849 dbSNP
rs1323004052 3849 dbSNP
rs1361366328 3849 dbSNP
rs1382828806 3849 dbSNP
rs1402266211 3849 dbSNP
rs28408467 3849 dbSNP
rs796576566 3849 dbSNP
rs1297821375 3851 dbSNP
rs201293571 3851 dbSNP
rs537590792 3853 dbSNP
rs1190082518 3855 dbSNP
rs932784623 3856 dbSNP
rs1415370492 3860 dbSNP
rs1195518727 3862 dbSNP
rs1390735882 3863 dbSNP
rs952302399 3864 dbSNP
rs1166526965 3865 dbSNP
rs1184420646 3865 dbSNP
rs998830561 3866 dbSNP
rs754465365 3867 dbSNP
rs771756116 3867 dbSNP
rs1222919392 3869 dbSNP
rs1265556740 3869 dbSNP
rs1409670158 3870 dbSNP
rs77320580 3870 dbSNP
rs1380808206 3871 dbSNP
rs191295012 3871 dbSNP
rs879877915 3871 dbSNP
rs893080764 3871 dbSNP
rs2906177 3873 dbSNP
rs966098411 3874 dbSNP
rs976468708 3875 dbSNP
rs1172737629 3876 dbSNP
rs1011900066 3877 dbSNP
rs1422732777 3878 dbSNP
rs200601072 3879 dbSNP
rs1267637000 3880 dbSNP
rs539826814 3883 dbSNP
rs1366606512 3886 dbSNP
rs1231249833 3888 dbSNP
rs62444203 3891 dbSNP
rs979267369 3895 dbSNP
rs925067301 3898 dbSNP
rs1035449500 3900 dbSNP
rs935145467 3910 dbSNP
rs1314117436 3916 dbSNP
rs1052381794 3922 dbSNP
rs1440185310 3924 dbSNP
rs983160608 3928 dbSNP
rs917809496 3929 dbSNP
rs949099341 3932 dbSNP
rs572318297 3935 dbSNP
rs1165888566 3936 dbSNP
rs904950751 3940 dbSNP
rs1467419130 3941 dbSNP
rs921484745 3943 dbSNP
rs1174927469 3945 dbSNP
rs1452015632 3948 dbSNP
rs1299004137 3954 dbSNP
rs932835342 3955 dbSNP
rs540950095 3961 dbSNP
rs891235835 3964 dbSNP
rs934733854 3965 dbSNP
rs1053159335 3967 dbSNP
rs1256751723 3968 dbSNP
rs1233917076 3972 dbSNP
rs893122505 3974 dbSNP
rs1311609849 3984 dbSNP
rs995180007 3985 dbSNP
rs1011537890 3986 dbSNP
rs1335054139 3987 dbSNP
rs1326773979 3991 dbSNP
rs1397500818 3996 dbSNP
rs1048130967 4001 dbSNP
rs1023310864 4002 dbSNP
rs887978488 4006 dbSNP
rs1002723283 4008 dbSNP
rs149760008 4012 dbSNP
rs1403782639 4013 dbSNP
rs1363664505 4016 dbSNP
rs1325381904 4017 dbSNP
rs184882998 4018 dbSNP
rs1425910978 4020 dbSNP
rs1015197811 4021 dbSNP
rs950474649 4032 dbSNP
rs761849537 4038 dbSNP
rs966670583 4040 dbSNP
rs1296052849 4042 dbSNP
rs1484843447 4045 dbSNP
rs1005038989 4048 dbSNP
rs1326315368 4049 dbSNP
rs1217346133 4053 dbSNP
rs1350062273 4057 dbSNP
rs767613092 4059 dbSNP
rs1246984663 4060 dbSNP
rs542543619 4064 dbSNP
rs1292499395 4065 dbSNP
rs997538902 4068 dbSNP
rs1412727689 4078 dbSNP
rs1029374083 4079 dbSNP
rs974408627 4081 dbSNP
rs953444369 4084 dbSNP
rs1382215577 4087 dbSNP
rs750592523 4095 dbSNP
rs574287901 4098 dbSNP
rs1419003372 4104 dbSNP
rs1187628949 4110 dbSNP
rs1474432937 4114 dbSNP
rs560601160 4120 dbSNP
rs543152191 4121 dbSNP
rs988356075 4122 dbSNP
rs1232299121 4142 dbSNP
rs1356901078 4145 dbSNP
rs1272506571 4154 dbSNP
rs1231156644 4156 dbSNP
rs917856273 4157 dbSNP
rs912721600 4158 dbSNP
rs1429676842 4174 dbSNP
rs1465874870 4183 dbSNP
rs934799920 4187 dbSNP
rs1325012171 4188 dbSNP
rs1053614762 4190 dbSNP
rs368347729 4191 dbSNP
rs189779530 4192 dbSNP
rs949295532 4196 dbSNP
rs145715660 4203 dbSNP
rs1260998715 4206 dbSNP
rs552172264 4208 dbSNP
rs930971471 4210 dbSNP
rs1048157929 4211 dbSNP
rs1201042279 4223 dbSNP
rs886839465 4226 dbSNP
rs940879014 4229 dbSNP
rs1468971076 4234 dbSNP
rs1002775669 4237 dbSNP
rs1057030571 4239 dbSNP
rs1366490517 4241 dbSNP
rs886277740 4246 dbSNP
rs559070768 4251 dbSNP
rs1213607501 4256 dbSNP
rs1276250787 4257 dbSNP
rs1164495754 4259 dbSNP
rs1004687720 4269 dbSNP
rs528809983 4270 dbSNP
rs766127461 4272 dbSNP
rs192982115 4273 dbSNP
rs996268370 4276 dbSNP
rs568711978 4277 dbSNP
rs115090940 4279 dbSNP
rs1384936751 4297 dbSNP
rs551150370 4308 dbSNP
rs570981811 4311 dbSNP
rs1029243287 4329 dbSNP
rs185270864 4335 dbSNP
rs1336635494 4343 dbSNP
rs987009195 4346 dbSNP
rs912774340 4347 dbSNP
rs553363814 4350 dbSNP
rs765068496 4354 dbSNP
rs1191641314 4355 dbSNP
rs988965986 4359 dbSNP
rs1288597069 4366 dbSNP
rs1203511458 4369 dbSNP
rs554571629 4371 dbSNP
rs914658482 4372 dbSNP
rs534962308 4378 dbSNP
rs1295560485 4379 dbSNP
rs554433206 4386 dbSNP
rs574350516 4395 dbSNP
rs1346479846 4397 dbSNP
rs780308770 4404 dbSNP
rs1300687139 4406 dbSNP
rs1345712117 4413 dbSNP
rs1025191732 4415 dbSNP
rs1241711959 4418 dbSNP
rs1202093224 4422 dbSNP
rs1280654465 4423 dbSNP
rs872517 4424 dbSNP
rs1485223894 4427 dbSNP
rs927269659 4439 dbSNP
rs545779380 4447 dbSNP
rs981132265 4454 dbSNP
rs926527678 4455 dbSNP
rs1057080910 4461 dbSNP
rs1473682715 4464 dbSNP
rs931002361 4469 dbSNP
rs1157063349 4471 dbSNP
rs1408547912 4473 dbSNP
rs149005704 4475 dbSNP
rs1468401793 4476 dbSNP
rs983725712 4478 dbSNP
rs2398633 4481 dbSNP
rs1485111855 4484 dbSNP
rs1037523350 4485 dbSNP
rs1218080126 4491 dbSNP
rs1400614579 4492 dbSNP
rs1308323847 4498 dbSNP
rs545559347 4499 dbSNP
rs2398634 4502 dbSNP
rs528066742 4503 dbSNP
rs1415811133 4509 dbSNP
rs549602378 4510 dbSNP
rs1407607576 4513 dbSNP
rs1421576118 4515 dbSNP
rs933492151 4515 dbSNP
rs1050691127 4519 dbSNP
rs1019836664 4527 dbSNP
rs1331190710 4530 dbSNP
rs562373775 4532 dbSNP
rs989406137 4533 dbSNP
rs1021780250 4536 dbSNP
rs748059272 4538 dbSNP
rs113164792 4541 dbSNP
rs754020723 4544 dbSNP
rs1215681749 4545 dbSNP
rs1276477358 4552 dbSNP
rs1315606207 4555 dbSNP
rs1484198715 4568 dbSNP
rs1234215641 4576 dbSNP
rs1175690757 4581 dbSNP
rs1250015881 4589 dbSNP
rs1433851638 4597 dbSNP
rs1291660311 4598 dbSNP
rs112698760 4606 dbSNP
rs1393835126 4618 dbSNP
rs188743167 4621 dbSNP
rs1288312591 4625 dbSNP
rs1428759662 4626 dbSNP
rs907807120 4627 dbSNP
rs1165578256 4628 dbSNP
rs940605248 4635 dbSNP
rs1025051898 4636 dbSNP
rs1037973506 4639 dbSNP
rs970994403 4640 dbSNP
rs1260640761 4646 dbSNP
rs1002023622 4649 dbSNP
rs1184219850 4659 dbSNP
rs1033573281 4662 dbSNP
rs898996036 4664 dbSNP
rs1169695255 4665 dbSNP
rs931776135 4666 dbSNP
rs1271711960 4670 dbSNP
rs1230096348 4671 dbSNP
rs1308259335 4673 dbSNP
rs1295129699 4676 dbSNP
rs1212821075 4681 dbSNP
rs1373363455 4683 dbSNP
rs952599653 4684 dbSNP
rs1050141328 4695 dbSNP
rs890174664 4698 dbSNP
rs112864581 4703 dbSNP
rs1462338527 4707 dbSNP
rs908179482 4718 dbSNP
rs529059324 4720 dbSNP
rs892068834 4739 dbSNP
rs566896776 4749 dbSNP
rs1194775334 4753 dbSNP
rs535489577 4754 dbSNP
rs17132410 4755 dbSNP
rs922359200 4757 dbSNP
rs1298532115 4776 dbSNP
rs568035288 4779 dbSNP
rs1229048269 4780 dbSNP
rs35499154 4785 dbSNP
rs968923281 4787 dbSNP
rs749592788 4788 dbSNP
rs1050555031 4789 dbSNP
rs910814572 4790 dbSNP
rs1309069723 4791 dbSNP
rs1391702591 4793 dbSNP
rs936870193 4799 dbSNP
rs1034454425 4808 dbSNP
rs1436252352 4811 dbSNP
rs960095322 4812 dbSNP
rs1251003034 4814 dbSNP
rs1488903923 4818 dbSNP
rs1393744749 4822 dbSNP
rs992858434 4823 dbSNP
rs373740140 4829 dbSNP
rs940643639 4831 dbSNP
rs1194275706 4835 dbSNP
rs1211766710 4838 dbSNP
rs892497197 4839 dbSNP
rs869727 4842 dbSNP
rs1046939754 4848 dbSNP
rs1345838360 4858 dbSNP
rs1262411282 4861 dbSNP
rs556766114 4863 dbSNP
rs1050193209 4864 dbSNP
rs774679095 4872 dbSNP
rs576961074 4873 dbSNP
rs1355624986 4884 dbSNP
rs1350159560 4885 dbSNP
rs1459093925 4890 dbSNP
rs772078587 4894 dbSNP
rs1393078940 4899 dbSNP
rs545924900 4901 dbSNP
rs1435121420 4908 dbSNP
rs1363751313 4911 dbSNP
rs1322475872 4912 dbSNP
rs552804636 4915 dbSNP
rs1180421354 4916 dbSNP
rs572851215 4922 dbSNP
rs1005464687 4923 dbSNP
rs1015457312 4929 dbSNP
rs1258424969 4938 dbSNP
rs541870642 4939 dbSNP
rs1189785903 4946 dbSNP
rs961358795 4947 dbSNP
rs1187579126 4948 dbSNP
rs1484731424 4950 dbSNP
rs1213802260 4952 dbSNP
rs1264003580 4952 dbSNP
rs1205813361 4953 dbSNP
rs6149959 4953 dbSNP
rs1258894056 4955 dbSNP
rs1322619206 4956 dbSNP
rs2398635 4957 dbSNP
rs2398636 4958 dbSNP
rs2398637 4959 dbSNP
rs2398638 4961 dbSNP
rs1234843481 4963 dbSNP
rs1292287949 4965 dbSNP
rs561636399 4965 dbSNP
rs565804177 4966 dbSNP
rs1327657789 4967 dbSNP
rs78221968 4970 dbSNP
rs1468093053 4971 dbSNP
rs904755371 4975 dbSNP
rs1384795111 4985 dbSNP
rs564746762 4988 dbSNP
rs77896247 4993 dbSNP
rs1463333933 4996 dbSNP
rs547131929 4999 dbSNP
rs986303493 5000 dbSNP
rs960145637 5007 dbSNP
rs1244086469 5012 dbSNP
rs760806957 5017 dbSNP
rs566855491 5022 dbSNP
rs1015384745 5026 dbSNP
rs1186340654 5027 dbSNP
rs1414971780 5035 dbSNP
rs1272372029 5036 dbSNP
rs1231252943 5044 dbSNP
rs1340991691 5048 dbSNP
rs1270416889 5049 dbSNP
rs1225990419 5051 dbSNP
rs1425249165 5055 dbSNP
rs529360439 5060 dbSNP
rs548981181 5061 dbSNP
rs1395879240 5063 dbSNP
rs568890380 5065 dbSNP
rs1403956645 5072 dbSNP
rs147714703 5088 dbSNP
rs142500450 5089 dbSNP
rs572171199 5090 dbSNP
rs146817114 5091 dbSNP
rs906616099 5093 dbSNP
rs116092479 5095 dbSNP
rs553102275 5096 dbSNP
rs1303285369 5098 dbSNP
rs1219030118 5099 dbSNP
rs888312500 5100 dbSNP
rs913614080 5106 dbSNP
rs1291692267 5110 dbSNP
rs946423220 5112 dbSNP
rs1005327535 5115 dbSNP
rs1229133523 5122 dbSNP
rs1234419375 5132 dbSNP
rs1015946494 5135 dbSNP
rs1303326970 5137 dbSNP
rs373908704 5137 dbSNP
rs572864322 5137 dbSNP
rs998268655 5138 dbSNP
rs1356710028 5139 dbSNP
rs765114183 5144 dbSNP
rs186113656 5145 dbSNP
rs1175554940 5146 dbSNP
rs1001779250 5148 dbSNP
rs375932272 5149 dbSNP
rs1032750487 5150 dbSNP
rs1180624055 5153 dbSNP
rs1481843950 5161 dbSNP
rs1282022434 5162 dbSNP
rs958217624 5168 dbSNP
rs1183770195 5169 dbSNP
rs1278529417 5171 dbSNP
rs1218021785 5184 dbSNP
rs575311245 5195 dbSNP
rs763632517 5196 dbSNP
rs945612842 5210 dbSNP
rs982522173 5211 dbSNP
rs1027597280 5212 dbSNP
rs928026297 5215 dbSNP
rs188232835 5216 dbSNP
rs1402430326 5220 dbSNP
rs756886175 5228 dbSNP
rs986006337 5230 dbSNP
rs1471494016 5236 dbSNP
rs1259157184 5238 dbSNP
rs1188297132 5239 dbSNP
rs888508678 5245 dbSNP
rs941212727 5246 dbSNP
rs780676356 5253 dbSNP
rs1217338658 5255 dbSNP
rs1036833285 5256 dbSNP
rs1355118183 5262 dbSNP
rs148207830 5263 dbSNP
rs998155012 5265 dbSNP
rs1281413064 5266 dbSNP
rs1029988065 5269 dbSNP
rs1228109432 5270 dbSNP
rs946448504 5273 dbSNP
rs889485792 5278 dbSNP
rs180814451 5298 dbSNP
rs1279977788 5301 dbSNP
rs1350627925 5303 dbSNP
rs141208736 5305 dbSNP
rs1280028092 5312 dbSNP
rs1432980015 5324 dbSNP
rs1345651920 5333 dbSNP
rs937622027 5340 dbSNP
rs376183611 5346 dbSNP
rs957079498 5348 dbSNP