miRTarBase - #MIRT023397 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FOXK2   
Synonyms ILF, ILF-1, ILF1
Description forkhead box K2
Transcript NM_004514   
Expression
Putative miRNA Targets on FOXK2
3'UTR of FOXK2
(miRNA target sites are highlighted)
>FOXK2|NM_004514|3'UTR
   1 CGACCGGGAGAGCTTTTCTTTAACGATATCAACTCTGTGGTGCCAAAAGGAGACGCGGCCTCCCGCCAGCACTCGGGGGT
  81 GCAGGGCCCTGTGGTTGGACTTCACCTCTCAGCACTGAAAACCCAAAACCCAGCTGGCCTTAACACTCCTTAAAGACAGA
 161 AGTCACACTTGAACAAAACCCACACACAACAAAACCTGATTTGGGAGACGGTGTCTCCACTGAGCACCTGCTGGGCTGAG
 241 CTTCTACCTACGAGTGAAACTCTGTCCTCCCGCGAGGACCAGGCATCGCTGTGTGAGGACGGCACGGCCAGCGCCTGCTG
 321 TGAGTGGGTCTCCCAAGACTAGGCCTCAGGACGCGGGGGGAGCCATCCCCGCCGCCCTCACAGGACCCACCAGGCAGCGG
 401 AGACATGTGGAATTAGAGTATTTTGAGGTGTCCTTTCTTTACAAAATAATGGGGTCTTGGGCATTTCACATCACTCCATT
 481 TCTACTGAGACTTTCAGAATCACACAGGCCCTTTCCGTGGATTTCATTTGGGGCAAAGAAACAACGTAGTTTTGTTTTTG
 561 TTTTCAGCCTATGGAATGATTTCCTTTTGTCTGTCTTGTTCAAGTTCAGACGAAGCTACTCTGGCATCTGCACATTTCCG
 641 TGTTACAGCAGCTGCCTGATGAATTTTATCCACCTCCATTTCAGCATGTGGCTCGCGTGGACAGGTGGACGGACGCTGTG
 721 GCCGCATGGAACCTTGAGAACCCAGGGACGAGCCAGTGCCGGGAAGGAACTGCCGGGACTCACCGAGCTGCACTTAACTG
 801 TTCTCTTTCTGGCTATTTTTTGTTGTTTGTTTCTTTGTGTTGACTTTGTCCCTGGCAAAATTTTCCACTCTGAGTAAAAC
 881 AAGTCTCCTAAGTATTGTGTATGTTTAAAACGACAGAACCATTTCTACTTCATTTGGAAAAAGATTCAGTCTTTTATCAC
 961 AGGCCCTTTTGAAACTCAGATCCCAGGTCTCTCCGTGGTATGTTTGTATTTGGGGTGTCCCTCCGGCTCTAGGCGGCCTC
1041 TGACCTGCTGTCTACTCCCCACCTTCGGTGAGCGGCCGCCATGGTGGAGCAGGGTCCGAGCCACGTCCTGCAGGGCACGT
1121 CTGGGGCATTTCCTGTTTTGTGGTAGGAAATGTCCCTGACCTTTCAGAACCGAACCCAATCCTGAGGCTGACTCCTCTAC
1201 GGAAAATGAGGACAGGACGGGGGTGAGGGAATGAGAGTGGGAGGTCCCTGCACCTCCTCGCCCGGCTCCTCAGGAAGAAA
1281 ACCGCTGGCCCTTCCCGAGTGTGCCGGCCGAGGGCCGAGGGCCGTGCACATGGGGAGAGGGCGTCAGCCTGATGGCTGAG
1361 CTTTTAAATGTCATCATCATAACATTATTTATTTAAATGTAGTTATTTTGGTATTTAATTTTTTTTTAGAGAGGAAAAAA
1441 CCTGTATTTTCCTGGTGGGATGAAATAGGGATGAAATGGCTCAGAATGGTATATTTAGGCAATTTTAAAACATTTATTAT
1521 TTACATAAAGACCAAATATGATGAATCTGTTCCGTGAATTGTGTCGGCCCTCAGCATGGGGCTGGGGCAGCGTCACTGCG
1601 GTGACGCCCATTGAAAGGTATGAAATGACTGCACACTAGCTGGATTATCACTCAGCCGTTTAAGAAATAAAAGCAAAACC
1681 ATCACGTGACTGAGACCGTGTGTGTGACCGCAGCAAAGCGCAGCGTGTGGATGGATCAGAGCCCCTCGGTGCAGCTGTCT
1761 GCATCTTCCAAGCACTTTACAGATACCTTGGAATGTATATTTTTGTCTTCTTACTCAGAAGGTTTGCAGTTTGTAAAATA
1841 ATCAGGATTCTGCTCTGTCCTGTGTGTGGGGTCAGCTCCCTCCACAGAGGGCTCCAGCTCTGTTGGTCACAGCTGATGGG
1921 GTTCTCTGATTGATAGGAGACGAGCTCTTGAGCTCTAAGGAACAGTGAGGTCGCCGGTGGGGAGCTTGGCTGGGACACCA
2001 AGCAAATGCATCGTATGTCCCCTTGGAGACGTTTTTATGCAGCTGTGTATGTTACTATCCAGAAGGAGTCGGGGGTAGAC
2081 TTTCCCGTGTAAGCTCAGTCCATAAACTGGTTACTTCTGATCCTGGAACGTGGACTTCACATGATAGGTCTGGATCTGTT
2161 TCTGTTGGGATCACAGGTAAGGAAAATGTCCATTCAAATGGTAAAGAAGGGAGGAGGGTGTTTTTTTTTTTTTTTTTTGC
2241 CGTAGGCACCATTCTGCATCTTGAACCCAGACTGAAGTGTGCCTCTCACAGATGGAAGGTGCACACGCTCCTGTCTCCTC
2321 CTCACTCTGCCACGTTCACTTGGCTTTTTCATTGGTACCTAGGAATTTAAGAATATCGAAGCGAGAGCAGTAACAAACCA
2401 TAGATGAGCAGACTCCCACACCGGGTTTTCTTGCCCGTCTTTAAGGCACTGTTTCTAAATTTTGAACTTAGCTCTGAATC
2481 CCCAAGAACTTGAGCACAGCAAGGGTTGCTGAGCTGCTGTCGCCGCAGCCCTGGCCCCTGGTGCTGGAGCTGCAGCACCT
2561 TTGGGAGAGGTCCTGCGTCGTCCTCAGCTGCGTCGCTGTGAACTCCCGCTCTCCACTGTGTTCCTCAGTGTCTGCTTTTC
2641 AGGAAGTCTGCTGTGACCTTTGCCCAACTTCTGAGCTCCTCAGGGACTAGGAACAATTTCAGTAGCTTTGCCCTGAACCA
2721 AACGAGAAAACAAAAGGGAACTCCCGTATGACCCACGTCACGTGGTGCACTCAGAGTGTGTGCGGCATGATCCTCGGTTG
2801 CTCCTCCTCTCACTTTAGTAGAGTACGCGGTGGACAGCTGATCTCCTTCAGTCGTCTACCCACTTCCGTCATTGTCCTCC
2881 GCTAGAATAACAGAGTAGTTGGTAGTCATGGCCAGAAGGGGGGTGGGGGCAGTGTGAGGACTTGGGGTTTCTGTGCTGTG
2961 TGACACAAGGAGATAAGTGACAATCTTGAAGTCCTAACTTCCACTATTCTAGAAAGTATAGTGGTGATTTGTGTGCAAAG
3041 ATTTGAAGTTTTAAAAAAGTACCAAGTTCCTGAAATTCAATAAAATATTTTTATTAATTTTAATGGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC----AGUGUGAGGu 5'
            ||| | : ||    | ||||||| 
Target 5' aaAACCCAGCTGGCCTTAACACTCCt 3'
125 - 150 150.00 -15.00
2
miRNA  3' guUUG--UGGUA---AC-AGUGUGAGGu 5'
            |||  |||||   ||  || ||||| 
Target 5' gtAACAAACCATAGATGAGCAGACTCCc 3'
2390 - 2417 130.00 -14.00
3
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       |||:|||| 
Target 5' gatggaaggtgcaCACGCTCCt 3'
2291 - 2312 129.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26976663 5 COSMIC
COSN31610684 6 COSMIC
COSN26976664 26 COSMIC
COSN30542137 55 COSMIC
COSN30727223 56 COSMIC
COSN31958033 57 COSMIC
COSN30744366 66 COSMIC
COSN30104941 68 COSMIC
COSN24306157 168 COSMIC
COSN16131251 218 COSMIC
COSN7457320 399 COSMIC
COSN16131296 433 COSMIC
COSN21305075 479 COSMIC
COSN7457321 789 COSMIC
COSN7457322 926 COSMIC
COSN31485299 1311 COSMIC
COSN29773528 1428 COSMIC
COSN30543810 1469 COSMIC
COSN30539207 1485 COSMIC
COSN29404960 1539 COSMIC
COSN17467507 1686 COSMIC
COSN21511288 1817 COSMIC
COSN20093395 1896 COSMIC
COSN20093396 2014 COSMIC
COSN17183244 2046 COSMIC
COSN27294726 2236 COSMIC
COSN20114535 2237 COSMIC
COSN29636524 2548 COSMIC
COSN32065243 2556 COSMIC
COSN19417309 2692 COSMIC
COSN31961394 2724 COSMIC
COSN28643573 2797 COSMIC
COSN28707538 2845 COSMIC
COSN28706242 2846 COSMIC
COSN31592830 2862 COSMIC
COSN26647788 2869 COSMIC
COSN31541316 2970 COSMIC
COSN30008220 3094 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs975972200 2 dbSNP
rs780334494 3 dbSNP
rs931088204 4 dbSNP
rs184940854 6 dbSNP
rs768711994 7 dbSNP
rs889481059 11 dbSNP
rs1156364942 13 dbSNP
rs774465946 14 dbSNP
rs1007127665 22 dbSNP
rs547879686 25 dbSNP
rs369200935 26 dbSNP
rs761242202 27 dbSNP
rs1049813251 31 dbSNP
rs1285724279 32 dbSNP
rs1332236743 33 dbSNP
rs1238413899 34 dbSNP
rs766858659 35 dbSNP
rs1352954187 36 dbSNP
rs777065904 39 dbSNP
rs1010825015 40 dbSNP
rs1291358530 43 dbSNP
rs761381326 51 dbSNP
rs762456803 52 dbSNP
rs1381289266 53 dbSNP
rs1020492229 55 dbSNP
rs1456721465 57 dbSNP
rs1237735101 58 dbSNP
rs889852255 60 dbSNP
rs968766712 62 dbSNP
rs978845373 63 dbSNP
rs189785327 65 dbSNP
rs1166272082 67 dbSNP
rs1358588667 71 dbSNP
rs180985046 75 dbSNP
rs1355606693 76 dbSNP
rs1374398002 78 dbSNP
rs1469392109 80 dbSNP
rs771769691 84 dbSNP
rs1278573610 85 dbSNP
rs570341778 88 dbSNP
rs868665797 89 dbSNP
rs1351083770 91 dbSNP
rs1321064571 94 dbSNP
rs917834081 98 dbSNP
rs767274684 108 dbSNP
rs1010454426 124 dbSNP
rs1361689122 140 dbSNP
rs949206106 146 dbSNP
rs779657233 147 dbSNP
rs1380147548 158 dbSNP
rs111902444 163 dbSNP
rs1479158733 167 dbSNP
rs879211507 180 dbSNP
rs559533646 190 dbSNP
rs1286573614 197 dbSNP
rs931035671 197 dbSNP
rs1034046622 202 dbSNP
rs1351224466 206 dbSNP
rs1283343670 208 dbSNP
rs1048192941 210 dbSNP
rs951879517 211 dbSNP
rs1403732362 212 dbSNP
rs528464541 218 dbSNP
rs1300584103 222 dbSNP
rs1014668949 229 dbSNP
rs961859222 232 dbSNP
rs1418453162 241 dbSNP
rs1041262470 243 dbSNP
rs1177182848 244 dbSNP
rs1416552649 246 dbSNP
rs1423250253 248 dbSNP
rs1190838888 249 dbSNP
rs1275089406 249 dbSNP
rs1318466112 250 dbSNP
rs901420716 252 dbSNP
rs139538611 253 dbSNP
rs1241467230 260 dbSNP
rs142616980 260 dbSNP
rs1260730278 262 dbSNP
rs568275623 263 dbSNP
rs923211420 265 dbSNP
rs34611296 272 dbSNP
rs1187903758 273 dbSNP
rs1222596449 275 dbSNP
rs368403780 288 dbSNP
rs1279598431 289 dbSNP
rs985854388 299 dbSNP
rs911262554 300 dbSNP
rs936081640 301 dbSNP
rs547409117 302 dbSNP
rs913369836 306 dbSNP
rs946211385 307 dbSNP
rs1045953932 313 dbSNP
rs907434276 314 dbSNP
rs78435800 322 dbSNP
rs1168560376 325 dbSNP
rs1428028518 331 dbSNP
rs952539657 336 dbSNP
rs878991207 341 dbSNP
rs1470341559 343 dbSNP
rs1055863667 353 dbSNP
rs1317971826 354 dbSNP
rs1202618328 355 dbSNP
rs149691901 355 dbSNP
rs1005892153 356 dbSNP
rs1428431556 359 dbSNP
rs145353578 364 dbSNP
rs942466592 370 dbSNP
rs112887170 371 dbSNP
rs1336537831 372 dbSNP
rs922321658 374 dbSNP
rs544828112 375 dbSNP
rs556670746 376 dbSNP
rs1461494262 380 dbSNP
rs1369197538 390 dbSNP
rs773479256 392 dbSNP
rs762202489 394 dbSNP
rs1383332538 395 dbSNP
rs1182711182 397 dbSNP
rs763103127 399 dbSNP
rs986104789 400 dbSNP
rs1239560718 403 dbSNP
rs904670761 405 dbSNP
rs1325143797 407 dbSNP
rs1000327211 410 dbSNP
rs1200515743 414 dbSNP
rs749231568 415 dbSNP
rs894560630 415 dbSNP
rs529907440 421 dbSNP
rs957403651 422 dbSNP
rs867901281 431 dbSNP
rs1379591963 438 dbSNP
rs1217433671 445 dbSNP
rs1391520373 451 dbSNP
rs766451285 453 dbSNP
rs990205889 455 dbSNP
rs185408813 457 dbSNP
rs1456486788 459 dbSNP
rs751554311 460 dbSNP
rs542500646 461 dbSNP
rs189721796 469 dbSNP
rs962091077 470 dbSNP
rs1281135154 473 dbSNP
rs1179181773 488 dbSNP
rs200152237 500 dbSNP
rs1267636726 502 dbSNP
rs376524125 503 dbSNP
rs181946069 504 dbSNP
rs1291616482 506 dbSNP
rs1218059841 509 dbSNP
rs1356258994 510 dbSNP
rs1480832445 512 dbSNP
rs994464001 513 dbSNP
rs796502309 517 dbSNP
rs946140923 518 dbSNP
rs1045923303 521 dbSNP
rs1303687778 528 dbSNP
rs1402680664 529 dbSNP
rs1302470890 530 dbSNP
rs1420269394 534 dbSNP
rs1362191542 543 dbSNP
rs1156539244 546 dbSNP
rs928856204 556 dbSNP
rs768541102 557 dbSNP
rs1479162509 558 dbSNP
rs937547633 566 dbSNP
rs1195005754 583 dbSNP
rs952486625 584 dbSNP
rs1260302465 590 dbSNP
rs983954302 593 dbSNP
rs1346171686 595 dbSNP
rs1056058485 596 dbSNP
rs1257974995 598 dbSNP
rs887411646 603 dbSNP
rs1322868938 609 dbSNP
rs1005859613 612 dbSNP
rs1360930649 613 dbSNP
rs549567113 621 dbSNP
rs563856361 623 dbSNP
rs1223195116 626 dbSNP
rs1316134915 639 dbSNP
rs1381384327 640 dbSNP
rs760112646 641 dbSNP
rs3198629 649 dbSNP
rs1301273516 650 dbSNP
rs1428193986 671 dbSNP
rs531267686 679 dbSNP
rs767960287 687 dbSNP
rs1036012069 689 dbSNP
rs753219729 694 dbSNP
rs997255035 695 dbSNP
rs549571347 696 dbSNP
rs953243451 697 dbSNP
rs1041917728 701 dbSNP
rs1007858097 704 dbSNP
rs936296564 711 dbSNP
rs1032275762 712 dbSNP
rs894675104 715 dbSNP
rs568246085 716 dbSNP
rs1490305045 724 dbSNP
rs1045832481 725 dbSNP
rs957335891 727 dbSNP
rs1340822400 728 dbSNP
rs897787955 729 dbSNP
rs1452724612 737 dbSNP
rs1331631479 743 dbSNP
rs529205464 746 dbSNP
rs913268423 747 dbSNP
rs1037732651 750 dbSNP
rs967451041 751 dbSNP
rs547645676 754 dbSNP
rs981525060 755 dbSNP
rs1159546622 757 dbSNP
rs1370721880 760 dbSNP
rs1384825533 761 dbSNP
rs565806201 762 dbSNP
rs1161481850 766 dbSNP
rs534199320 769 dbSNP
rs1200819395 771 dbSNP
rs558950144 775 dbSNP
rs1387294568 776 dbSNP
rs570961043 782 dbSNP
rs1210533597 783 dbSNP
rs1356914670 786 dbSNP
rs1328023459 791 dbSNP
rs1317080202 794 dbSNP
rs756616216 796 dbSNP
rs1381839353 804 dbSNP
rs1443722051 814 dbSNP
rs765727615 816 dbSNP
rs1443971423 820 dbSNP
rs569469187 823 dbSNP
rs963930636 823 dbSNP
rs55831128 829 dbSNP
rs11558343 830 dbSNP
rs1393433655 832 dbSNP
rs1309593130 834 dbSNP
rs1381392402 834 dbSNP
rs1358245795 838 dbSNP
rs976878848 840 dbSNP
rs1199586584 845 dbSNP
rs1453413943 849 dbSNP
rs1243271519 856 dbSNP
rs1294426304 867 dbSNP
rs909447751 872 dbSNP
rs1357421923 890 dbSNP
rs1358420375 900 dbSNP
rs1029421252 901 dbSNP
rs942317075 907 dbSNP
rs867948261 912 dbSNP
rs1035979467 913 dbSNP
rs538338503 915 dbSNP
rs1271495584 921 dbSNP
rs1439686727 923 dbSNP
rs897534730 927 dbSNP
rs977053188 928 dbSNP
rs1346911855 930 dbSNP
rs1242571346 932 dbSNP
rs118072068 933 dbSNP
rs758081138 935 dbSNP
rs1399325756 938 dbSNP
rs1407454272 947 dbSNP
rs1173433452 950 dbSNP
rs1051532215 962 dbSNP
rs1266911191 963 dbSNP
rs888919606 966 dbSNP
rs1197158127 974 dbSNP
rs1007413212 976 dbSNP
rs1185590810 980 dbSNP
rs1032615685 988 dbSNP
rs1458218497 989 dbSNP
rs893718593 990 dbSNP
rs187193884 995 dbSNP
rs1394218683 996 dbSNP
rs950255584 998 dbSNP
rs1466767539 999 dbSNP
rs1020255758 1007 dbSNP
rs542188252 1016 dbSNP
rs1381340075 1025 dbSNP
rs897908489 1026 dbSNP
rs981904056 1028 dbSNP
rs1471104565 1034 dbSNP
rs1035796667 1035 dbSNP
rs1175755924 1036 dbSNP
rs1188273179 1045 dbSNP
rs765885282 1045 dbSNP
rs751100372 1046 dbSNP
rs8795 1047 dbSNP
rs1210360621 1048 dbSNP
rs1018218506 1053 dbSNP
rs1202421883 1055 dbSNP
rs899629887 1055 dbSNP
rs942284659 1056 dbSNP
rs1318070175 1057 dbSNP
rs1298366760 1059 dbSNP
rs1213365646 1061 dbSNP
rs1361668500 1063 dbSNP
rs1268976251 1067 dbSNP
rs972291600 1068 dbSNP
rs918892091 1069 dbSNP
rs1199769611 1071 dbSNP
rs1262606400 1074 dbSNP
rs933003362 1075 dbSNP
rs572371626 1078 dbSNP
rs1257110169 1079 dbSNP
rs977167834 1083 dbSNP
rs1032620363 1088 dbSNP
rs545405797 1092 dbSNP
rs957051517 1097 dbSNP
rs563695157 1098 dbSNP
rs943144430 1101 dbSNP
rs1201847901 1102 dbSNP
rs1307382572 1103 dbSNP
rs1053622140 1105 dbSNP
rs1291229914 1106 dbSNP
rs893644852 1107 dbSNP
rs916169720 1108 dbSNP
rs1381120882 1113 dbSNP
rs143920542 1118 dbSNP
rs1020895671 1119 dbSNP
rs4822 1120 dbSNP
rs1296476279 1122 dbSNP
rs1353797466 1123 dbSNP
rs1461573444 1123 dbSNP
rs28708773 1126 dbSNP
rs1426309865 1128 dbSNP
rs755851081 1129 dbSNP
rs929357975 1139 dbSNP
rs1049193489 1140 dbSNP
rs1419249066 1144 dbSNP
rs529105681 1151 dbSNP
rs943358795 1153 dbSNP
rs958811260 1155 dbSNP
rs992023147 1157 dbSNP
rs1225455761 1158 dbSNP
rs998545136 1162 dbSNP
rs1291570140 1167 dbSNP
rs769589686 1172 dbSNP
rs772923061 1173 dbSNP
rs1381268128 1180 dbSNP
rs1305138996 1196 dbSNP
rs1390876821 1200 dbSNP
rs763194756 1201 dbSNP
rs771093339 1202 dbSNP
rs1406745344 1204 dbSNP
rs1363659561 1206 dbSNP
rs903036466 1209 dbSNP
rs1454122362 1211 dbSNP
rs919530272 1215 dbSNP
rs955155467 1219 dbSNP
rs1283200592 1220 dbSNP
rs547239876 1228 dbSNP
rs77988312 1229 dbSNP
rs910248654 1232 dbSNP
rs1206023145 1233 dbSNP
rs1023089793 1235 dbSNP
rs971662124 1236 dbSNP
rs943092969 1237 dbSNP
rs533214639 1238 dbSNP
rs1285213660 1241 dbSNP
rs1053952091 1243 dbSNP
rs191763615 1244 dbSNP
rs570849533 1245 dbSNP
rs538377136 1249 dbSNP
rs984839796 1250 dbSNP
rs1386957517 1258 dbSNP
rs1203564274 1260 dbSNP
rs1042267910 1261 dbSNP
rs906434921 1264 dbSNP
rs1003905027 1265 dbSNP
rs1489108156 1268 dbSNP
rs1057130731 1269 dbSNP
rs1460280964 1274 dbSNP
rs894470016 1284 dbSNP
rs1429132606 1285 dbSNP
rs1012969763 1295 dbSNP
rs1430632728 1295 dbSNP
rs796291911 1297 dbSNP
rs923294202 1298 dbSNP
rs146870118 1306 dbSNP
rs902994610 1306 dbSNP
rs933903274 1306 dbSNP
rs998651956 1308 dbSNP
rs993609185 1310 dbSNP
rs1377651899 1311 dbSNP
rs140706459 1314 dbSNP
rs754203656 1317 dbSNP
rs1327960755 1323 dbSNP
rs775625239 1324 dbSNP
rs536062710 1325 dbSNP
rs910183555 1326 dbSNP
rs747005703 1331 dbSNP
rs1406270989 1332 dbSNP
rs757008277 1333 dbSNP
rs1022612335 1334 dbSNP
rs1168973871 1335 dbSNP
rs971489203 1335 dbSNP
rs111282007 1336 dbSNP
rs1344136157 1343 dbSNP
rs1371879366 1344 dbSNP
rs1003099513 1346 dbSNP
rs914975900 1348 dbSNP
rs1245181574 1350 dbSNP
rs950821815 1352 dbSNP
rs554033908 1355 dbSNP
rs1273866655 1359 dbSNP
rs1237154764 1362 dbSNP
rs909414075 1371 dbSNP
rs1355656888 1376 dbSNP
rs964776714 1383 dbSNP
rs1217037096 1384 dbSNP
rs1267872010 1385 dbSNP
rs1042236291 1387 dbSNP
rs1192796287 1395 dbSNP
rs927827825 1400 dbSNP
rs1328896930 1402 dbSNP
rs1411157789 1403 dbSNP
rs923270907 1404 dbSNP
rs939244524 1412 dbSNP
rs35013350 1415 dbSNP
rs1050989636 1419 dbSNP
rs1055459089 1419 dbSNP
rs557599468 1419 dbSNP
rs934613828 1424 dbSNP
rs1183999391 1428 dbSNP
rs894448178 1428 dbSNP
rs1013352956 1432 dbSNP
rs1037692344 1434 dbSNP
rs11368566 1435 dbSNP
rs1248313670 1441 dbSNP
rs1204395911 1442 dbSNP
rs948474773 1452 dbSNP
rs1049790648 1457 dbSNP
rs899244250 1468 dbSNP
rs993578473 1469 dbSNP
rs1443721839 1471 dbSNP
rs1026400197 1489 dbSNP
rs890625773 1490 dbSNP
rs1006506283 1492 dbSNP
rs1016423050 1495 dbSNP
rs1368032024 1495 dbSNP
rs572410534 1499 dbSNP
rs1389725702 1500 dbSNP
rs964891145 1507 dbSNP
rs1408913686 1508 dbSNP
rs1160574788 1509 dbSNP
rs1468663886 1510 dbSNP
rs879116569 1512 dbSNP
rs1363345956 1513 dbSNP
rs1311798127 1514 dbSNP
rs879230408 1518 dbSNP
rs1490481506 1520 dbSNP
rs1377884946 1525 dbSNP
rs1245461322 1527 dbSNP
rs1270965538 1531 dbSNP
rs974823451 1533 dbSNP
rs1450876914 1537 dbSNP
rs1284510095 1538 dbSNP
rs183611112 1554 dbSNP
rs145655699 1555 dbSNP
rs1287111330 1560 dbSNP
rs965012795 1562 dbSNP
rs989133700 1566 dbSNP
rs1022003119 1567 dbSNP
rs1436193145 1573 dbSNP
rs923974622 1578 dbSNP
rs1320508190 1580 dbSNP
rs966446895 1582 dbSNP
rs1265951012 1584 dbSNP
rs754503693 1592 dbSNP
rs914378341 1597 dbSNP
rs559781596 1600 dbSNP
rs1431328884 1601 dbSNP
rs939195060 1606 dbSNP
rs990730693 1607 dbSNP
rs1242541996 1611 dbSNP
rs1217708061 1614 dbSNP
rs1182533585 1617 dbSNP
rs916468259 1622 dbSNP
rs1267112018 1623 dbSNP
rs1203682576 1629 dbSNP
rs573221532 1629 dbSNP
rs1407431784 1631 dbSNP
rs1281927602 1632 dbSNP
rs542228451 1637 dbSNP
rs1219199970 1642 dbSNP
rs1047416128 1643 dbSNP
rs886128870 1658 dbSNP
rs1006452260 1659 dbSNP
rs1337703185 1660 dbSNP
rs1470993359 1661 dbSNP
rs1166182582 1662 dbSNP
rs543020621 1665 dbSNP
rs748016303 1665 dbSNP
rs1354439866 1666 dbSNP
rs1404048235 1669 dbSNP
rs561834746 1671 dbSNP
rs1173847680 1675 dbSNP
rs1333473887 1676 dbSNP
rs1420182997 1680 dbSNP
rs188114807 1680 dbSNP
rs1333805015 1681 dbSNP
rs541222723 1686 dbSNP
rs1183893031 1687 dbSNP
rs559583452 1689 dbSNP
rs1260649086 1691 dbSNP
rs756004696 1692 dbSNP
rs1308527283 1695 dbSNP
rs533305713 1698 dbSNP
rs978173420 1699 dbSNP
rs1213161234 1702 dbSNP
rs573955468 1710 dbSNP
rs151033563 1711 dbSNP
rs890603948 1720 dbSNP
rs958045276 1721 dbSNP
rs564501213 1726 dbSNP
rs914494099 1735 dbSNP
rs948705256 1741 dbSNP
rs1196623709 1743 dbSNP
rs980334241 1748 dbSNP
rs531753730 1750 dbSNP
rs1253647327 1757 dbSNP
rs749131943 1769 dbSNP
rs928514474 1776 dbSNP
rs1480706397 1779 dbSNP
rs1202709659 1783 dbSNP
rs938412436 1793 dbSNP
rs1341865560 1796 dbSNP
rs900742434 1797 dbSNP
rs564619434 1798 dbSNP
rs1474006134 1801 dbSNP
rs1182772163 1804 dbSNP
rs1419202337 1806 dbSNP
rs190019974 1809 dbSNP
rs1021930045 1814 dbSNP
rs1173373006 1817 dbSNP
rs760361407 1817 dbSNP
rs1401209230 1819 dbSNP
rs966375517 1820 dbSNP
rs1375705548 1824 dbSNP
rs1469343953 1829 dbSNP
rs1335033179 1830 dbSNP
rs1407975992 1840 dbSNP
rs977808120 1846 dbSNP
rs543064168 1847 dbSNP
rs960513148 1850 dbSNP
rs1361084047 1851 dbSNP
rs1303461000 1855 dbSNP
rs991050216 1861 dbSNP
rs1426332528 1867 dbSNP
rs1448982271 1868 dbSNP
rs866275852 1870 dbSNP
rs1163713980 1876 dbSNP
rs1419115922 1880 dbSNP
rs1303232323 1883 dbSNP
rs372700947 1883 dbSNP
rs941682526 1885 dbSNP
rs1482993916 1896 dbSNP
rs1270244922 1899 dbSNP
rs1360937643 1900 dbSNP
rs1216723759 1906 dbSNP
rs1280007790 1910 dbSNP
rs535534529 1916 dbSNP
rs941281540 1918 dbSNP
rs770682697 1922 dbSNP
rs1225116065 1927 dbSNP
rs1489979922 1927 dbSNP
rs774507222 1932 dbSNP
rs1037916515 1934 dbSNP
rs548019313 1935 dbSNP
rs890334911 1938 dbSNP
rs565929656 1940 dbSNP
rs1283912863 1942 dbSNP
rs539769365 1943 dbSNP
rs1047744398 1946 dbSNP
rs386799991 1949 dbSNP
rs879496393 1949 dbSNP
rs1051855 1950 dbSNP
rs67052715 1950 dbSNP
rs3794714 1951 dbSNP
rs1241898415 1956 dbSNP
rs1487510512 1964 dbSNP
rs775578267 1973 dbSNP
rs377165180 1974 dbSNP
rs900674334 1977 dbSNP
rs1202309794 1991 dbSNP
rs865826184 2011 dbSNP
rs1044015341 2013 dbSNP
rs902157835 2014 dbSNP
rs113481526 2019 dbSNP
rs761282683 2020 dbSNP
rs1339461825 2025 dbSNP
rs1034723313 2031 dbSNP
rs1324444558 2032 dbSNP
rs957992999 2038 dbSNP
rs1010860766 2043 dbSNP
rs1329293182 2046 dbSNP
rs1023669443 2048 dbSNP
rs1427300605 2060 dbSNP
rs537057972 2065 dbSNP
rs980066385 2069 dbSNP
rs928434235 2071 dbSNP
rs1344454826 2072 dbSNP
rs76610569 2075 dbSNP
rs1179182779 2084 dbSNP
rs1464941722 2084 dbSNP
rs1300014858 2087 dbSNP
rs182430011 2088 dbSNP
rs907626196 2090 dbSNP
rs540759853 2096 dbSNP
rs150206319 2111 dbSNP
rs962528962 2118 dbSNP
rs1198829485 2123 dbSNP
rs762333149 2130 dbSNP
rs138593217 2131 dbSNP
rs951327939 2134 dbSNP
rs1352025526 2139 dbSNP
rs1294907320 2142 dbSNP
rs1344138668 2142 dbSNP
rs983848892 2145 dbSNP
rs1433970887 2146 dbSNP
rs1383103814 2149 dbSNP
rs61742310 2156 dbSNP
rs1393803315 2163 dbSNP
rs944748553 2165 dbSNP
rs552023948 2167 dbSNP
rs545196177 2169 dbSNP
rs565784174 2178 dbSNP
rs563591550 2181 dbSNP
rs1463823626 2190 dbSNP
rs946885924 2194 dbSNP
rs186702319 2196 dbSNP
rs1043941896 2202 dbSNP
rs1245202468 2204 dbSNP
rs902756607 2212 dbSNP
rs1158266914 2213 dbSNP
rs999817781 2214 dbSNP
rs1202072539 2215 dbSNP
rs1417675134 2216 dbSNP
rs1196355802 2217 dbSNP
rs1483901432 2217 dbSNP
rs1052593370 2219 dbSNP
rs759052766 2219 dbSNP
rs760086092 2219 dbSNP
rs10615625 2221 dbSNP
rs1241976332 2221 dbSNP
rs1330117187 2221 dbSNP
rs1339406841 2221 dbSNP
rs1359628777 2221 dbSNP
rs1425699964 2221 dbSNP
rs372937188 2221 dbSNP
rs549493117 2221 dbSNP
rs764510185 2221 dbSNP
rs765599263 2221 dbSNP
rs776096376 2221 dbSNP
rs879234413 2221 dbSNP
rs1387303161 2222 dbSNP
rs1161750018 2224 dbSNP
rs1160266626 2225 dbSNP
rs1360875659 2226 dbSNP
rs893885819 2228 dbSNP
rs1010973542 2229 dbSNP
rs1321504528 2231 dbSNP
rs1249538435 2234 dbSNP
rs1332377629 2236 dbSNP
rs1204157918 2237 dbSNP
rs1490470511 2238 dbSNP
rs77886186 2238 dbSNP
rs1207747330 2239 dbSNP
rs1291535222 2239 dbSNP
rs1355235212 2239 dbSNP
rs1436545814 2240 dbSNP
rs1278636896 2241 dbSNP
rs3794713 2242 dbSNP
rs1024038115 2243 dbSNP
rs1287211012 2245 dbSNP
rs1405931306 2248 dbSNP
rs371704204 2250 dbSNP
rs1208646086 2252 dbSNP
rs529432614 2253 dbSNP
rs1404940792 2263 dbSNP
rs766736414 2264 dbSNP
rs1452299350 2265 dbSNP
rs547472760 2271 dbSNP
rs565805237 2276 dbSNP
rs1236389633 2280 dbSNP
rs752107924 2283 dbSNP
rs1056531880 2300 dbSNP
rs1181410409 2302 dbSNP
rs1480625928 2303 dbSNP
rs1248186449 2305 dbSNP
rs866001472 2307 dbSNP
rs548211651 2308 dbSNP
rs1035617191 2311 dbSNP
rs1012379606 2314 dbSNP
rs983279469 2315 dbSNP
rs1326551225 2321 dbSNP
rs1268021659 2326 dbSNP
rs61740618 2333 dbSNP
rs1405843709 2334 dbSNP
rs1370396727 2335 dbSNP
rs962456415 2338 dbSNP
rs1273406023 2345 dbSNP
rs1436217833 2351 dbSNP
rs995284902 2353 dbSNP
rs1455679576 2362 dbSNP
rs921568042 2363 dbSNP
rs1388055648 2369 dbSNP
rs1025466072 2374 dbSNP
rs766966728 2377 dbSNP
rs551516672 2378 dbSNP
rs13382 2379 dbSNP
rs935620056 2382 dbSNP
rs373348451 2383 dbSNP
rs986737167 2384 dbSNP
rs1203795151 2387 dbSNP
rs893999708 2388 dbSNP
rs1051848 2389 dbSNP
rs1195680725 2398 dbSNP
rs191103076 2400 dbSNP
rs1340545328 2401 dbSNP
rs1300064455 2410 dbSNP
rs1045168337 2411 dbSNP
rs966085906 2413 dbSNP
rs1364768435 2421 dbSNP
rs1337395847 2422 dbSNP
rs975209935 2423 dbSNP
rs1360812882 2424 dbSNP
rs921992934 2430 dbSNP
rs567136190 2433 dbSNP
rs1459141605 2437 dbSNP
rs1413671539 2438 dbSNP
rs946813923 2439 dbSNP
rs1170278676 2449 dbSNP
rs1447248673 2450 dbSNP
rs1003545912 2456 dbSNP
rs1043912386 2459 dbSNP
rs924148512 2460 dbSNP
rs184088718 2463 dbSNP
rs553126309 2465 dbSNP
rs1423069687 2466 dbSNP
rs147015481 2467 dbSNP
rs879108962 2470 dbSNP
rs1004829003 2471 dbSNP
rs1341650152 2474 dbSNP
rs896114906 2493 dbSNP
rs545234887 2496 dbSNP
rs1377122517 2509 dbSNP
rs1473094582 2511 dbSNP
rs1447139411 2513 dbSNP
rs1169794064 2518 dbSNP
rs947727319 2522 dbSNP
rs1044737221 2523 dbSNP
rs1369547606 2524 dbSNP
rs963222515 2525 dbSNP
rs973530412 2526 dbSNP
rs1410925343 2532 dbSNP
rs189019550 2536 dbSNP
rs777729709 2541 dbSNP
rs1254611239 2542 dbSNP
rs1336581679 2542 dbSNP
rs192971615 2550 dbSNP
rs1482971161 2551 dbSNP
rs995255337 2560 dbSNP
rs1292734452 2562 dbSNP
rs1224120827 2567 dbSNP
rs138221326 2576 dbSNP
rs911588206 2577 dbSNP
rs886953513 2578 dbSNP
rs1008533971 2580 dbSNP
rs1290204579 2581 dbSNP
rs1407764800 2584 dbSNP
rs542550692 2592 dbSNP
rs1293917136 2593 dbSNP
rs1019546397 2594 dbSNP
rs964330411 2595 dbSNP
rs974759344 2596 dbSNP
rs1412928433 2601 dbSNP
rs879145783 2605 dbSNP
rs915380934 2605 dbSNP
rs1258020406 2608 dbSNP
rs946912921 2609 dbSNP
rs1472456964 2612 dbSNP
rs116733586 2613 dbSNP
rs905272688 2615 dbSNP
rs968123919 2617 dbSNP
rs1265102345 2621 dbSNP
rs1216578669 2623 dbSNP
rs1331398584 2627 dbSNP
rs979517661 2631 dbSNP
rs1269914057 2638 dbSNP
rs529290464 2647 dbSNP
rs777539436 2651 dbSNP
rs1226444357 2658 dbSNP
rs1349825640 2659 dbSNP
rs1301630622 2660 dbSNP
rs1388307005 2661 dbSNP
rs1365032975 2666 dbSNP
rs939464768 2667 dbSNP
rs1260901923 2674 dbSNP
rs1435150048 2679 dbSNP
rs1390265118 2686 dbSNP
rs757060372 2688 dbSNP
rs540989708 2691 dbSNP
rs1170807799 2709 dbSNP
rs1376526259 2712 dbSNP
rs778714961 2714 dbSNP
rs1431861781 2715 dbSNP
rs118115744 2716 dbSNP
rs1189501734 2719 dbSNP
rs185209015 2724 dbSNP
rs188971401 2725 dbSNP
rs548893168 2727 dbSNP
rs1349791821 2728 dbSNP
rs994677575 2729 dbSNP
rs1029277789 2731 dbSNP
rs1235136597 2732 dbSNP
rs1310259034 2733 dbSNP
rs1300138489 2734 dbSNP
rs1435304137 2736 dbSNP
rs1366959189 2737 dbSNP
rs918160959 2739 dbSNP
rs1433730268 2742 dbSNP
rs1305184811 2746 dbSNP
rs1342970331 2746 dbSNP
rs1403523885 2746 dbSNP
rs386799992 2746 dbSNP
rs1464833915 2747 dbSNP
rs1377472789 2748 dbSNP
rs1169655173 2753 dbSNP
rs567419396 2753 dbSNP
rs948337543 2754 dbSNP
rs1044707556 2756 dbSNP
rs775828801 2757 dbSNP
rs1256793923 2758 dbSNP
rs931030105 2762 dbSNP
rs953144942 2763 dbSNP
rs1343784540 2768 dbSNP
rs1295023162 2773 dbSNP
rs1226057298 2774 dbSNP
rs987649163 2776 dbSNP
rs1315413106 2777 dbSNP
rs1046811387 2778 dbSNP
rs886919273 2780 dbSNP
rs1402120645 2782 dbSNP
rs540039546 2784 dbSNP
rs191841817 2785 dbSNP
rs1019895928 2787 dbSNP
rs747122727 2789 dbSNP
rs1370216131 2790 dbSNP
rs996807149 2792 dbSNP
rs778650934 2796 dbSNP
rs968743063 2797 dbSNP
rs1256736035 2801 dbSNP
rs980953767 2802 dbSNP
rs1483953899 2804 dbSNP
rs1194924952 2809 dbSNP
rs1356645405 2810 dbSNP
rs1266058114 2816 dbSNP
rs1241996666 2817 dbSNP
rs1430943584 2817 dbSNP
rs1200615765 2820 dbSNP
rs553260593 2827 dbSNP
rs143723782 2828 dbSNP
rs768849920 2829 dbSNP
rs1406128112 2830 dbSNP
rs184010317 2830 dbSNP
rs777332757 2833 dbSNP
rs1161476557 2841 dbSNP
rs926811878 2843 dbSNP
rs202174273 2844 dbSNP
rs371117483 2844 dbSNP
rs879623166 2844 dbSNP
rs979486613 2844 dbSNP
rs12944611 2845 dbSNP
rs71369025 2845 dbSNP
rs12939611 2846 dbSNP
rs1180822167 2850 dbSNP
rs773585102 2854 dbSNP
rs541915884 2855 dbSNP
rs1207542961 2861 dbSNP
rs918118973 2862 dbSNP
rs1365658069 2863 dbSNP
rs759133737 2868 dbSNP
rs908510690 2869 dbSNP
rs767248378 2873 dbSNP
rs919564110 2874 dbSNP
rs1279269946 2881 dbSNP
rs930999072 2882 dbSNP
rs1046739170 2889 dbSNP
rs1333037159 2890 dbSNP
rs9903168 2891 dbSNP
rs1161496984 2892 dbSNP
rs575233011 2892 dbSNP
rs1217333544 2897 dbSNP
rs1264772013 2898 dbSNP
rs1458716447 2904 dbSNP
rs1409675005 2907 dbSNP
rs760246785 2912 dbSNP
rs543342268 2914 dbSNP
rs1050252888 2918 dbSNP
rs1478270720 2918 dbSNP
rs1211144135 2919 dbSNP
rs1040882623 2920 dbSNP
rs1267381081 2921 dbSNP
rs1210060111 2936 dbSNP
rs1463889821 2940 dbSNP
rs1438713909 2946 dbSNP
rs888965055 2956 dbSNP
rs1176331695 2957 dbSNP
rs1347630629 2959 dbSNP
rs1382626024 2962 dbSNP
rs899669003 2966 dbSNP
rs1366244317 2967 dbSNP
rs563229180 2967 dbSNP
rs956332332 2972 dbSNP
rs1343358720 2974 dbSNP
rs1317601846 2976 dbSNP
rs1009185704 2977 dbSNP
rs1164748061 2978 dbSNP
rs1021950022 2979 dbSNP
rs1453350995 2984 dbSNP
rs996735035 2986 dbSNP
rs1459858512 2987 dbSNP
rs370053528 3002 dbSNP
rs763584551 3003 dbSNP
rs1189924468 3007 dbSNP
rs1043011312 3010 dbSNP
rs15153 3013 dbSNP
rs538736049 3016 dbSNP
rs1463214359 3018 dbSNP
rs1242014423 3020 dbSNP
rs1245073644 3021 dbSNP
rs1444659622 3022 dbSNP
rs1276903143 3023 dbSNP
rs1210626968 3025 dbSNP
rs968314902 3025 dbSNP
rs981452802 3033 dbSNP
rs753790297 3034 dbSNP
rs1000852988 3036 dbSNP
rs557236573 3037 dbSNP
rs1448614912 3039 dbSNP
rs1360833647 3042 dbSNP
rs956808818 3044 dbSNP
rs1370782280 3057 dbSNP
rs1426199074 3058 dbSNP
rs773243152 3058 dbSNP
rs200372170 3060 dbSNP
rs370478664 3064 dbSNP
rs201703376 3068 dbSNP
rs1474024121 3078 dbSNP
rs143909309 3081 dbSNP
rs757155798 3085 dbSNP
rs1483608139 3088 dbSNP
rs1277006810 3093 dbSNP
rs1311696573 3095 dbSNP
rs1203223767 3099 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' uugggcauuucacauCACUCCa 3'
3 - 24
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000335255.5 | 3UTR | UCUUGGGCAUUUCACAUCACUCCAUUUCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.789 2.3e-6 -0.795 1.7e-6 24 Click to see details
GSE28260 Renal cortex and medulla 0.779 8.5e-4 0.621 1.2e-2 13 Click to see details
GSE21687 Ependynoma primary tumors -0.269 1.6e-2 -0.354 2.1e-3 64 Click to see details
GSE17306 Multiple myeloma -0.264 3.3e-2 -0.116 2.1e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.313 6.4e-2 0.347 4.5e-2 25 Click to see details
GSE21849 B cell lymphoma 0.156 2.1e-1 0.260 8.7e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.155 2.6e-1 0.089 3.5e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.065 2.7e-1 -0.057 3.0e-1 90 Click to see details
GSE19350 CNS germ cell tumors -0.188 2.8e-1 0.126 3.5e-1 12 Click to see details
GSE38226 Liver fibrosis 0.132 2.8e-1 0.230 1.6e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.266 3.1e-1 -0.086 4.4e-1 6 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.099 3.2e-1 -0.042 4.2e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.093 3.3e-1 0.108 3.1e-1 24 Click to see details
GSE17498 Multiple myeloma -0.065 3.5e-1 -0.145 1.9e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells 0.087 3.5e-1 -0.106 3.2e-1 23 Click to see details
GSE32688 Pancreatic cancer 0.055 3.8e-1 0.330 3.3e-2 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP 0.284 0.23 0.233 0.27 9 Click to see details
KIRC -0.127 0.26 -0.052 0.39 29 Click to see details
HNSC 0.666 0.27 0.500 0.33 3 Click to see details
STAD -0.189 0.33 -0.071 0.43 8 Click to see details
LIHC 0.061 0.34 0.123 0.2 49 Click to see details
THCA 0.216 0.36 0.500 0.2 5 Click to see details
KICH -0.032 0.47 -0.071 0.43 8 Click to see details
ESCA 0.016 0.49 0.100 0.44 5 Click to see details
CHOL 0.005 0.49 0.133 0.37 9 Click to see details
CHOL 0.005 0.49 0.133 0.37 9 Click to see details
CHOL 0.005 0.49 0.133 0.37 9 Click to see details
CHOL 0.005 0.49 0.133 0.37 9 Click to see details
CHOL 0.005 0.49 0.133 0.37 9 Click to see details
CHOL 0.005 0.49 0.133 0.37 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand <