miRTarBase - #MIRT023398 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CLIC4   
Synonyms CLIC4L, H1, MTCLIC, huH1, p64H1
Description chloride intracellular channel 4
Transcript NM_013943   
Expression
Putative miRNA Targets on CLIC4
3'UTR of CLIC4
(miRNA target sites are highlighted)
>CLIC4|NM_013943|3'UTR
   1 AATCGCGTTTGTAAAAGAGATGTCTTCATGTCTTCCCCTAAGAATACGCTTTTCCTAACAGGCTACTCCTTCCTGTAGAG
  81 CAGAAATTGTATTTTGCACGAACATGCAGTTATTGAAGATTAGGATCAAGGATAGACAAGGTATAGTAGTTATCTTAAAA
 161 TATACACTCCTAAGCAGTATTATTTTAAAATCCTTTACCCTGGCTACCTCCCCTACCCGGGTTCCCCTCTCTTTAATTTG
 241 GAGACACTCCACCACAAACTTTTCACTTTAGAGGTAGCTTGCCATCTCTCAGGAGCCCTCACCATTGTGTCCATTCACTG
 321 TGTATAGATGGCAGAACTTTTGAGGTGCAATGTTTAATTGTTAAAAATAGTAGCCACGACTTTATCAGGCAGCCCCAAAC
 401 TGGTGCATAATGCATGGTACAAGAAATATTTATGTATTTTTTGGAATTTTGTAATATTTAGTAAGAGTATATGAAAGGAT
 481 TGCTACTGTATCAGAAATATTGTTTCAATTTAGTCTATCCTGGATATGTACTAACGAATATTACCACCAGAGAAGAGAGC
 561 TTTCTACAAAAGTCACTACAGATTTTGCTATATTGCTTTGTAGATAGATTTTTACTTTTGCCTAAAAGCATTTATCCTTC
 641 ATACCAATTGTAACATCTGACACCATGTAGAAGCTAAAAGTTTAGAGGGAGTGAGGGTTTTCTCAAGACCTTCCTCAAGC
 721 ATTTTATCTTTAGAAGAGAAACTGATGGGCACCTGATACTCTGTCTAAATACGTTTGTTATATGTGTTTTGCCCTGTGCC
 801 ATTCATTTGGAACTTTATTGCATTCTTTATTTTAAAAAGCTTGTTTTTACGTAATCATAGAGCTTGCTATTTGTACATCT
 881 GTTGAGCAACACTACATAACTGATTTTTAGTTGACTTAGCTATAGCAGTACAATGATTAGTAATGTAAAAATTAACACAG
 961 AAATTAACCTAAGGAATGAAGGGTGGGTTTGTCAAAATATCAAGTAAATTTTTGTTTCTAAAGTACATTTAATGTAGATG
1041 ACCTAAAGAATGCGTTATCCATCCTATATAAAAGAAAGATAAAACACAGGTCACCAATTTTCTCATTTCACCCCATTTAC
1121 CTTGTATAGAGGATTGTTCATTCCTTTGGGACTAAGTTATAGTTATGGTGAGTGTGTATTTACTGTAGTTTTGCCTGATC
1201 TCACTCATTGCACTTCCTGGAGTTAAATTTTCCAACAGCCATGTTGAGGAATAGCACTCTGCATGTTTTTGTTTTGTTTT
1281 TCGGGGTTTTTTTTAATTGAAGCCCTAAACCAGGAATTATTTGTGTTCTAACAGGAGGATGAACTTGCTGAAAATAAAAC
1361 TTTGCTATGTATTTACTCTTTTTTAAAAGACAAAAGCAAAACCAGACTTTCTACGTACTACTCCAAAGACTGTGATTGTG
1441 ACTATAATACATTTTTGGTAATTTTTTTATACCTAATTTGTATAGGAAGTGCTATTTCTCATAGGCTGTTTCTTGAAATT
1521 TTAAGTTTATTGCTTTAAAATGGCAGTGTTTCTCCCACTTTGATATGCTAACATTTAGTAAGCACTGGCTTTATGAAAGC
1601 GGCTTTTTATAAGTATACTGCATTTTTTGAGCCTATCATTAATTAGCTTAGTATGAAAGATAAGAAAATCTCCATGTTGT
1681 ATCCATTTGGCTCAGGAAGATTCTTTGCCTTACCTTTCTTAGAACTCTTTATTGCTTATCAAAAGTTTGAGTACCCGCTT
1761 GGTTTTTTTTTGGTAATTAAATATTGTATGATTTATCTGGTTCAAGGAAGATGCACTATTCAGTTATCTATTGAGAAATT
1841 ATTTTGCAGTGGTTTTAGTGGGTGAAAATGTCCCATCTGCACCAGTACACAGGCAGGCATTATCATTCTTCACCTACTTT
1921 TTAAATAGTGGCAACTTGGGATTCATTCTGGTGATTCTGAACCTTGCCTCATAGCTTAAAGTATAAAAAAGATTCAAGAG
2001 CAGTGAGGTTTGTTCTTTCCAGTGAATGGTGGACTGAGTGGTGCGAGGTGGAGGGCTAACAAGAGGAAAGAACTACATTC
2081 TTCAGAATACAGTGATGAAAATTCATTTTGAAACTCAAATATTTTCATTTTGGATATTCTCCTGTTTTTATTAAACCAGT
2161 GATTACACCTGGCCATCCCTCTAAATGTTCTAGGAAGGCATGTCTATTGTGATTTTGATGAAGACAGAATTATTTTTCTC
2241 TGTAGAAACACAGATACCACTTTATCAGGGAAGTTAGTCAAATGAAATGGAAATTGGTAAATGGACAAAAGCTAGCTAGT
2321 AAAAAGGACGACCCAGCAACATGCTTTAACCCCATTGTATGTTTGTGGAAAGAGCATAGTTTAACATCTTGAGAAATTTG
2401 GGACATAAAGTTTTCATGGTAGACAGTTCATGCAGTATATGAATTGCCATAATGGAAATAATCTGATTTTATTTTTACAA
2481 CTAACATCCATTCCCCTTCATTTAAACACCTTTTGTGTTTTACTTCAGTGAGGAGATTGGAGTCTGAATGGATCTGTTTT
2561 CCAAGAGATTCTGAGAAATTTTTGTATTCAGCAGTTGGAAAGCTCTCTATTCTAGTTGATAAAACTTCCCTTTTTTGATG
2641 TAGATGCAGATATTCTATACAGTTCTGTTGTCTTTTACTAGGACTGTAAACTTTTGTGATAAAATTCAAATAAGATTTTA
2721 TTTCTTGGTAATTTTGGCTTTCACAATTTATCTTTAAATCCTTGAGCAATCTGTATACAATTAAGAGATTTCTGACATTT
2801 ATTCTTACACTAAATGGATCAACTCTAGGATTTAGGCATGTTAACTTCTGTTGTGTTTTGAATCTCTCCAGAGTTGCATG
2881 TAGATAGCATTTATTTCTGTGCCCTTAAACCCATTTAGAAAATAACTACAAAGTAAAAATGTAGAGGAAATAGAAATGTA
2961 TTTTTTCATGAACATTTTGATACAAATTTCATCATTTAATGATTCACCAATTTCTTGCATTAATTTGAATTTAAGCATTT
3041 AATTCAAAGAGAGGGGAGCATCCATTATTGATACATGTGGGCTTTTAAAAACTCCATCCTTTATAAATAGTCAAGGTTTG
3121 GGCCACACAAAGTATATTTTTATCATGGAAAAATTTCAACTCCTCAAGCCGTAATGTTGAACAGAATTGGAGTATTTTCT
3201 TTATAATTTCTTGAACAGGCAAATGAAAGCTTATTATAGAATGCATGTATTTTCTTTTATCTTTGGAACATCAGCACCAG
3281 TATATTGCTGGCAGCTATTGTATTAAAAAATAAAGTATATTTTCACTATCATAAAGGATTCTTTTTTCCCCCCTCATGAA
3361 AATAAACAACAACTTGGGGTAAAAGTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuguggUAA--CAGUGUGAGGu 5'
                  |||  |  ||||||| 
Target 5' tctctttaATTTGGAGACACTCCa 3'
228 - 251 144.00 -14.20
2
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       :||||||| 
Target 5' ttatcttaaaataTACACTCCt 3'
150 - 171 141.00 -11.20
3
miRNA  3' guUUGU-GGUAACAGUGUGAggu 5'
            :||| ::||| |:|||||   
Target 5' ctGACATTTATTCTTACACTaaa 3'
2792 - 2814 128.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM8909268 1 COSMIC
COSN30111835 5 COSMIC
COSN30475732 6 COSMIC
COSN31550022 8 COSMIC
COSN26970989 33 COSMIC
COSN30165362 79 COSMIC
COSN30506475 100 COSMIC
COSN30514685 101 COSMIC
COSN31558818 160 COSMIC
COSN30538173 161 COSMIC
COSN31541226 176 COSMIC
COSN18714703 291 COSMIC
COSN32062590 375 COSMIC
COSN32062591 378 COSMIC
COSN7215441 478 COSMIC
COSN26219410 694 COSMIC
COSN24298269 921 COSMIC
COSN28752975 1037 COSMIC
COSN21077463 1180 COSMIC
COSN25882434 1287 COSMIC
COSN20090177 1288 COSMIC
COSN1101876 1680 COSMIC
COSN15004684 1704 COSMIC
COSN20625928 1763 COSMIC
COSN4749841 1786 COSMIC
COSN21081169 1806 COSMIC
COSN26769251 1815 COSMIC
COSN1441958 1819 COSMIC
COSN16155576 1872 COSMIC
COSN7215442 2123 COSMIC
COSN21981248 2203 COSMIC
COSN6032526 2522 COSMIC
COSN23790776 2787 COSMIC
COSN26506815 2851 COSMIC
COSN6032527 2886 COSMIC
COSN26640505 2888 COSMIC
COSN31519975 2945 COSMIC
COSN22529759 3107 COSMIC
COSN8638032 3113 COSMIC
COSN22093290 3211 COSMIC
COSN19660602 3352 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1470245666 5 dbSNP
rs200696203 6 dbSNP
rs1404219853 7 dbSNP
rs574940681 8 dbSNP
rs1313677879 9 dbSNP
rs1424511831 12 dbSNP
rs866630882 14 dbSNP
rs1164624222 16 dbSNP
rs747840838 17 dbSNP
rs377413211 20 dbSNP
rs1027758221 21 dbSNP
rs1330361771 23 dbSNP
rs1328480867 30 dbSNP
rs1336553875 31 dbSNP
rs1444525918 36 dbSNP
rs773508748 37 dbSNP
rs754205347 40 dbSNP
rs576642201 41 dbSNP
rs752815230 45 dbSNP
rs766734384 48 dbSNP
rs114651082 49 dbSNP
rs759642536 51 dbSNP
rs1181262554 59 dbSNP
rs1364330266 63 dbSNP
rs1473506833 65 dbSNP
rs553847050 66 dbSNP
rs1362143822 76 dbSNP
rs1303714177 99 dbSNP
rs1404539062 99 dbSNP
rs758538646 100 dbSNP
rs187308024 101 dbSNP
rs1328545161 103 dbSNP
rs966306554 105 dbSNP
rs977647120 108 dbSNP
rs1281907550 115 dbSNP
rs1160588899 117 dbSNP
rs1031851678 137 dbSNP
rs956416664 138 dbSNP
rs754433766 160 dbSNP
rs554573942 170 dbSNP
rs1468606373 174 dbSNP
rs943596505 196 dbSNP
rs1483899873 197 dbSNP
rs561821985 211 dbSNP
rs1268095611 218 dbSNP
rs752124021 219 dbSNP
rs1176814469 220 dbSNP
rs192079959 227 dbSNP
rs1460623807 228 dbSNP
rs1380965682 229 dbSNP
rs1167525585 230 dbSNP
rs1371615135 232 dbSNP
rs1412050972 237 dbSNP
rs113288422 254 dbSNP
rs1305598484 257 dbSNP
rs1348110863 266 dbSNP
rs1230109550 272 dbSNP
rs1305220075 274 dbSNP
rs1288951127 285 dbSNP
rs184437183 291 dbSNP
rs550159891 305 dbSNP
rs1290969014 311 dbSNP
rs781734525 312 dbSNP
rs187534577 319 dbSNP
rs939131911 323 dbSNP
rs1269610071 326 dbSNP
rs1036296256 342 dbSNP
rs575879087 349 dbSNP
rs543164112 351 dbSNP
rs1432029706 357 dbSNP
rs1162005202 361 dbSNP
rs930686678 368 dbSNP
rs866093165 372 dbSNP
rs540486196 378 dbSNP
rs1183494587 379 dbSNP
rs1429262710 381 dbSNP
rs1297889741 386 dbSNP
rs1366848804 392 dbSNP
rs1243532143 394 dbSNP
rs1479654811 397 dbSNP
rs1290713163 406 dbSNP
rs889241268 407 dbSNP
rs1008054520 409 dbSNP
rs1258882454 414 dbSNP
rs1018947359 417 dbSNP
rs1466186543 423 dbSNP
rs533766815 427 dbSNP
rs998954701 431 dbSNP
rs570117692 433 dbSNP
rs547389777 434 dbSNP
rs1411174132 436 dbSNP
rs1424744640 437 dbSNP
rs1167606169 445 dbSNP
rs559115655 449 dbSNP
rs957842911 456 dbSNP
rs1456265005 459 dbSNP
rs779347784 464 dbSNP
rs1308543640 468 dbSNP
rs1390429262 475 dbSNP
rs1344874213 478 dbSNP
rs1217408887 489 dbSNP
rs1313896933 494 dbSNP
rs1379694907 509 dbSNP
rs1303065410 520 dbSNP
rs532928003 528 dbSNP
rs755867279 529 dbSNP
rs1226923116 530 dbSNP
rs144790131 536 dbSNP
rs969039379 537 dbSNP
rs1466288658 539 dbSNP
rs1202069453 545 dbSNP
rs1484064520 554 dbSNP
rs779880046 560 dbSNP
rs1268795924 561 dbSNP
rs571161846 569 dbSNP
rs1406458040 575 dbSNP
rs939187518 577 dbSNP
rs554302929 582 dbSNP
rs1193448366 583 dbSNP
rs971874141 589 dbSNP
rs1426262552 591 dbSNP
rs753063089 593 dbSNP
rs919206814 595 dbSNP
rs930550358 597 dbSNP
rs550358484 599 dbSNP
rs1372305978 601 dbSNP
rs889119285 601 dbSNP
rs146746536 603 dbSNP
rs1040450684 623 dbSNP
rs901916932 626 dbSNP
rs1431097060 627 dbSNP
rs1278206350 631 dbSNP
rs535926821 636 dbSNP
rs748841307 642 dbSNP
rs41292297 648 dbSNP
rs1231572462 654 dbSNP
rs1482921129 655 dbSNP
rs1276699719 656 dbSNP
rs1183609752 663 dbSNP
rs1254589719 667 dbSNP
rs1364425334 672 dbSNP
rs1171430829 674 dbSNP
rs1053209625 676 dbSNP
rs1425467865 676 dbSNP
rs1167853486 680 dbSNP
rs1434153755 684 dbSNP
rs893427501 689 dbSNP
rs1309776743 694 dbSNP
rs9259 697 dbSNP
rs1434433978 719 dbSNP
rs1274294648 722 dbSNP
rs1368362256 723 dbSNP
rs1023180277 742 dbSNP
rs539817300 752 dbSNP
rs148896762 766 dbSNP
rs377154979 773 dbSNP
rs1206232257 774 dbSNP
rs575889264 784 dbSNP
rs960433933 787 dbSNP
rs1229420177 788 dbSNP
rs971927839 790 dbSNP
rs546218990 797 dbSNP
rs919083081 802 dbSNP
rs1320030727 814 dbSNP
rs543226277 823 dbSNP
rs562912370 826 dbSNP
rs41292299 851 dbSNP
rs1170196775 852 dbSNP
rs1363674626 858 dbSNP
rs1404737330 877 dbSNP
rs12726765 878 dbSNP
rs12731450 879 dbSNP
rs910442187 884 dbSNP
rs57063413 888 dbSNP
rs1331812102 890 dbSNP
rs1040338298 896 dbSNP
rs1438699950 905 dbSNP
rs923391579 906 dbSNP
rs193003203 914 dbSNP
rs1229640429 921 dbSNP
rs1300314569 923 dbSNP
rs376218951 926 dbSNP
rs748182086 933 dbSNP
rs747222956 945 dbSNP
rs1291207822 948 dbSNP
rs1011716166 957 dbSNP
rs1212961671 962 dbSNP
rs1450880992 967 dbSNP
rs1168864001 970 dbSNP
rs1449660124 973 dbSNP
rs143619825 977 dbSNP
rs1383206546 979 dbSNP
rs1163842013 980 dbSNP
rs906098266 984 dbSNP
rs1403141539 994 dbSNP
rs1318569049 1001 dbSNP
rs12036492 1004 dbSNP
rs141863886 1005 dbSNP
rs1322787736 1008 dbSNP
rs1339142142 1009 dbSNP
rs1350458942 1009 dbSNP
rs960486259 1015 dbSNP
rs1226075939 1018 dbSNP
rs1266987225 1043 dbSNP
rs532011279 1054 dbSNP
rs1367120189 1055 dbSNP
rs1026029800 1062 dbSNP
rs951985197 1069 dbSNP
rs1377036159 1071 dbSNP
rs984618550 1077 dbSNP
rs910486985 1078 dbSNP
rs550420277 1079 dbSNP
rs1291207958 1082 dbSNP
rs1316772846 1085 dbSNP
rs76330923 1091 dbSNP
rs1166916940 1094 dbSNP
rs1322811183 1098 dbSNP
rs1400264467 1119 dbSNP
rs1395829524 1127 dbSNP
rs1335224344 1130 dbSNP
rs964590829 1151 dbSNP
rs976092875 1155 dbSNP
rs1270363533 1161 dbSNP
rs923277071 1163 dbSNP
rs1229632581 1166 dbSNP
rs185865052 1167 dbSNP
rs1343793785 1169 dbSNP
rs1200858571 1171 dbSNP
rs1258065228 1179 dbSNP
rs1236592093 1185 dbSNP
rs1481940942 1192 dbSNP
rs1053623016 1196 dbSNP
rs1252359649 1205 dbSNP
rs1472966733 1210 dbSNP
rs1161399252 1213 dbSNP
rs1376163567 1217 dbSNP
rs914636955 1236 dbSNP
rs1173356178 1244 dbSNP
rs947563982 1246 dbSNP
rs1428217914 1255 dbSNP
rs547620528 1262 dbSNP
rs41292301 1264 dbSNP
rs906150879 1283 dbSNP
rs1298511008 1287 dbSNP
rs189128687 1287 dbSNP
rs775712900 1289 dbSNP
rs1057363206 1295 dbSNP
rs557696059 1298 dbSNP
rs181024620 1305 dbSNP
rs1275289446 1306 dbSNP
rs1483971814 1329 dbSNP
rs183897018 1340 dbSNP
rs1265421193 1361 dbSNP
rs993135158 1362 dbSNP
rs1026502856 1365 dbSNP
rs1379522006 1368 dbSNP
rs1428241831 1374 dbSNP
rs755818518 1375 dbSNP
rs1168304446 1379 dbSNP
rs1371752180 1389 dbSNP
rs1432218796 1392 dbSNP
rs1156894071 1393 dbSNP
rs1390523969 1394 dbSNP
rs1292276088 1411 dbSNP
rs1389467166 1412 dbSNP
rs1386778222 1414 dbSNP
rs1302967225 1415 dbSNP
rs887520414 1416 dbSNP
rs1006500037 1424 dbSNP
rs1298112213 1426 dbSNP
rs1344014657 1434 dbSNP
rs1219356040 1436 dbSNP
rs1017434621 1446 dbSNP
rs1336305173 1451 dbSNP
rs1488200380 1454 dbSNP
rs1210453754 1455 dbSNP
rs964475246 1459 dbSNP
rs542461970 1460 dbSNP
rs1357705248 1462 dbSNP
rs1188134984 1463 dbSNP
rs1391227192 1469 dbSNP
rs1430655235 1473 dbSNP
rs975977081 1479 dbSNP
rs1368337497 1481 dbSNP
rs139150152 1486 dbSNP
rs1284792991 1490 dbSNP
rs1372723975 1499 dbSNP
rs201015135 1516 dbSNP
rs1227056036 1517 dbSNP
rs573541373 1524 dbSNP
rs1290799321 1542 dbSNP
rs796804231 1544 dbSNP
rs1433966459 1547 dbSNP
rs367587210 1551 dbSNP
rs1320796653 1553 dbSNP
rs764242343 1554 dbSNP
rs878924267 1555 dbSNP
rs1203500751 1564 dbSNP
rs1277473271 1567 dbSNP
rs1030175150 1579 dbSNP
rs1465365877 1584 dbSNP
rs1169682342 1595 dbSNP
rs1245658179 1597 dbSNP
rs1211817102 1600 dbSNP
rs749264261 1601 dbSNP
rs188432629 1602 dbSNP
rs1487059513 1610 dbSNP
rs1179895621 1612 dbSNP
rs1414167349 1614 dbSNP
rs914671802 1618 dbSNP
rs1171711122 1623 dbSNP
rs947487564 1634 dbSNP
rs751589829 1635 dbSNP
rs1422814266 1636 dbSNP
rs1456246585 1656 dbSNP
rs757845217 1658 dbSNP
rs980718730 1662 dbSNP
rs1346542697 1673 dbSNP
rs1335141680 1682 dbSNP
rs927451135 1686 dbSNP
rs1302007384 1695 dbSNP
rs768102635 1696 dbSNP
rs1408132541 1701 dbSNP
rs750916688 1715 dbSNP
rs11538925 1716 dbSNP
rs1286371917 1720 dbSNP
rs1327165442 1731 dbSNP
rs1227794895 1741 dbSNP
rs1269029910 1744 dbSNP
rs552796592 1757 dbSNP
rs562265910 1758 dbSNP
rs1047381723 1763 dbSNP
rs1250164103 1763 dbSNP
rs577629336 1771 dbSNP
rs1471986411 1773 dbSNP
rs1182210247 1778 dbSNP
rs1409755038 1787 dbSNP
rs1412446742 1789 dbSNP
rs1174890578 1802 dbSNP
rs887561951 1803 dbSNP
rs1005971253 1804 dbSNP
rs1278950719 1805 dbSNP
rs1482432560 1810 dbSNP
rs1306119216 1814 dbSNP
rs1349739924 1820 dbSNP
rs1017737630 1831 dbSNP
rs1202491735 1832 dbSNP
rs1289110564 1846 dbSNP
rs143175108 1850 dbSNP
rs1217747530 1853 dbSNP
rs1278182360 1863 dbSNP
rs1313158512 1876 dbSNP
rs1483308272 1883 dbSNP
rs1213394840 1891 dbSNP
rs1273133240 1896 dbSNP
rs1482994211 1898 dbSNP
rs1206462366 1903 dbSNP
rs1198102654 1905 dbSNP
rs997279353 1920 dbSNP
rs1190273363 1926 dbSNP
rs1425361782 1941 dbSNP
rs1478910640 1951 dbSNP
rs1455435924 1957 dbSNP
rs1412697724 1959 dbSNP
rs1166437414 1964 dbSNP
rs1173356130 1969 dbSNP
rs780506064 1979 dbSNP
rs577471547 1984 dbSNP
rs867240456 1991 dbSNP
rs530498678 1996 dbSNP
rs1330794993 2001 dbSNP
rs748973197 2019 dbSNP
rs1427897766 2020 dbSNP
rs955941585 2027 dbSNP
rs754581422 2029 dbSNP
rs989254006 2039 dbSNP
rs1371938853 2045 dbSNP
rs1295918574 2046 dbSNP
rs1021626856 2052 dbSNP
rs1206577605 2058 dbSNP
rs1371264216 2061 dbSNP
rs1449387909 2065 dbSNP
rs1220120533 2071 dbSNP
rs969087355 2073 dbSNP
rs1469565610 2076 dbSNP
rs778543134 2081 dbSNP
rs1333166171 2099 dbSNP
rs1379374304 2102 dbSNP
rs1397275757 2104 dbSNP
rs747588556 2106 dbSNP
rs376138755 2114 dbSNP
rs1411463877 2116 dbSNP
rs992979449 2119 dbSNP
rs1340938634 2126 dbSNP
rs918875116 2142 dbSNP
rs1395274182 2173 dbSNP
rs1276091690 2174 dbSNP
rs1443447775 2176 dbSNP
rs1318772309 2182 dbSNP
rs1342290990 2199 dbSNP
rs181248401 2205 dbSNP
rs12439 2207 dbSNP
rs185706896 2213 dbSNP
rs1228217614 2215 dbSNP
rs1290029101 2221 dbSNP
rs1336284383 2224 dbSNP
rs1206506859 2225 dbSNP
rs1246959998 2248 dbSNP
rs1453103503 2251 dbSNP
rs908885236 2257 dbSNP
rs1235695711 2261 dbSNP
rs1472450710 2267 dbSNP
rs773165968 2269 dbSNP
rs1038775091 2285 dbSNP
rs1463078462 2287 dbSNP
rs76272718 2295 dbSNP
rs182096843 2299 dbSNP
rs1383152605 2301 dbSNP
rs1051540889 2312 dbSNP
rs891748429 2316 dbSNP
rs1294437599 2317 dbSNP
rs1336312383 2320 dbSNP
rs1010159906 2321 dbSNP
rs1390824586 2323 dbSNP
rs1021929565 2330 dbSNP
rs968761562 2331 dbSNP
rs547617998 2335 dbSNP
rs1441621305 2342 dbSNP
rs1188248802 2345 dbSNP
rs1259449906 2351 dbSNP
rs1034457730 2362 dbSNP
rs187649689 2373 dbSNP
rs1406460670 2375 dbSNP
rs1180049786 2377 dbSNP
rs1411286992 2383 dbSNP
rs960100058 2386 dbSNP
rs1160498089 2392 dbSNP
rs1004265966 2404 dbSNP
rs771829107 2430 dbSNP
rs1320240062 2435 dbSNP
rs918760474 2440 dbSNP
rs1363492290 2444 dbSNP
rs951596230 2445 dbSNP
rs4649025 2448 dbSNP
rs1287206906 2451 dbSNP
rs1335811221 2455 dbSNP
rs1299413794 2457 dbSNP
rs1272714745 2462 dbSNP
rs879098284 2472 dbSNP
rs1211268755 2479 dbSNP
rs910099078 2481 dbSNP
rs1482053596 2482 dbSNP
rs1204319518 2498 dbSNP
rs1249975069 2499 dbSNP
rs1243507055 2503 dbSNP
rs1263606369 2518 dbSNP
rs1358298162 2526 dbSNP
rs1388637381 2543 dbSNP
rs1376076042 2545 dbSNP
rs941727279 2551 dbSNP
rs764212388 2552 dbSNP
rs1377620934 2554 dbSNP
rs1428440573 2561 dbSNP
rs1307950603 2565 dbSNP
rs1038661016 2570 dbSNP
rs921718650 2572 dbSNP
rs1463404524 2602 dbSNP
rs1190722424 2603 dbSNP
rs1330105090 2605 dbSNP
rs1248941030 2606 dbSNP
rs1234525892 2610 dbSNP
rs762341004 2610 dbSNP
rs1305413317 2613 dbSNP
rs1202275544 2617 dbSNP
rs774543556 2619 dbSNP
rs1251748356 2632 dbSNP
rs1481007856 2635 dbSNP
rs1185421504 2636 dbSNP
rs1197579729 2654 dbSNP
rs933070509 2662 dbSNP
rs1468235751 2666 dbSNP
rs1051423078 2678 dbSNP
rs1194483786 2683 dbSNP
rs891637046 2684 dbSNP
rs1159111785 2692 dbSNP
rs1448044813 2695 dbSNP
rs41302009 2711 dbSNP
rs1042998132 2712 dbSNP
rs1463093066 2726 dbSNP
rs1291323428 2728 dbSNP
rs182407625 2746 dbSNP
rs904421242 2761 dbSNP
rs186887857 2768 dbSNP
rs1362774213 2772 dbSNP
rs190120249 2776 dbSNP
rs959989547 2777 dbSNP
rs1014355577 2780 dbSNP
rs1025705370 2788 dbSNP
rs1242480839 2797 dbSNP
rs1385306355 2798 dbSNP
rs368561148 2818 dbSNP
rs1214627013 2826 dbSNP
rs1255049590 2827 dbSNP
rs1463837409 2831 dbSNP
rs551743573 2837 dbSNP
rs1186247955 2842 dbSNP
rs1262825250 2843 dbSNP
rs1430855348 2847 dbSNP
rs761825913 2849 dbSNP
rs182679139 2857 dbSNP
rs964636767 2865 dbSNP
rs1385925783 2868 dbSNP
rs974420893 2872 dbSNP
rs1289272391 2879 dbSNP
rs577689356 2884 dbSNP
rs1394279093 2889 dbSNP
rs1255630906 2896 dbSNP
rs750976992 2909 dbSNP
rs1354908866 2916 dbSNP
rs1210427463 2928 dbSNP
rs1233917651 2941 dbSNP
rs765916395 2943 dbSNP
rs1275312226 2959 dbSNP
rs796540529 2963 dbSNP
rs1268527720 2969 dbSNP
rs1215297076 2971 dbSNP
rs188356585 2974 dbSNP
rs1487049698 2980 dbSNP
rs1198971239 2995 dbSNP
rs987195391 3011 dbSNP
rs912951502 3015 dbSNP
rs1475260769 3030 dbSNP
rs538756773 3031 dbSNP
rs557081512 3035 dbSNP
rs1443115686 3036 dbSNP
rs758090207 3039 dbSNP
rs1399803952 3043 dbSNP
rs945926414 3045 dbSNP
rs1346819254 3048 dbSNP
rs1464299485 3048 dbSNP
rs1312216576 3052 dbSNP
rs1375941823 3052 dbSNP
rs1415513495 3056 dbSNP
rs1043270701 3059 dbSNP
rs754570751 3065 dbSNP
rs1223496953 3067 dbSNP
rs1307889729 3079 dbSNP
rs1319117896 3081 dbSNP
rs1208396578 3097 dbSNP
rs904474994 3099 dbSNP
rs1486308092 3108 dbSNP
rs1182059601 3117 dbSNP
rs1249060021 3129 dbSNP
rs937242424 3133 dbSNP
rs1055683988 3135 dbSNP
rs1409635387 3146 dbSNP
rs1410476780 3148 dbSNP
rs1354267963 3149 dbSNP
rs1431253992 3158 dbSNP
rs895831394 3160 dbSNP
rs1473775053 3164 dbSNP
rs1449257810 3166 dbSNP
rs1014237885 3171 dbSNP
rs575355416 3172 dbSNP
rs193192915 3175 dbSNP
rs1298982307 3193 dbSNP
rs775944772 3196 dbSNP
rs1375749333 3202 dbSNP
rs1300752996 3204 dbSNP
rs147516039 3205 dbSNP
rs372946615 3206 dbSNP
rs1349032262 3209 dbSNP
rs1169730332 3216 dbSNP
rs1237232481 3227 dbSNP
rs1403687083 3238 dbSNP
rs796395111 3247 dbSNP
rs1204551274 3250 dbSNP
rs964142541 3258 dbSNP
rs1307329634 3260 dbSNP
rs975644740 3263 dbSNP
rs1029840962 3276 dbSNP
rs1395525830 3279 dbSNP
rs1455364828 3293 dbSNP
rs1166653274 3302 dbSNP
rs1409484280 3311 dbSNP
rs954399031 3311 dbSNP
rs987081079 3330 dbSNP
rs1356331921 3332 dbSNP
rs1139995 3333 dbSNP
rs913011893 3342 dbSNP
rs945780266 3344 dbSNP
rs978494046 3346 dbSNP
rs1443493049 3348 dbSNP
rs1268959837 3351 dbSNP
rs1348478816 3353 dbSNP
rs35169449 3358 dbSNP
rs1215639495 3368 dbSNP
rs761194813 3378 dbSNP
rs185491072 3380 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        ||||||| 
Target 5' --------------ACACUCCa 3'
1 - 8
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaacagUGUGAGGu 5'
                        ||||||| 
Target 5' --------------ACACUCCa 3'
1 - 8
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hun7.5 , HEK293
Disease HCV infection
Location of target site 3'UTR
Tools used in this research TargetScan
Article - Bradrick SS; Nagyal S; Novatt H
- RNA (New York, N.Y.), 2013
Micro(mi)RNAs are 21- to 23-nt RNAs that regulate multiple biological processes. In association with Argonaute (Ago) proteins and other factors that form the RNA-induced silencing complex (RISC), miRNAs typically bind mRNA 3' untranslated regions (UTRs) and repress protein production through antagonizing translation and transcript stability. For a given mRNA-miRNA interaction, cis-acting RNA elements and trans-acting RNA-binding proteins (RBPs) may influence mRNA fate. This is particularly true of the hepatitis C virus (HCV) genome which interacts with miR-122, an abundant liver miRNA. miR-122 binding to HCV RNA considerably stimulates virus replication in cultured cells and primates, but the mechanism(s) and associated host factors required for enhancement of HCV replication have not been fully elucidated. We recapitulated miR-122-HCV RNA interactions in a cell-free translation system derived from cells that express miR-122. Specifically, lysates produced from HEK-293 cells that inducibly transcribe and process pri-miR-122 were characterized alongside those from isogenic cells lacking miR-122 expression. We observed a stimulatory effect of miR-122 on HCV reporter mRNAs in a manner that depended on expression of miR-122 and intact target sites within the HCV 5' UTR. We took advantage of this system to affinity-purify miR-122-HCV RNP complexes. Similar to functional assays, we found that association of immobilized HCV internal ribosome entry site (IRES) RNA with endogenous Ago2 requires both miR-122 expression and intact miR-122 target sites in cis. This combined approach may be generalizable to affinity purification of miRNP complexes for selected target mRNAs, allowing identification of miRNP components and RBPs that may contribute to regulation.
LinkOut: [PMID: 23793894]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000374379.4 | 3UTR | ACACUCCACCACAAACUUUUCACUUUAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000374379.4 | 3UTR | ACACUCCACCACAAACUUUUCACUUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21849 B cell lymphoma -0.384 2.0e-2 0.211 1.4e-1 29 Click to see details
GSE32688 Pancreatic cancer -0.269 6.8e-2 -0.385 1.5e-2 32 Click to see details
GSE28544 Breast cancer -0.296 8.0e-2 -0.386 3.1e-2 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.281 9.7e-2 -0.137 2.7e-1 23 Click to see details
GSE17498 Multiple myeloma 0.19 1.2e-1 0.267 4.8e-2 40 Click to see details
GSE28260 Renal cortex and medulla -0.329 1.4e-1 -0.115 3.5e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.117 1.8e-1 -0.065 3.0e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.445 1.9e-1 0.714 5.5e-2 6 Click to see details
GSE38226 Liver fibrosis 0.198 1.9e-1 0.180 2.2e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.151 2.4e-1 0.161 2.2e-1 25 Click to see details
GSE17306 Multiple myeloma -0.102 2.4e-1 -0.104 2.4e-1 49 Click to see details
GSE19350 CNS germ cell tumors -0.206 2.6e-1 -0.136 3.4e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.117 2.9e-1 0.023 4.6e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.139 3.0e-1 0.062 4.1e-1 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.058 4.0e-1 -0.194 2.1e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.032 4.4e-1 -0.007 4.9e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.005 4.8e-1 -0.012 4.6e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.452 0 -0.598 0 49 Click to see details
STAD -0.61 0.05 -0.667 0.04 8 Click to see details
HNSC 0.95 0.1 0.500 0.33 3 Click to see details
KICH 0.481 0.11 0.095 0.41 8 Click to see details
ESCA -0.549 0.17 -0.600 0.14 5 Click to see details
KIRP 0.321 0.2 0.450 0.11 9 Click to see details
THCA 0.489 0.2 0.300 0.31 5 Click to see details
KIRC 0.125 0.26 0.097 0.31 29 Click to see details
CHOL 0.227 0.28 0.517 0.08 9 Click to see details
CHOL 0.227 0.28 0.517 0.08 9 Click to see details
CHOL 0.227 0.28 0.517 0.08 9 Click to see details
CHOL 0.227 0.28 0.517 0.08 9 Click to see details
CHOL 0.227 0.28 0.517 0.08 9 Click to see details
CHOL 0.227 0.28 0.517 0.08 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*