miRTarBase - #MIRT023401 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LMNB2   
Synonyms EPM9, LAMB2, LMN2
Description lamin B2
Transcript NM_032737   
Expression
Putative miRNA Targets on LMNB2
3'UTR of LMNB2
(miRNA target sites are highlighted)
>LMNB2|NM_032737|3'UTR
   1 ACCCACACTCCTCATCCACACACCTTTCTTTACCCAGAGCCACTGAAAACTATTTTTATATCATTGGCTTTCTTTAGTTC
  81 TTGATACATTTCTAGAGAATTTCTAAGCGAACTGCCAGAACGTGTGGGTGGGTCTCCCCCAGCCCTCCCTCCTGGCGGGT
 161 CTCCTCCAGCCTCACTTCGCTGCCACTTCGCCGCTGCCCCGGAGACTTTTCAATCCCACCCCACTCCTCATCTCACCATT
 241 TGGTCAAATTGGAAGCCCAGGGCCAGGACCCGGAGGTTTAGAAGATGCTTGGGCTTGGAGGGAGGAGGGCCGGCGAGGCT
 321 AGCGAGGGGACAGGAGACGGCCCTGCTGCGGACGGAGCGCGGAAACTGCGTAGGAATTCAGTGGTGGTGGGTTTTTTTAA
 401 GGCTTTCTACAAAACCAAATTCAGAATCCAGGCGTCGACCTGGTGGGGCCCGGGGCCAAGCCTGCATTCTGGCTGCCCAG
 481 CTTCGGACAGCGGGAACTCCTCAGGCAGCCACGCAGCGGGTGTGGGCCAGCATGGGGATGGCGTGGCCCCCAGGGCGGGT
 561 TTTCACTCCGCTGCCTGGGCTTCCAGATTCCCGTTCTGGCAGCGCACCGGCCGGGTTTCTCGGACCGTTGACTTTATTTG
 641 GGGGAGTTTTCCCGCAGTTCAGTTCCTGACTGTGCAAGGCCAACAGGGCAGGGGAGGGGAAGACCTGGGGAAGGAAGAAT
 721 GAGGACAGTCCCGTCGTAAGACCTGTCACAACAATAAGCAGGGAGGGGAGATGTGGAGGGGACACATCTGGTTGCCTTGG
 801 AGGCAGAAGCTGTGAGTTTCAGAACAGCTGTCTGCAGGGAACGCCACCATGTTGACCCTCTGGAGGAGAGCGCTGTGGAG
 881 CCCCTCCCGTGTTCCAGCTCCGTCTGCCCTGTGCCTATATATACACATGCGTCTATCCATACTGTGCTTTTATCTGTGAT
 961 TTTCTCGCTGAAACCATGTTTCTCAGACAGGCCAAGGCCACCTGACTCCTATCACGACGCACCCAAGCCCCTCAGTCCAG
1041 CTTCCCAATGCCTGGCACCCCCCTTCGGCAATAGCTCACCGTTTACACCCTCCCTCATAGATACACAGAAGTTATTTTTT
1121 TAATGGATATTTATTTTTTTACATTGGTCAGTACACAGGTCAGGAGCTCACGCCAGGGCCTTGAGGACAGGCTGACCCTC
1201 CTCCCCGGGGTGGCGTGGGGCTGGGGCACCCTCCGACGGCAGAGCCTCCTTCAGAAAGTGCAGCTCAAGTCTTAAAGACA
1281 CCAAAACTGAGCCATGGGCACGCGCCGTCTCCGGGCCATGGCGTTCACTGCAGGGCGGGGGCGGCACCGCTCCCCTGTGA
1361 CTGCATCCCGCCTCCCTGGGGACCTGCCTGTGGCAGGAAGGAATGGGGGGCCCCAGCCCCAGGCCGGGAAGGAGCCAGCG
1441 GCCGACAAAGCAGAAACACCCGCTGCTCCACGTAGCCCCTGCTCGCTGTCCTTGCTCTCAGAAGTCCCGGTCCCATGTAG
1521 ATAGAGGGGGGCGCATCTTACCAAAGCATTTCCTCCTGGAGGCTACGCCGCTGTGCTCCCAGTCAGGCGGCTGGTAGGGA
1601 GCTTTGCCTGCCCCGGGGATACCCTCTGCCAGCCGCTGGAAGTGGGAATGCTGGCGACAGACTGTGTCCTCTTTCCCACC
1681 TTCATAGCAGGAATCACCCGGACCCGACTGGCTGGGCTTCGTGCTAGCGAGGGTTCTGGGGGTGGGTCTTGGTGATCTTG
1761 TCCTATGGGGAGTCTGCAGTGGTCTCAGCCACATCCTATGTATTTTGGCTCTGGAGGAGCAAAGCTGTATCCTGGAGTTG
1841 GTCTGTGATTTGCCGACAGCCTTGCAGGCTGGGCTCAGGGACAAAGTCCCCCCCAAAACCCGCAGGTCCTCATGTCCAGA
1921 CGCTGCCCAGTCCTGTCCTGAAAACAGCACGCCCCAGGCCCACAGAACCCCCCACCCTACATTTGCCTTGGGTGGAGCTG
2001 GGGGTGGTCCTAGGACTGCGGGTGCCCTTAGCTGAAGGGGGTGGGGAGAAGCGTGGACTGGGCAGCCTGTGGGTAATTGG
2081 AGGTTCATTGAGAATTGAGTCTTTGGAAACACTAAGAAAATCAAATTTTTAAAAGTTATTTATGGCCTGGGAAACAATTT
2161 GCATTTGTCCCCAAATACGCTTAGCTGTGTGCCGCTTAGAACGATGCGAAACCATCCCTCTGTGTAAGCCCGTGCCGTGT
2241 GACTCGAAGCCTAGCGCCCTCCCTGCGAAGCATCAGACGCCACCCAGCCCTGGGGGGAGGCCCACGCCTGCTGGACCAAC
2321 GCGGGTTCTGGGGTGCACAGCGCCAGGTTAACGCTGAAGCCTGCCCCGCTGAGCCCAGGAGCCGGGAGGCCTGCGGGCTG
2401 ACCCAGAATCCGATCATGCACCTGTCCTCATGCCAGCGGCTTTGGCTGGGGTTGGTCTGAAGCCTGCACGCGGCAGTTCT
2481 TTGTTAAAGATCTGAGGGACTCCTCAGTCCTGGGGCGTCGCCGCCTGCAGCCTCTTCCAAGCCCTGCGTCCAGCGAGCGT
2561 CACAGCACAACCTGCAAAAACGGAGCTGGGCTGCAGCTGGGGCTGGCATGGACTTTCATTTCAGAGATTCGGTTTTTAAG
2641 AAGATGCATGCCTAATGTGTTCTTTTTTTTTTCCAATGATTTGTAATATACATTTTATGACTGGAAACTTTTTTGTACAA
2721 CACTCCAATAAACATTTTGATTTTAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACA-G-UGUGAGGu 5'
            ||| :: |||| | ||||||| 
Target 5' gaAACTTTTTTGTACAACACTCCa 3'
2704 - 2727 160.00 -17.30
2
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       |||||||| 
Target 5' ----------accCACACTCCt 3'
1 - 12 145.00 -12.60
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ||||:||  ||| |||| 
Target 5' agctCACCGTTTACACCCTCCc 3'
1073 - 1094 138.00 -17.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30148434 37 COSMIC
COSN5850571 40 COSMIC
COSN30160147 45 COSMIC
COSN26982649 54 COSMIC
COSN30128989 62 COSMIC
COSN30173345 83 COSMIC
COSN19668496 89 COSMIC
COSN31485681 97 COSMIC
COSN30137535 108 COSMIC
COSN30136936 120 COSMIC
COSN30541940 156 COSMIC
COSN30139279 189 COSMIC
COSN17004854 272 COSMIC
COSN9351984 813 COSMIC
COSN25112477 978 COSMIC
COSN28286409 1004 COSMIC
COSN2482398 1043 COSMIC
COSN9847802 1136 COSMIC
COSN1213489 1206 COSMIC
COSN23402807 1330 COSMIC
COSN27935596 1425 COSMIC
COSN28201474 1765 COSMIC
COSN15918599 1887 COSMIC
COSN25084750 2159 COSMIC
COSN20868396 2270 COSMIC
COSN20115301 2662 COSMIC
COSN1213485 2663 COSMIC
COSN21284639 2739 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1345303749 1 dbSNP
rs142439833 2 dbSNP
rs937547847 6 dbSNP
rs1389041300 10 dbSNP
rs371773627 11 dbSNP
rs774469147 14 dbSNP
rs752023759 16 dbSNP
rs780378623 17 dbSNP
rs758940936 18 dbSNP
rs1293072735 19 dbSNP
rs750957843 20 dbSNP
rs756552926 22 dbSNP
rs750759227 32 dbSNP
rs765679951 35 dbSNP
rs761890556 37 dbSNP
rs1249807832 42 dbSNP
rs199897691 44 dbSNP
rs764444575 45 dbSNP
rs1260025481 46 dbSNP
rs1364126661 52 dbSNP
rs903819307 54 dbSNP
rs987795885 66 dbSNP
rs1308060192 67 dbSNP
rs1022315391 68 dbSNP
rs1273805687 75 dbSNP
rs745355266 76 dbSNP
rs1489178970 79 dbSNP
rs955011405 80 dbSNP
rs752410562 92 dbSNP
rs1213866494 99 dbSNP
rs892397499 108 dbSNP
rs780752714 109 dbSNP
rs1187120125 112 dbSNP
rs755348723 116 dbSNP
rs566675422 121 dbSNP
rs572640325 122 dbSNP
rs899710520 126 dbSNP
rs373147642 127 dbSNP
rs542284153 131 dbSNP
rs575214458 132 dbSNP
rs556941388 138 dbSNP
rs1326775870 141 dbSNP
rs1388237040 143 dbSNP
rs1432612547 147 dbSNP
rs1442140556 150 dbSNP
rs941116778 152 dbSNP
rs766901646 156 dbSNP
rs909517845 157 dbSNP
rs751251480 165 dbSNP
rs963907724 167 dbSNP
rs1267074312 169 dbSNP
rs1326708778 170 dbSNP
rs1207210579 176 dbSNP
rs1016735071 178 dbSNP
rs1005886285 179 dbSNP
rs1181734267 185 dbSNP
rs982868574 189 dbSNP
rs887008859 190 dbSNP
rs1172105278 192 dbSNP
rs929549260 192 dbSNP
rs763553624 193 dbSNP
rs1455910585 195 dbSNP
rs1379321036 197 dbSNP
rs1345508482 200 dbSNP
rs750875016 201 dbSNP
rs1457155090 207 dbSNP
rs1236069561 220 dbSNP
rs1014239979 222 dbSNP
rs960854851 223 dbSNP
rs538934155 232 dbSNP
rs1033853370 242 dbSNP
rs1348089840 245 dbSNP
rs980820451 251 dbSNP
rs1229785236 252 dbSNP
rs895806059 259 dbSNP
rs1055837783 260 dbSNP
rs144691121 262 dbSNP
rs1254750458 265 dbSNP
rs761795313 267 dbSNP
rs1022283032 269 dbSNP
rs183700524 271 dbSNP
rs1049910 272 dbSNP
rs946303382 275 dbSNP
rs1413669942 289 dbSNP
rs1173764418 291 dbSNP
rs1377191376 294 dbSNP
rs1435184673 305 dbSNP
rs567796589 311 dbSNP
rs988110417 312 dbSNP
rs1029986411 314 dbSNP
rs1235584991 315 dbSNP
rs1218998381 323 dbSNP
rs549377503 324 dbSNP
rs181735028 329 dbSNP
rs1212154044 330 dbSNP
rs568986656 339 dbSNP
rs955063398 342 dbSNP
rs899636851 349 dbSNP
rs1039519765 350 dbSNP
rs1233652979 352 dbSNP
rs1477861416 354 dbSNP
rs570049793 358 dbSNP
rs941084286 359 dbSNP
rs1017199484 360 dbSNP
rs879923941 361 dbSNP
rs888214149 365 dbSNP
rs1167838787 366 dbSNP
rs768946106 367 dbSNP
rs1411129074 368 dbSNP
rs551748581 369 dbSNP
rs1439069869 370 dbSNP
rs1005357383 373 dbSNP
rs929616591 376 dbSNP
rs149341537 379 dbSNP
rs1235519815 381 dbSNP
rs1297471530 399 dbSNP
rs1470364040 399 dbSNP
rs879480494 400 dbSNP
rs1273720332 402 dbSNP
rs1025586426 407 dbSNP
rs1014115576 410 dbSNP
rs895827344 414 dbSNP
rs1184874709 415 dbSNP
rs1468723079 415 dbSNP
rs1388237492 416 dbSNP
rs1443656930 420 dbSNP
rs916953657 421 dbSNP
rs1412376132 425 dbSNP
rs1057113170 433 dbSNP
rs939593409 436 dbSNP
rs565923702 437 dbSNP
rs1394814964 439 dbSNP
rs376060464 441 dbSNP
rs528150482 443 dbSNP
rs1325053122 448 dbSNP
rs551140194 449 dbSNP
rs762088223 451 dbSNP
rs529395578 452 dbSNP
rs1355678063 458 dbSNP
rs915299922 460 dbSNP
rs988278524 462 dbSNP
rs542721865 464 dbSNP
rs1275254619 469 dbSNP
rs1342469253 470 dbSNP
rs1313630488 471 dbSNP
rs1207877163 479 dbSNP
rs1419149274 480 dbSNP
rs1245898611 484 dbSNP
rs138897905 485 dbSNP
rs1052051441 486 dbSNP
rs933525897 488 dbSNP
rs1401079861 491 dbSNP
rs546993627 492 dbSNP
rs1418107539 494 dbSNP
rs963942560 499 dbSNP
rs922266502 500 dbSNP
rs1156524284 503 dbSNP
rs1018038584 504 dbSNP
rs1402838283 506 dbSNP
rs1179889619 507 dbSNP
rs1340449330 508 dbSNP
rs377192792 512 dbSNP
rs1005322414 513 dbSNP
rs1447787297 517 dbSNP
rs1192360688 520 dbSNP
rs1227958548 527 dbSNP
rs189361311 538 dbSNP
rs770607526 540 dbSNP
rs1205543655 542 dbSNP
rs776134634 543 dbSNP
rs993968554 544 dbSNP
rs1212938487 547 dbSNP
rs1218471688 551 dbSNP
rs1471991311 554 dbSNP
rs895439980 557 dbSNP
rs1365222083 564 dbSNP
rs1471346559 566 dbSNP
rs1025863111 567 dbSNP
rs992705526 569 dbSNP
rs1433334680 570 dbSNP
rs544970919 574 dbSNP
rs1409325155 577 dbSNP
rs939562133 581 dbSNP
rs1305094845 583 dbSNP
rs926845623 586 dbSNP
rs1034325684 590 dbSNP
rs578029528 592 dbSNP
rs777564541 593 dbSNP
rs1212871165 600 dbSNP
rs1280993254 603 dbSNP
rs1482424218 607 dbSNP
rs1193619227 608 dbSNP
rs769347726 609 dbSNP
rs1252209458 612 dbSNP
rs879190072 613 dbSNP
rs1001518211 616 dbSNP
rs988592219 618 dbSNP
rs747598409 621 dbSNP
rs956819981 622 dbSNP
rs1021750581 626 dbSNP
rs553189423 627 dbSNP
rs1429161826 632 dbSNP
rs1296585452 639 dbSNP
rs780844749 640 dbSNP
rs1162482254 642 dbSNP
rs1010728744 648 dbSNP
rs1323164625 651 dbSNP
rs891971790 653 dbSNP
rs75202524 654 dbSNP
rs1169464416 662 dbSNP
rs1224604543 667 dbSNP
rs1252482635 668 dbSNP
rs933580470 670 dbSNP
rs1476557552 675 dbSNP
rs900728329 675 dbSNP
rs743578 677 dbSNP
rs751872464 683 dbSNP
rs1195949379 686 dbSNP
rs564637701 689 dbSNP
rs1428515887 695 dbSNP
rs942406769 696 dbSNP
rs1462587945 702 dbSNP
rs1162858571 710 dbSNP
rs1392614476 711 dbSNP
rs555547660 715 dbSNP
rs909538771 732 dbSNP
rs1380396339 733 dbSNP
rs537563812 735 dbSNP
rs994297246 736 dbSNP
rs1243487433 738 dbSNP
rs918443835 741 dbSNP
rs992590011 743 dbSNP
rs1215938978 745 dbSNP
rs1219856357 746 dbSNP
rs1485758017 751 dbSNP
rs959851108 752 dbSNP
rs1264529595 754 dbSNP
rs1470077275 779 dbSNP
rs200429328 789 dbSNP
rs1218184793 794 dbSNP
rs979985011 796 dbSNP
rs1463146969 797 dbSNP
rs1165937493 803 dbSNP
rs1316281034 804 dbSNP
rs1451402246 804 dbSNP
rs1290530928 808 dbSNP
rs1362640084 809 dbSNP
rs968781340 810 dbSNP
rs1297903017 813 dbSNP
rs1356822916 818 dbSNP
rs1022010841 819 dbSNP
rs1010323804 820 dbSNP
rs1316665027 825 dbSNP
rs531061375 828 dbSNP
rs1215209108 831 dbSNP
rs1214154399 832 dbSNP
rs956296350 835 dbSNP
rs1486515248 839 dbSNP
rs1210799974 842 dbSNP
rs1255415571 843 dbSNP
rs895587967 848 dbSNP
rs1056927900 849 dbSNP
rs1001189218 850 dbSNP
rs1188875970 850 dbSNP
rs1417063857 853 dbSNP
rs1438383751 854 dbSNP
rs1433953211 859 dbSNP
rs997715062 859 dbSNP
rs1260771101 860 dbSNP
rs905563502 863 dbSNP
rs1330276637 864 dbSNP
rs900656333 868 dbSNP
rs1414910281 869 dbSNP
rs1463784316 872 dbSNP
rs1039345007 873 dbSNP
rs1222415440 876 dbSNP
rs1006878874 882 dbSNP
rs1432044674 886 dbSNP
rs780519222 887 dbSNP
rs946954631 888 dbSNP
rs1234136895 894 dbSNP
rs758678643 895 dbSNP
rs1052629983 897 dbSNP
rs569906631 908 dbSNP
rs1455870161 914 dbSNP
rs922692008 915 dbSNP
rs1232511091 917 dbSNP
rs541475286 919 dbSNP
rs558181995 920 dbSNP
rs1198407340 922 dbSNP
rs375513770 927 dbSNP
rs929753518 929 dbSNP
rs1396862610 930 dbSNP
rs918363302 930 dbSNP
rs1056788897 931 dbSNP
rs938556721 940 dbSNP
rs942693948 942 dbSNP
rs911260034 946 dbSNP
rs201799670 952 dbSNP
rs771536936 958 dbSNP
rs1350761802 959 dbSNP
rs952676184 959 dbSNP
rs747845203 964 dbSNP
rs969000935 968 dbSNP
rs1308343799 977 dbSNP
rs914597654 982 dbSNP
rs1025877932 989 dbSNP
rs956053609 991 dbSNP
rs1467848868 992 dbSNP
rs1254809273 994 dbSNP
rs185851026 1002 dbSNP
rs1167272093 1008 dbSNP
rs1465115784 1009 dbSNP
rs1416704288 1013 dbSNP
rs997600613 1016 dbSNP
rs1356879557 1017 dbSNP
rs964911396 1018 dbSNP
rs1393342216 1019 dbSNP
rs1440618403 1020 dbSNP
rs960174731 1035 dbSNP
rs1035431593 1039 dbSNP
rs1177586668 1047 dbSNP
rs547704249 1048 dbSNP
rs1001324934 1049 dbSNP
rs1017745232 1058 dbSNP
rs905488435 1061 dbSNP
rs1216451906 1064 dbSNP
rs1396182132 1064 dbSNP
rs1006489498 1071 dbSNP
rs1212060908 1072 dbSNP
rs887995643 1075 dbSNP
rs563533687 1080 dbSNP
rs568324415 1081 dbSNP
rs1252962751 1084 dbSNP
rs1011546891 1088 dbSNP
rs896819565 1091 dbSNP
rs1056849225 1092 dbSNP
rs1416714819 1096 dbSNP
rs938394298 1097 dbSNP
rs1166664055 1100 dbSNP
rs1397080186 1102 dbSNP
rs1482972417 1107 dbSNP
rs1406351715 1111 dbSNP
rs1318220006 1112 dbSNP
rs927137520 1116 dbSNP
rs1432970017 1118 dbSNP
rs1044594055 1122 dbSNP
rs1354912356 1124 dbSNP
rs1213104369 1133 dbSNP
rs1231627812 1134 dbSNP
rs894075324 1134 dbSNP
rs1295379008 1142 dbSNP
rs1356746224 1146 dbSNP
rs1053139109 1149 dbSNP
rs1204387147 1150 dbSNP
rs1282052611 1155 dbSNP
rs1448736536 1156 dbSNP
rs935499239 1159 dbSNP
rs1216422609 1169 dbSNP
rs548755171 1171 dbSNP
rs914496980 1172 dbSNP
rs988730256 1189 dbSNP
rs1237733663 1196 dbSNP
rs1418176002 1197 dbSNP
rs765597077 1201 dbSNP
rs1158417156 1204 dbSNP
rs934680847 1206 dbSNP
rs1041106939 1207 dbSNP
rs1413055074 1211 dbSNP
rs1314976542 1212 dbSNP
rs942787674 1214 dbSNP
rs192858127 1215 dbSNP
rs976164624 1216 dbSNP
rs1277490035 1217 dbSNP
rs964763664 1219 dbSNP
rs1240726876 1221 dbSNP
rs984106696 1228 dbSNP
rs931332225 1234 dbSNP
rs918499414 1235 dbSNP
rs563127200 1237 dbSNP
rs867853723 1238 dbSNP
rs1314221489 1246 dbSNP
rs1484387999 1252 dbSNP
rs1212467480 1254 dbSNP
rs1017792083 1257 dbSNP
rs1436794017 1266 dbSNP
rs1376618935 1277 dbSNP
rs545023758 1281 dbSNP
rs985389402 1290 dbSNP
rs1365847965 1291 dbSNP
rs959897424 1292 dbSNP
rs190368272 1294 dbSNP
rs1395061829 1295 dbSNP
rs371882770 1299 dbSNP
rs1175679853 1300 dbSNP
rs1403007877 1301 dbSNP
rs541354930 1306 dbSNP
rs896829443 1307 dbSNP
rs1337272314 1308 dbSNP
rs573841374 1309 dbSNP
rs1447301184 1311 dbSNP
rs969808320 1313 dbSNP
rs1190211120 1314 dbSNP
rs1035284343 1318 dbSNP
rs1236407769 1321 dbSNP
rs1256009627 1322 dbSNP
rs1021276642 1323 dbSNP
rs1276728453 1329 dbSNP
rs1338202076 1331 dbSNP
rs1011222688 1333 dbSNP
rs1193677344 1336 dbSNP
rs1002591426 1337 dbSNP
rs891483708 1342 dbSNP
rs555544252 1343 dbSNP
rs543551752 1344 dbSNP
rs1044133087 1345 dbSNP
rs947235605 1352 dbSNP
rs892961580 1353 dbSNP
rs1378225913 1356 dbSNP
rs576513490 1358 dbSNP
rs934522681 1359 dbSNP
rs1398973243 1362 dbSNP
rs923283133 1368 dbSNP
rs1000223929 1369 dbSNP
rs557842324 1370 dbSNP
rs58852705 1374 dbSNP
rs565749549 1376 dbSNP
rs1224672085 1382 dbSNP
rs889851732 1384 dbSNP
rs1319608134 1390 dbSNP
rs1212688520 1398 dbSNP
rs1294697022 1406 dbSNP
rs1048986932 1407 dbSNP
rs1414898299 1411 dbSNP
rs984886635 1415 dbSNP
rs952352209 1416 dbSNP
rs1026443781 1417 dbSNP
rs931323854 1420 dbSNP
rs1425877321 1423 dbSNP
rs554002382 1423 dbSNP
rs960915888 1425 dbSNP
rs1036912503 1426 dbSNP
rs938605704 1427 dbSNP
rs1384236185 1435 dbSNP
rs543938023 1440 dbSNP
rs1297017652 1441 dbSNP
rs979949872 1443 dbSNP
rs969902992 1444 dbSNP
rs1232250957 1457 dbSNP
rs535748569 1457 dbSNP
rs1415981952 1460 dbSNP
rs1002516479 1461 dbSNP
rs1167286506 1462 dbSNP
rs905522072 1466 dbSNP
rs1266535073 1469 dbSNP
rs914310855 1470 dbSNP
rs1485787666 1471 dbSNP
rs1203907904 1475 dbSNP
rs1265362051 1476 dbSNP
rs1488673822 1479 dbSNP
rs1187455295 1483 dbSNP
rs1023169831 1484 dbSNP
rs1475585424 1485 dbSNP
rs1363018480 1488 dbSNP
rs753924748 1491 dbSNP
rs1451467945 1501 dbSNP
rs1290586215 1506 dbSNP
rs573380520 1508 dbSNP
rs116370116 1510 dbSNP
rs1413683076 1512 dbSNP
rs1191593484 1516 dbSNP
rs1170626013 1521 dbSNP
rs140604670 1522 dbSNP
rs1357041126 1526 dbSNP
rs148368930 1526 dbSNP
rs1049912 1528 dbSNP
rs1262322100 1532 dbSNP
rs999746457 1537 dbSNP
rs770822701 1546 dbSNP
rs1316717666 1552 dbSNP
rs1420917824 1553 dbSNP
rs934584811 1561 dbSNP
rs1488645018 1563 dbSNP
rs1019849831 1565 dbSNP
rs1007002227 1569 dbSNP
rs1484320300 1575 dbSNP
rs1487361430 1581 dbSNP
rs1049913 1584 dbSNP
rs1274665171 1586 dbSNP
rs1233454563 1589 dbSNP
rs1316904289 1590 dbSNP
rs1417113859 1592 dbSNP
rs1275826305 1594 dbSNP
rs1228935065 1597 dbSNP
rs1160352462 1599 dbSNP
rs143452400 1601 dbSNP
rs901786632 1606 dbSNP
rs1048473436 1607 dbSNP
rs1171277367 1608 dbSNP
rs1296858759 1609 dbSNP
rs995999710 1611 dbSNP
rs762583971 1614 dbSNP
rs1297280294 1616 dbSNP
rs1373009940 1620 dbSNP
rs1390075663 1621 dbSNP
rs943386708 1624 dbSNP
rs1355129696 1626 dbSNP
rs1049914 1628 dbSNP
rs1234206756 1634 dbSNP
rs1278215899 1636 dbSNP
rs1314048086 1645 dbSNP
rs1211039018 1654 dbSNP
rs1037452745 1656 dbSNP
rs938557271 1657 dbSNP
rs1479525382 1660 dbSNP
rs1049616678 1664 dbSNP
rs928517262 1666 dbSNP
rs1453656825 1668 dbSNP
rs1049915 1671 dbSNP
rs1191688832 1675 dbSNP
rs1044363425 1677 dbSNP
rs1166282063 1679 dbSNP
rs1169278654 1680 dbSNP
rs972182092 1696 dbSNP
rs960842156 1697 dbSNP
rs1464388112 1699 dbSNP
rs928247940 1710 dbSNP
rs980980799 1711 dbSNP
rs1476406568 1715 dbSNP
rs1373606936 1717 dbSNP
rs1197995366 1720 dbSNP
rs1219939957 1725 dbSNP
rs1272549982 1726 dbSNP
rs1431239351 1729 dbSNP
rs1200765886 1734 dbSNP
rs948526312 1735 dbSNP
rs1258407336 1752 dbSNP
rs1480662009 1757 dbSNP
rs1254717957 1759 dbSNP
rs970165755 1764 dbSNP
rs551210772 1765 dbSNP
rs1248429461 1774 dbSNP
rs1457072642 1780 dbSNP
rs1255735002 1784 dbSNP
rs532922596 1785 dbSNP
rs563498609 1786 dbSNP
rs1189417008 1797 dbSNP
rs1478564210 1798 dbSNP
rs1401433182 1799 dbSNP
rs1049916 1800 dbSNP
rs1339424685 1803 dbSNP
rs1031409313 1807 dbSNP
rs1322122289 1809 dbSNP
rs1352180202 1811 dbSNP
rs148818996 1813 dbSNP
rs1269603065 1815 dbSNP
rs924270010 1816 dbSNP
rs1040355353 1819 dbSNP
rs1306138105 1820 dbSNP
rs529253937 1827 dbSNP
rs1333847985 1831 dbSNP
rs1231284976 1833 dbSNP
rs976137846 1834 dbSNP
rs1452045087 1835 dbSNP
rs1214997039 1836 dbSNP
rs1239811670 1837 dbSNP
rs965715962 1841 dbSNP
rs1327057998 1842 dbSNP
rs1416781505 1848 dbSNP
rs1475078514 1849 dbSNP
rs1049028990 1855 dbSNP
rs1049917 1860 dbSNP
rs1397228570 1864 dbSNP
rs930740222 1873 dbSNP
rs1318277920 1878 dbSNP
rs1172051338 1880 dbSNP
rs1019818482 1881 dbSNP
rs1358664942 1884 dbSNP
rs1299010575 1887 dbSNP
rs1242887571 1888 dbSNP
rs919372340 1890 dbSNP
rs1396773014 1891 dbSNP
rs1223105349 1893 dbSNP
rs1283850694 1895 dbSNP
rs1007137872 1899 dbSNP
rs1355200937 1899 dbSNP
rs939554816 1907 dbSNP
rs1438797737 1911 dbSNP
rs1230851039 1912 dbSNP
rs1239532253 1913 dbSNP
rs1473351396 1914 dbSNP
rs561725980 1916 dbSNP
rs1027575837 1921 dbSNP
rs543628244 1929 dbSNP
rs769569477 1930 dbSNP
rs969631429 1933 dbSNP
rs915573060 1935 dbSNP
rs1438035394 1950 dbSNP
rs897250346 1953 dbSNP
rs957251268 1961 dbSNP
rs1306976176 1965 dbSNP
rs1031461532 1973 dbSNP
rs761810114 1974 dbSNP
rs1346404214 1976 dbSNP
rs1283033402 1978 dbSNP
rs1342293878 1980 dbSNP
rs1015701593 1991 dbSNP
rs1278950547 1992 dbSNP
rs1353360501 1998 dbSNP
rs372589275 2001 dbSNP
rs1236734561 2004 dbSNP
rs907235298 2005 dbSNP
rs1179840854 2009 dbSNP
rs1394514437 2014 dbSNP
rs1018756737 2019 dbSNP
rs1044332592 2024 dbSNP
rs1174512069 2025 dbSNP
rs1007902578 2026 dbSNP
rs1049918 2043 dbSNP
rs1049919 2046 dbSNP
rs1409152645 2055 dbSNP
rs1328967852 2056 dbSNP
rs948618713 2060 dbSNP
rs747687462 2061 dbSNP
rs1169337742 2062 dbSNP
rs1049922 2064 dbSNP
rs1302626761 2065 dbSNP
rs564568477 2072 dbSNP
rs1275068710 2073 dbSNP
rs1049923 2075 dbSNP
rs1336569413 2077 dbSNP
rs1333635456 2087 dbSNP
rs1049433056 2088 dbSNP
rs976207615 2091 dbSNP
rs1199787401 2094 dbSNP
rs545899805 2097 dbSNP
rs572061647 2100 dbSNP
rs1174138964 2108 dbSNP
rs1049924 2110 dbSNP
rs1168828394 2122 dbSNP
rs1402153895 2124 dbSNP
rs934401597 2125 dbSNP
rs1405594561 2126 dbSNP
rs776158249 2128 dbSNP
rs553795982 2131 dbSNP
rs1388449598 2132 dbSNP
rs1323578141 2135 dbSNP
rs924344323 2140 dbSNP
rs1325367853 2142 dbSNP
rs975841285 2144 dbSNP
rs543296714 2149 dbSNP
rs1279740924 2164 dbSNP
rs1320422178 2167 dbSNP
rs1219695015 2171 dbSNP
rs1265368496 2193 dbSNP
rs1236512969 2196 dbSNP
rs1487753711 2201 dbSNP
rs184609927 2202 dbSNP
rs892420245 2207 dbSNP
rs910222316 2209 dbSNP
rs1191743673 2212 dbSNP
rs575110213 2222 dbSNP
rs1478020999 2224 dbSNP
rs772913050 2226 dbSNP
rs1163724671 2232 dbSNP
rs1366508126 2237 dbSNP
rs556459488 2241 dbSNP
rs1459333475 2246 dbSNP
rs1260238364 2250 dbSNP
rs773597868 2255 dbSNP
rs1212155681 2265 dbSNP
rs372255864 2266 dbSNP
rs1397647692 2279 dbSNP
rs866925794 2283 dbSNP
rs1353596172 2287 dbSNP
rs1340817445 2289 dbSNP
rs538406901 2290 dbSNP
rs35146837 2291 dbSNP
rs974629537 2291 dbSNP
rs906716713 2294 dbSNP
rs1320319058 2297 dbSNP
rs1225795602 2298 dbSNP
rs570974333 2306 dbSNP
rs1353053457 2309 dbSNP
rs557770656 2314 dbSNP
rs1214625501 2322 dbSNP
rs1283766912 2323 dbSNP
rs1488705614 2325 dbSNP
rs1231565849 2334 dbSNP
rs1357371845 2341 dbSNP
rs1425376665 2354 dbSNP
rs1165365416 2356 dbSNP
rs1379678736 2360 dbSNP
rs1417315183 2363 dbSNP
rs368027066 2364 dbSNP
rs1016085895 2365 dbSNP
rs948321251 2367 dbSNP
rs1343334236 2368 dbSNP
rs1433665224 2374 dbSNP
rs1300752835 2385 dbSNP
rs1377396572 2386 dbSNP
rs1314055252 2393 dbSNP
rs1376721765 2394 dbSNP
rs1238624281 2398 dbSNP
rs375786190 2400 dbSNP
rs551457133 2403 dbSNP
rs907163181 2411 dbSNP
rs1022978190 2413 dbSNP
rs1254536123 2420 dbSNP
rs990133033 2421 dbSNP
rs1412664220 2422 dbSNP
rs1162268420 2426 dbSNP
rs1012809642 2427 dbSNP
rs1380337211 2436 dbSNP
rs11542333 2440 dbSNP
rs1432136344 2440 dbSNP
rs924235345 2467 dbSNP
rs893058688 2469 dbSNP
rs1054409861 2472 dbSNP
rs539544295 2476 dbSNP
rs1400051929 2479 dbSNP
rs934483956 2489 dbSNP
rs986004979 2490 dbSNP
rs746723503 2496 dbSNP
rs1485847927 2511 dbSNP
rs1240837595 2512 dbSNP
rs3209976 2516 dbSNP
rs539716369 2516 dbSNP
rs1218409196 2528 dbSNP
rs1314096545 2541 dbSNP
rs565679480 2549 dbSNP
rs1027606337 2553 dbSNP
rs1257139622 2555 dbSNP
rs866043644 2565 dbSNP
rs1272786859 2566 dbSNP
rs569250924 2567 dbSNP
rs995159681 2567 dbSNP
rs1337221836 2568 dbSNP
rs903057313 2570 dbSNP
rs1294028173 2580 dbSNP
rs779570026 2582 dbSNP
rs1433357816 2586 dbSNP
rs547459712 2588 dbSNP
rs569112801 2589 dbSNP
rs1423317748 2591 dbSNP
rs944469199 2593 dbSNP
rs1355696690 2598 dbSNP
rs529151219 2600 dbSNP
rs561986775 2601 dbSNP
rs1014842425 2603 dbSNP
rs549821496 2607 dbSNP
rs1369849816 2617 dbSNP
rs1431213063 2619 dbSNP
rs1224316297 2624 dbSNP
rs906601992 2630 dbSNP
rs1220302507 2631 dbSNP
rs1323634589 2648 dbSNP
rs1050009 2656 dbSNP
rs1394723211 2659 dbSNP
rs1169394703 2664 dbSNP
rs1450900143 2664 dbSNP
rs528719343 2667 dbSNP
rs1247902833 2669 dbSNP
rs191850831 2672 dbSNP
rs1192451265 2673 dbSNP
rs35520147 2673 dbSNP
rs397859894 2673 dbSNP
rs76278622 2673 dbSNP
rs1420686867 2675 dbSNP
rs893964935 2676 dbSNP
rs1163331678 2678 dbSNP
rs1188736247 2679 dbSNP
rs1405680909 2681 dbSNP
rs1297811528 2686 dbSNP
rs545887667 2688 dbSNP
rs1252825086 2691 dbSNP
rs757803131 2692 dbSNP
rs1212179680 2696 dbSNP
rs961841610 2699 dbSNP
rs1470033726 2701 dbSNP
rs1015772745 2716 dbSNP
rs1402091692 2722 dbSNP
rs1273992432 2729 dbSNP
rs1054046512 2732 dbSNP
rs981487739 2734 dbSNP
rs935548999 2741 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000325327.3 | 3UTR | UAAUAUACAUUUUAUGACUGGAAACUUUUUUGUACAACACUCCAAUAAACAUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000325327.3 | 3UTR | UAAUAUACAUUUUAUGACUGGAAACUUUUUUGUACAACACUCCAAUAAACAUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000325327.3 | 3UTR | UAAUAUACAUUUUAUGACUGGAAACUUUUUUGUACAACACUCCAAUAAACAUUUUGAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000325327.3 | 3UTR | AUUUGUAAUAUACAUUUUAUGACUGGAAACUUUUUUGUACAACACUCCAAUAAACAUUUUGAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000325327.3 | 3UTR | UAAUAUACAUUUUAUGACUGGAAACUUUUUUGUACAACACUCCAAUAAACAUUUUGAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*