miRTarBase - #MIRT032077 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DLK1   
Synonyms DLK, DLK-1, Delta1, FA1, PREF1, Pref-1, ZOG, pG2
Description delta like non-canonical Notch ligand 1
Transcript NM_003836   
Expression
Putative miRNA Targets on DLK1
3'UTR of DLK1
(miRNA target sites are highlighted)
>DLK1|NM_003836|3'UTR
   1 GCAGCGTTCCCACAGCCCCCTCTAGATTCTTGGAGTTCCGCAGAGCTTACTATACGCGGTCTGTCCTAATCTTTGTGGTG
  81 TTCGCTATCTCTTGTGTCAAATCTGGTGAACGCTACGCTTACATATATTGTCTTTGTGCTGCTGTGTGACAAACGCAATG
 161 CAAAAACAATCCTCTTTCTCTCTCTTAATGCATGATACAGAATAATAATAAGAATTTCATCTTTAAATGAGTAAGAGAAA
 241 TAAGTATGTTATTCTAAAATCTAAACTCAAATGAAATTTCAAAAAAGACCAAAAAAAAACAAGGCAACAGAACCAGGGCT
 321 CAGTGCCGACGCCCCTACCCTGGGGGTCTCGGCCACATGGTCCTCGTGAAACCGTTACGAGTGCTGTACATGACCACCCA
 401 CTGTGCAAAGAGCTACGATTGCTTTCGTTCGTTAATTCTCACACACCACATCCGACTCGCACTCACATCCAGCTCAACAT
 481 CGCTACCTTTAGATCTTTCCGATTGATTTGAGATTTAGCGGAGTGCAGCGGCTGTGTGTCAGTCAGAGAGAGCCCCAGGT
 561 TGGCTGCTGGGGGGCCGGGCCTCTGTGCCAGCCCTGCCACTAACTCGCTGTGTGATCCTTGGCGAGTCCCTATCCCAATC
 641 CTGGGCCCACTTTCTCGCCCCTCTCGAGGGAGGGGTTTGAACACCGACCACCATGGTCCTCTCTGGCTCTAAAACTCTGA
 721 ATTAGGAACGAGGGGGTATGAACCAAAACACTTCCTGACCCCAACAATTGGGATCTGATGAAGACGAATTCTCATCCTGG
 801 GATCCGAAAGGTTTTGGCCTATCCTGGATGAACGCTTGATGTTGAAATTTATCCTAACTGTGTTTCTCAAAGTGGGGAGC
 881 CTCCTGGCCCACTTCCCTTTTGGGAAAAAATAGCCCCTTTGAGTCATAATGTGCCATCTGGAGTTGCCACTTAGGCAGCC
 961 AGCCCTCCCCCACCCCTCTTTGCCCACCCAGAACCCCAACACTATACCTGCCTCTACCCTATAGAGACATCCCTTGAGAC
1041 TTGAATGTACTTTGAGCCGCAAGTGCCCCTGGCAGAATCTGAGCAGCAACACAGCCCTCACCAAGGTTTTCACAGGGATT
1121 AGTGGAAATTGTCACTTGTGGGGCGCTTACTAGTTTTGTGGCAAATGTGGTCCAAGACCTGGCCCACACAGCCATGGGTT
1201 TACATTTGTGTTGCTGAGTTAATAATCCTCAGATCTCAAAAGACCTAGCCAGCTTCTGAATTTTGAATTTGACTTTTTTT
1281 TTTTTTTTAACAAAGAGCATCTATCTTTTTTGCAAAAATAGAAAGAAATGGGACAGAGCTCTGTTTAGCTTTTCAGCTTT
1361 TGGGGTTGGACAGCTAAACAGCCCTTGGGTACCAGATAGGAATATTTTGCTTCTTAGATTATTTGGATAAGAATCTATAC
1441 TCTTAGCTTTATTGAGCATTGCCTGCCGTGTTTACCTTGCTCCAGGTGTTTATTTCTAAGTCATCATCACCTTCGTCATC
1521 TACAGTCAGTCACATCAGTCACCCACACACAACTCACAGTCACCCATCCATTGGTCACCTGCGCCATCGTCATGACACAA
1601 TATCGACCTCATCACCTCATCGTCCTCCAGCCACTACCCAAGCCCCCTCATCCTGACTCAAAGCCCGACCAGCATCTGCC
1681 CAAACTCCCAACACCCCACTCTCCCCACCAAGCCATTGGTCTCCTCACTCCCGGTCCTTTGTCATCCTGATTCCAAGCCC
1761 CGCCCCACCCTCACCGCCTCCTCCGCATCATCTGCACTCTGCAGAGCCCCTCCTACCCGCCTCTGTCCCCACCAGGCCCC
1841 TCCCTACCGTCAGCCCTGAGTCCCACAGCACGCGTCCCCAGCCCCTCCCAGCCTCACCCCAAAAACCCTGTCACCCCACC
1921 GACCACCATCATCACTGGCAAGCCCCTTCCCCTTCTCCAGCTCCCGTCCCCACTACCCCTCCCGTCCCCCAATCCTTCCC
2001 CTCCTGTTAGCCCACCCCTCCTTTCCTATCACCCCCACCTTTCCCTTCCCATTCTCCCCACCCTTCCCCTCCGATCCCAC
2081 CACCCTTCCCTTCCGATCCCCGTCATCCTTCCCCTCTGATCCCCCACCCTTCCCCTCCTGTCCTCCCCAGCCCTCCCTTC
2161 CTATCACCCTCACCCTTCCCCTCCCGTTCTCCCCACCCTTCCCCTCCTGTCTCCACCAGCCCTCCCTTCCTATCACCCCC
2241 ACCCTTCTCCTCCCTTCCCTCACCCCAAACCCCTGGGTCCTCCACCCCAATCTCTGACAACCGCCCCAAGTCCCTCTTCC
2321 TTCCCCACGAAGTCATTCATAAGTCACCATCTCATCTCATTTTGAGTTTGTTTTAAGAAATAAAAAAATTAAAAAGACAA
2401 AAAAAAGAATTGTTGGCATGTGTCAGGCGGGCGTCTGGTACCCTGCCTGGCCTCTCTCAGCGTGAGACCTGGACTGAGCC
2481 TGCTAACGATTCTGTTCCTCAGTTTCCCCAAATAGAAAATTCTAAGATTGGTCAGATGATCAAATTATCTATGTTTTCGA
2561 TCTTGATGCTATAGAGAACAGCCATGTTCCCCTGATAACAAGAAAAAGACGTCCCACGGTCGAGGTATCCTTGACCAACT
2641 CCCCATCCATTCATTTGTTCACCGTCCACAACCCATCTGATCAGGAAGCATTTCCAGGCACCTGCGGAGCACTAGGCAGT
2721 GTGCGGAAGCTGCAGGGCAGGCAGGACGAGGGGGCAGTCTGGAGGGGGGTGGACACACAGCTGTCCCCAGGGAGCCCAGC
2801 GCGGTGCCGGTCACATGCCGTGGGAGTGGAGGGTCTTGAGCAGACGCCTCCCTTGGAGAAGAGCCACCATCTCACCTTCC
2881 CACGCAACAAATTATCTATTACCAGCACCCGATGAGGCCGTCCCTCCCAAATTCCACAGTGCCCACCACTCGCACTACCC
2961 CCCCCGTGCCACAGAAGCAGTGTCAGCAGCCTCGCCACGGTCTTCACGTCATGCAGAAATGGTCATTCCATGTTCTATGG
3041 CCACCAGATTCTGCTGAGAGTGTCGGGATCCTTGACTGCCCAGCCACACCTTGTGTGTGTCTGGTGTAGTGTGTAGTTTA
3121 CGAAACAAACGGAAAAGCTCAAAGACAGCGATCCAAGACATGATCAGCAATTTGGTCCCAAATTAGGAGAGGAGGAAGAG
3201 GAGTATCAATTTTGTCACCAAAATGTTAAAAAAAATGTCCTTGGCGCTCTTTTTAGCTTTCCCGTTTACTACCAGTCCAG
3281 ACATGCAAAAAAACCTTGTTTATTGAAAAATAAACAACAAGGGCTAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            :| |:::| | ||||||||| 
Target 5' caTATATTGTCTTTGTGCTGCTg 3'
122 - 144 160.00 -16.40
2
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 |||| ||||:|||| 
Target 5' gggtttaCATT-TGTGTTGCTg 3'
1196 - 1216 146.00 -15.20
3
miRNA  3' gugUUUGGUAAU--ACACGACGau 5'
             |||||:|||   ||||||:  
Target 5' gtgAAACCGTTACGAGTGCTGTac 3'
366 - 389 137.00 -16.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM7901556 1 COSMIC
COSN30518938 6 COSMIC
COSN8587954 7 COSMIC
COSN30449578 12 COSMIC
COSN30475537 19 COSMIC
COSN31512112 20 COSMIC
COSN24313455 34 COSMIC
COSN26973538 40 COSMIC
COSN30456596 40 COSMIC
COSN30177373 54 COSMIC
COSN30524264 56 COSMIC
COSN28852053 57 COSMIC
COSN31502754 58 COSMIC
COSN30516928 68 COSMIC
COSN13570285 84 COSMIC
COSN19668069 85 COSMIC
COSN16040806 113 COSMIC
COSN30109991 117 COSMIC
COSN1164166 173 COSMIC
COSN28630915 175 COSMIC
COSN23081072 300 COSMIC
COSN16013623 375 COSMIC
COSN8139397 921 COSMIC
COSN5380546 930 COSMIC
COSN8139398 952 COSMIC
COSN16537259 1034 COSMIC
COSN8821552 1272 COSMIC
COSN1164167 1292 COSMIC
COSN8821553 1316 COSMIC
COSN5380547 1609 COSMIC
COSN26445319 1955 COSMIC
COSN2532751 2080 COSMIC
COSN7428698 2803 COSMIC
COSN1637945 2811 COSMIC
COSN8139399 2847 COSMIC
COSN22813898 2966 COSMIC
COSN16148574 2967 COSMIC
COSN19124333 3246 COSMIC
COSN21012842 3251 COSMIC
rs78420139 455 GWAS
rs1555406 3003 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757350561 6 dbSNP
rs201917535 7 dbSNP
rs770142612 12 dbSNP
rs1245760028 13 dbSNP
rs780524490 16 dbSNP
rs749687069 17 dbSNP
rs768952049 19 dbSNP
rs774891084 21 dbSNP
rs369878911 26 dbSNP
rs58929007 27 dbSNP
rs1162552005 37 dbSNP
rs372726109 40 dbSNP
rs774645789 40 dbSNP
rs7501 41 dbSNP
rs753535246 50 dbSNP
rs759340429 51 dbSNP
rs764376062 53 dbSNP
rs145282046 54 dbSNP
rs567161250 56 dbSNP
rs1229202324 57 dbSNP
rs189304474 58 dbSNP
rs992457600 59 dbSNP
rs1286473884 60 dbSNP
rs915602656 63 dbSNP
rs1390757476 65 dbSNP
rs181106921 76 dbSNP
rs1001832694 84 dbSNP
rs1043227899 88 dbSNP
rs1440282328 95 dbSNP
rs1458441171 96 dbSNP
rs866750448 112 dbSNP
rs569399875 113 dbSNP
rs780676086 115 dbSNP
rs934471464 117 dbSNP
rs1052897584 118 dbSNP
rs1415228840 123 dbSNP
rs901063121 124 dbSNP
rs1175364171 126 dbSNP
rs754354157 127 dbSNP
rs1242866684 128 dbSNP
rs1051767292 129 dbSNP
rs1471072574 147 dbSNP
rs757881220 155 dbSNP
rs1399991611 160 dbSNP
rs796443575 172 dbSNP
rs1297985425 177 dbSNP
rs897544942 177 dbSNP
rs1447933968 184 dbSNP
rs536768855 188 dbSNP
rs1030387218 193 dbSNP
rs757147702 198 dbSNP
rs963510015 199 dbSNP
rs1351077665 201 dbSNP
rs569901568 209 dbSNP
rs868805054 213 dbSNP
rs1218136552 222 dbSNP
rs532422725 228 dbSNP
rs1189692624 247 dbSNP
rs547835466 248 dbSNP
rs1259977482 262 dbSNP
rs1204740297 273 dbSNP
rs1026489115 284 dbSNP
rs960278078 288 dbSNP
rs1018504740 289 dbSNP
rs1216378905 291 dbSNP
rs1220175409 291 dbSNP
rs1275256509 291 dbSNP
rs1230409953 299 dbSNP
rs993115395 303 dbSNP
rs1362740772 314 dbSNP
rs1294445276 321 dbSNP
rs1386942966 326 dbSNP
rs915567930 328 dbSNP
rs1291224051 329 dbSNP
rs779116357 331 dbSNP
rs990311135 335 dbSNP
rs978469564 336 dbSNP
rs946093892 339 dbSNP
rs1432064172 340 dbSNP
rs981565002 342 dbSNP
rs1192771849 347 dbSNP
rs1200229271 351 dbSNP
rs185637157 352 dbSNP
rs1488113304 353 dbSNP
rs1269561970 356 dbSNP
rs934418965 360 dbSNP
rs535837138 366 dbSNP
rs750485284 367 dbSNP
rs758581806 374 dbSNP
rs933900974 375 dbSNP
rs535625574 379 dbSNP
rs1250495621 380 dbSNP
rs1233528455 382 dbSNP
rs747210408 391 dbSNP
rs1313659643 395 dbSNP
rs572806144 395 dbSNP
rs1298726160 396 dbSNP
rs118122626 398 dbSNP
rs1350539412 399 dbSNP
rs1309201301 413 dbSNP
rs1412162512 416 dbSNP
rs777493399 417 dbSNP
rs1037718295 418 dbSNP
rs1293646741 422 dbSNP
rs1379646706 427 dbSNP
rs899211777 427 dbSNP
rs558485657 428 dbSNP
rs147566560 431 dbSNP
rs749216989 432 dbSNP
rs1277190827 439 dbSNP
rs1318086702 440 dbSNP
rs544405958 445 dbSNP
rs896017634 447 dbSNP
rs1018472166 448 dbSNP
rs1321102741 454 dbSNP
rs78420139 455 dbSNP
rs1023616545 460 dbSNP
rs1289613749 467 dbSNP
rs1490868413 479 dbSNP
rs970349536 480 dbSNP
rs141948638 482 dbSNP
rs990362124 483 dbSNP
rs1404761611 490 dbSNP
rs978800160 492 dbSNP
rs1032681274 496 dbSNP
rs540627370 501 dbSNP
rs560478732 502 dbSNP
rs928776665 503 dbSNP
rs534610866 507 dbSNP
rs922425621 509 dbSNP
rs1412033221 519 dbSNP
rs1405093514 520 dbSNP
rs933848437 521 dbSNP
rs1242790909 524 dbSNP
rs557423127 530 dbSNP
rs1202649197 531 dbSNP
rs1465014406 532 dbSNP
rs941904051 533 dbSNP
rs552876858 537 dbSNP
rs911098628 547 dbSNP
rs1202910656 552 dbSNP
rs1349302032 558 dbSNP
rs190340104 560 dbSNP
rs1246115467 567 dbSNP
rs1313286689 569 dbSNP
rs1385455143 569 dbSNP
rs1038106017 570 dbSNP
rs1452369415 572 dbSNP
rs1389737925 575 dbSNP
rs897649392 577 dbSNP
rs933191286 582 dbSNP
rs899200616 586 dbSNP
rs1051947727 589 dbSNP
rs945153074 592 dbSNP
rs1473702022 595 dbSNP
rs1383156414 599 dbSNP
rs1182825956 600 dbSNP
rs929364488 603 dbSNP
rs1249560236 607 dbSNP
rs1047869302 608 dbSNP
rs895922779 611 dbSNP
rs374406501 613 dbSNP
rs1289899375 617 dbSNP
rs1210963094 623 dbSNP
rs1023142427 624 dbSNP
rs1053344613 627 dbSNP
rs1245766941 630 dbSNP
rs1366343736 637 dbSNP
rs893489852 638 dbSNP
rs550445196 639 dbSNP
rs1020520411 645 dbSNP
rs906069908 650 dbSNP
rs1000491738 657 dbSNP
rs759002207 658 dbSNP
rs1036278659 666 dbSNP
rs1391743785 674 dbSNP
rs1474838927 675 dbSNP
rs1351333250 676 dbSNP
rs1200445692 685 dbSNP
rs1032630332 686 dbSNP
rs955734370 687 dbSNP
rs1343350039 689 dbSNP
rs988499928 692 dbSNP
rs1213027482 694 dbSNP
rs1339053072 695 dbSNP
rs1195638981 697 dbSNP
rs1235894937 698 dbSNP
rs144338079 699 dbSNP
rs1343683405 700 dbSNP
rs535899541 701 dbSNP
rs1410305570 708 dbSNP
rs985661136 709 dbSNP
rs1260317413 722 dbSNP
rs1356068912 730 dbSNP
rs771571591 733 dbSNP
rs911099406 734 dbSNP
rs1168140985 743 dbSNP
rs1409143487 744 dbSNP
rs1425492837 746 dbSNP
rs941269474 749 dbSNP
rs971955869 751 dbSNP
rs974047101 755 dbSNP
rs1184517560 757 dbSNP
rs919220014 761 dbSNP
rs920577040 766 dbSNP
rs1235095426 768 dbSNP
rs1202933794 778 dbSNP
rs1437585877 779 dbSNP
rs578223306 783 dbSNP
rs929269596 783 dbSNP
rs1047774235 784 dbSNP
rs1225536654 786 dbSNP
rs10136874 790 dbSNP
rs1229079533 791 dbSNP
rs1375518635 794 dbSNP
rs566094327 806 dbSNP
rs1360572658 807 dbSNP
rs910377680 809 dbSNP
rs1338323204 812 dbSNP
rs760299723 822 dbSNP
rs796333817 825 dbSNP
rs1331821371 834 dbSNP
rs370771448 835 dbSNP
rs764490009 837 dbSNP
rs1420335745 842 dbSNP
rs1410861971 847 dbSNP
rs1339458023 854 dbSNP
rs1469972837 863 dbSNP
rs1448487239 869 dbSNP
rs866005531 869 dbSNP
rs543795801 872 dbSNP
rs1053477871 878 dbSNP
rs1262736814 883 dbSNP
rs1209496167 888 dbSNP
rs893457310 890 dbSNP
rs906065542 891 dbSNP
rs1000841163 892 dbSNP
rs1309835555 893 dbSNP
rs1054658497 896 dbSNP
rs558791681 898 dbSNP
rs1316814247 915 dbSNP
rs1009828257 916 dbSNP
rs1450173469 917 dbSNP
rs1404970922 922 dbSNP
rs575381039 930 dbSNP
rs151168971 931 dbSNP
rs1454929300 938 dbSNP
rs903402870 951 dbSNP
rs554810707 957 dbSNP
rs1035840695 961 dbSNP
rs1006677091 963 dbSNP
rs1443141765 966 dbSNP
rs879578437 973 dbSNP
rs1012993904 976 dbSNP
rs1438426129 978 dbSNP
rs1178605272 979 dbSNP
rs1364833705 980 dbSNP
rs1470888734 983 dbSNP
rs1322330123 986 dbSNP
rs1170228405 987 dbSNP
rs1243557904 991 dbSNP
rs1381727420 993 dbSNP
rs911560863 994 dbSNP
rs574989414 997 dbSNP
rs1016380633 999 dbSNP
rs1338517008 1001 dbSNP
rs777051237 1002 dbSNP
rs972091719 1003 dbSNP
rs1165986857 1005 dbSNP
rs942990679 1007 dbSNP
rs1423165622 1014 dbSNP
rs1384950433 1015 dbSNP
rs540690218 1020 dbSNP
rs973923001 1022 dbSNP
rs954609801 1024 dbSNP
rs560495935 1027 dbSNP
rs141064723 1032 dbSNP
rs1490528925 1040 dbSNP
rs113652123 1043 dbSNP
rs762294487 1048 dbSNP
rs917293824 1049 dbSNP
rs1358496146 1055 dbSNP
rs1273136297 1058 dbSNP
rs546215316 1059 dbSNP
rs181563909 1060 dbSNP
rs765717940 1063 dbSNP
rs1265189638 1070 dbSNP
rs867936264 1076 dbSNP
rs1294380800 1077 dbSNP
rs1386883966 1093 dbSNP
rs1346801591 1094 dbSNP
rs1305509500 1107 dbSNP
rs1044514293 1111 dbSNP
rs531859501 1121 dbSNP
rs1251880936 1123 dbSNP
rs936157646 1124 dbSNP
rs1371610630 1133 dbSNP
rs1042018118 1134 dbSNP
rs750971133 1137 dbSNP
rs1196203195 1144 dbSNP
rs906210393 1145 dbSNP
rs773195722 1146 dbSNP
rs1376553846 1149 dbSNP
rs113247320 1165 dbSNP
rs1480583394 1177 dbSNP
rs1054564004 1183 dbSNP
rs1197397660 1185 dbSNP
rs1479517973 1188 dbSNP
rs1250443751 1191 dbSNP
rs1223692933 1194 dbSNP
rs1325087325 1206 dbSNP
rs1280730931 1240 dbSNP
rs938918586 1241 dbSNP
rs1178168898 1243 dbSNP
rs892010657 1252 dbSNP
rs548769092 1266 dbSNP
rs1308315943 1272 dbSNP
rs1393544750 1273 dbSNP
rs1174453815 1274 dbSNP
rs1195214955 1274 dbSNP
rs1364353556 1274 dbSNP
rs398057450 1274 dbSNP
rs749699811 1274 dbSNP
rs1420946219 1276 dbSNP
rs751272964 1276 dbSNP
rs1464910654 1277 dbSNP
rs35169376 1289 dbSNP
rs200609832 1290 dbSNP
rs562104017 1291 dbSNP
rs1384981127 1293 dbSNP
rs894624889 1297 dbSNP
rs1321710814 1298 dbSNP
rs1350733247 1302 dbSNP
rs373835347 1302 dbSNP
rs1013130932 1303 dbSNP
rs1405582345 1304 dbSNP
rs1453834158 1320 dbSNP
rs1385334898 1322 dbSNP
rs187088815 1325 dbSNP
rs1469382276 1326 dbSNP
rs1385698300 1329 dbSNP
rs1316228499 1330 dbSNP
rs192370862 1331 dbSNP
rs1451451175 1335 dbSNP
rs1363150360 1336 dbSNP
rs1184030280 1348 dbSNP
rs1007034317 1356 dbSNP
rs1018001522 1357 dbSNP
rs1446202048 1364 dbSNP
rs1252239959 1367 dbSNP
rs962790986 1371 dbSNP
rs993582825 1374 dbSNP
rs758494884 1376 dbSNP
rs1025485991 1384 dbSNP
rs1285680742 1387 dbSNP
rs538230428 1388 dbSNP
rs1490373878 1391 dbSNP
rs780056941 1392 dbSNP
rs552228299 1396 dbSNP
rs1247235832 1398 dbSNP
rs569129644 1400 dbSNP
rs537702203 1407 dbSNP
rs554758792 1411 dbSNP
rs568233126 1412 dbSNP
rs145787562 1414 dbSNP
rs1313216212 1417 dbSNP
rs184045435 1418 dbSNP
rs980528689 1419 dbSNP
rs1320444490 1432 dbSNP
rs1170940426 1433 dbSNP
rs1374549783 1434 dbSNP
rs1359874386 1448 dbSNP
rs755193657 1453 dbSNP
rs1426354994 1454 dbSNP
rs936092708 1458 dbSNP
rs1017980651 1464 dbSNP
rs990237246 1468 dbSNP
rs140727567 1469 dbSNP
rs1425391728 1476 dbSNP
rs1038982627 1477 dbSNP
rs1305032480 1481 dbSNP
rs749033047 1495 dbSNP
rs1051312393 1496 dbSNP
rs1296794805 1504 dbSNP
rs891392288 1506 dbSNP
rs942354379 1515 dbSNP
rs1265374175 1524 dbSNP
rs1039785854 1534 dbSNP
rs1228101373 1535 dbSNP
rs1340387364 1536 dbSNP
rs1272118023 1546 dbSNP
rs1360788797 1552 dbSNP
rs1225379932 1557 dbSNP
rs898204715 1571 dbSNP
rs995295553 1573 dbSNP
rs1025474536 1574 dbSNP
rs145864850 1583 dbSNP
rs75741145 1584 dbSNP
rs948956591 1585 dbSNP
rs1037832825 1589 dbSNP
rs1165763411 1590 dbSNP
rs1474807731 1593 dbSNP
rs1024868626 1599 dbSNP
rs1263340392 1599 dbSNP
rs751835934 1600 dbSNP
rs1429760754 1605 dbSNP
rs1267360192 1606 dbSNP
rs994745008 1607 dbSNP
rs1221355401 1609 dbSNP
rs1048060363 1615 dbSNP
rs1438716656 1617 dbSNP
rs1275415744 1618 dbSNP
rs1194253460 1619 dbSNP
rs1026842015 1622 dbSNP
rs1283934489 1623 dbSNP
rs890441424 1626 dbSNP
rs886267401 1627 dbSNP
rs1343626824 1628 dbSNP
rs1186496619 1632 dbSNP
rs1274158921 1633 dbSNP
rs1009348832 1635 dbSNP
rs1446357537 1636 dbSNP
rs1356021757 1640 dbSNP
rs1326459834 1645 dbSNP
rs1464717803 1646 dbSNP
rs576685168 1651 dbSNP
rs1406349596 1659 dbSNP
rs542126508 1667 dbSNP
rs989376134 1668 dbSNP
rs1034765174 1670 dbSNP
rs1358672072 1675 dbSNP
rs61991001 1683 dbSNP
rs1234905499 1689 dbSNP
rs1202703536 1691 dbSNP
rs1457540408 1695 dbSNP
rs1453100639 1696 dbSNP
rs1289694394 1697 dbSNP
rs1022056075 1700 dbSNP
rs561963642 1704 dbSNP
rs966545716 1710 dbSNP
rs990224330 1714 dbSNP
rs1375262438 1717 dbSNP
rs1387327272 1722 dbSNP
rs372529053 1724 dbSNP
rs539971899 1733 dbSNP
rs946198463 1734 dbSNP
rs1467799042 1736 dbSNP
rs1248764134 1742 dbSNP
rs1358020877 1743 dbSNP
rs987390602 1744 dbSNP
rs912780241 1746 dbSNP
rs990857263 1747 dbSNP
rs942949371 1748 dbSNP
rs1352363132 1756 dbSNP
rs1244021598 1758 dbSNP
rs1039370735 1759 dbSNP
rs916250992 1761 dbSNP
rs77474161 1762 dbSNP
rs1236909186 1766 dbSNP
rs1037970270 1768 dbSNP
rs1216584423 1768 dbSNP
rs1282037720 1770 dbSNP
rs1239203984 1772 dbSNP
rs1262129004 1774 dbSNP
rs931035966 1776 dbSNP
rs1316739134 1777 dbSNP
rs1482069027 1782 dbSNP
rs1046869970 1785 dbSNP
rs1377818979 1786 dbSNP
rs532056223 1789 dbSNP
rs886875881 1800 dbSNP
rs1243509310 1803 dbSNP
rs1347516859 1803 dbSNP
rs1024355120 1816 dbSNP
rs552153597 1819 dbSNP
rs1013395401 1820 dbSNP
rs568719254 1821 dbSNP
rs1159915462 1829 dbSNP
rs1047802644 1830 dbSNP
rs1187232918 1833 dbSNP
rs890504692 1837 dbSNP
rs905068185 1843 dbSNP
rs1490455116 1847 dbSNP
rs1464710019 1849 dbSNP
rs1293592161 1850 dbSNP
rs1038988581 1852 dbSNP
rs1320808063 1863 dbSNP
rs1002569011 1864 dbSNP
rs1010766032 1870 dbSNP
rs1359206307 1872 dbSNP
rs1407337473 1873 dbSNP
rs763879068 1874 dbSNP
rs966514386 1875 dbSNP
rs867242408 1878 dbSNP
rs1034867871 1879 dbSNP
rs1373157703 1880 dbSNP
rs1171343439 1881 dbSNP
rs1034344467 1884 dbSNP
rs1421496309 1887 dbSNP
rs753607103 1888 dbSNP
rs970051327 1889 dbSNP
rs1270950017 1893 dbSNP
rs187788198 1894 dbSNP
rs916219674 1899 dbSNP
rs1251563210 1901 dbSNP
rs1001464307 1902 dbSNP
rs1206126080 1907 dbSNP
rs1315548103 1910 dbSNP
rs1277092457 1913 dbSNP
rs1310126270 1916 dbSNP
rs962397922 1918 dbSNP
rs957393334 1921 dbSNP
rs973630721 1922 dbSNP
rs867323829 1924 dbSNP
rs73343664 1926 dbSNP
rs1462505681 1929 dbSNP
rs1020299536 1931 dbSNP
rs920884713 1936 dbSNP
rs1431412673 1944 dbSNP
rs929584929 1946 dbSNP
rs1432407201 1948 dbSNP
rs967445751 1952 dbSNP
rs986948199 1956 dbSNP
rs1257001660 1958 dbSNP
rs1237561909 1962 dbSNP
rs1480908957 1963 dbSNP
rs1203799244 1966 dbSNP
rs1177899407 1967 dbSNP
rs1321481879 1970 dbSNP
rs1231632060 1973 dbSNP
rs1292823358 1977 dbSNP
rs1330887520 1978 dbSNP
rs1032963231 1981 dbSNP
rs568296479 1982 dbSNP
rs1431469662 1984 dbSNP
rs867156995 1985 dbSNP
rs1408329291 1988 dbSNP
rs989075827 1992 dbSNP
rs1430174024 2001 dbSNP
rs1364297803 2005 dbSNP
rs1471164728 2006 dbSNP
rs1168980467 2007 dbSNP
rs1237220573 2012 dbSNP
rs1354530094 2015 dbSNP
rs1253375016 2019 dbSNP
rs1199380829 2025 dbSNP
rs1443534513 2028 dbSNP
rs1344997807 2032 dbSNP
rs1299428749 2038 dbSNP
rs1261806247 2045 dbSNP
rs1242823815 2049 dbSNP
rs1351916900 2051 dbSNP
rs1308832933 2052 dbSNP
rs913396619 2061 dbSNP
rs1364922026 2062 dbSNP
rs1453579341 2062 dbSNP
rs1403745320 2063 dbSNP
rs1283545561 2068 dbSNP
rs1332352940 2070 dbSNP
rs867524865 2073 dbSNP
rs1385629436 2074 dbSNP
rs955526045 2080 dbSNP
rs1271993420 2083 dbSNP
rs1379387625 2083 dbSNP
rs1308043856 2085 dbSNP
rs1366336216 2090 dbSNP
rs1206576513 2095 dbSNP
rs1447051818 2096 dbSNP
rs1263088673 2097 dbSNP
rs1219368316 2100 dbSNP
rs1487520363 2102 dbSNP
rs1244858995 2103 dbSNP
rs1487553545 2110 dbSNP
rs1247170493 2123 dbSNP
rs987643134 2127 dbSNP
rs1282611147 2128 dbSNP
rs911613142 2131 dbSNP
rs1244196755 2132 dbSNP
rs1327048259 2136 dbSNP
rs1481534829 2137 dbSNP
rs1299973929 2140 dbSNP
rs1397992421 2144 dbSNP
rs1359817182 2145 dbSNP
rs1303594498 2147 dbSNP
rs1406859534 2149 dbSNP
rs943087280 2150 dbSNP
rs1162243413 2164 dbSNP
rs533964506 2167 dbSNP
rs1192014630 2171 dbSNP
rs1196475164 2171 dbSNP
rs1374236679 2171 dbSNP
rs1477167715 2173 dbSNP
rs1263087484 2180 dbSNP
rs1223741627 2181 dbSNP
rs1453642947 2182 dbSNP
rs1288019264 2183 dbSNP
rs1209403934 2186 dbSNP
rs1280247306 2187 dbSNP
rs1339812651 2194 dbSNP
rs1419215015 2195 dbSNP
rs1438388495 2196 dbSNP
rs920254320 2196 dbSNP
rs1173196580 2199 dbSNP
rs1048324505 2205 dbSNP
rs1322490478 2206 dbSNP
rs554352697 2207 dbSNP
rs1423460866 2211 dbSNP
rs1402020692 2213 dbSNP
rs1303211843 2215 dbSNP
rs1347058010 2216 dbSNP
rs1464619254 2218 dbSNP
rs1423580610 2226 dbSNP
rs1200719883 2235 dbSNP
rs1479216630 2236 dbSNP
rs1245274875 2238 dbSNP
rs1198587731 2241 dbSNP
rs930589493 2242 dbSNP
rs1269185767 2247 dbSNP
rs1196875537 2249 dbSNP
rs1317334868 2252 dbSNP
rs1263707017 2253 dbSNP
rs912084170 2263 dbSNP
rs1365232020 2268 dbSNP
rs570959125 2269 dbSNP
rs1216045741 2270 dbSNP
rs866537417 2271 dbSNP
rs1442648731 2272 dbSNP
rs1287646403 2273 dbSNP
rs1358639122 2276 dbSNP
rs1039124730 2286 dbSNP
rs912762733 2290 dbSNP
rs964321048 2300 dbSNP
rs900493768 2301 dbSNP
rs1010901603 2303 dbSNP
rs976100488 2304 dbSNP
rs1423664544 2314 dbSNP
rs1043617403 2315 dbSNP
rs902394404 2317 dbSNP
rs539505324 2326 dbSNP
rs919572809 2329 dbSNP
rs1035241274 2330 dbSNP
rs960582544 2335 dbSNP
rs1011988701 2340 dbSNP
rs1277804216 2344 dbSNP
rs930941875 2345 dbSNP
rs1355523402 2348 dbSNP
rs1475955265 2348 dbSNP
rs1023411167 2355 dbSNP
rs1383061034 2360 dbSNP
rs1304132946 2364 dbSNP
rs1357965996 2367 dbSNP
rs1445139203 2367 dbSNP
rs962366157 2382 dbSNP
rs1420721323 2387 dbSNP
rs1382497173 2388 dbSNP
rs1046777376 2389 dbSNP
rs757160557 2390 dbSNP
rs1025320325 2399 dbSNP
rs1482301130 2399 dbSNP
rs1236855733 2401 dbSNP
rs1216337198 2405 dbSNP
rs1489150770 2410 dbSNP
rs745816093 2413 dbSNP
rs951011589 2419 dbSNP
rs1188588130 2421 dbSNP
rs771555164 2429 dbSNP
rs190025142 2430 dbSNP
rs556533761 2431 dbSNP
rs1226147076 2433 dbSNP
rs138250749 2434 dbSNP
rs1366927349 2443 dbSNP
rs542541279 2454 dbSNP
rs905057955 2457 dbSNP
rs1002110283 2462 dbSNP
rs1054089709 2466 dbSNP
rs893740185 2467 dbSNP
rs1419460305 2470 dbSNP
rs796900926 2477 dbSNP
rs1350728776 2480 dbSNP
rs545404890 2482 dbSNP
rs1432714950 2485 dbSNP
rs555627159 2488 dbSNP
rs1047608081 2489 dbSNP
rs1246584286 2495 dbSNP
rs1317026339 2502 dbSNP
rs1361713607 2503 dbSNP
rs1011500120 2507 dbSNP
rs946809328 2508 dbSNP
rs372215581 2513 dbSNP
rs1447797693 2514 dbSNP
rs1218439841 2515 dbSNP
rs1043668168 2517 dbSNP
rs541225377 2527 dbSNP
rs76153811 2528 dbSNP
rs1019767688 2540 dbSNP
rs114316313 2543 dbSNP
rs545546979 2548 dbSNP
rs1276824970 2550 dbSNP
rs975625244 2550 dbSNP
rs867512512 2551 dbSNP
rs1399817310 2559 dbSNP
rs896288718 2560 dbSNP
rs1295507241 2563 dbSNP
rs1456640877 2567 dbSNP
rs1349499067 2570 dbSNP
rs1171535956 2574 dbSNP
rs1467219811 2575 dbSNP
rs920146530 2578 dbSNP
rs1437279843 2582 dbSNP
rs1157476847 2584 dbSNP
rs1433573077 2586 dbSNP
rs79095882 2591 dbSNP
rs1402064877 2595 dbSNP
rs1023380153 2603 dbSNP
rs898210267 2603 dbSNP
rs1258282988 2608 dbSNP
rs995275734 2609 dbSNP
rs1256730727 2611 dbSNP
rs776381286 2611 dbSNP
rs531192489 2612 dbSNP
rs908245038 2617 dbSNP
rs760725662 2618 dbSNP
rs548542793 2619 dbSNP
rs949154209 2622 dbSNP
rs1374488152 2623 dbSNP
rs1046598682 2626 dbSNP
rs922104986 2629 dbSNP
rs946778125 2630 dbSNP
rs926412964 2635 dbSNP
rs1279008688 2639 dbSNP
rs937815770 2641 dbSNP
rs923922143 2643 dbSNP
rs1053560506 2650 dbSNP
rs1351719236 2661 dbSNP
rs1456070616 2664 dbSNP
rs549837790 2664 dbSNP
rs1200515986 2665 dbSNP
rs762206518 2678 dbSNP
rs1258252742 2679 dbSNP
rs1056781236 2684 dbSNP
rs896435210 2687 dbSNP
rs1242503731 2690 dbSNP
rs1374951337 2692 dbSNP
rs765711006 2695 dbSNP
rs1041692549 2705 dbSNP
rs773843618 2706 dbSNP
rs540978406 2707 dbSNP
rs1300973582 2712 dbSNP
rs1008294675 2718 dbSNP
rs569964482 2725 dbSNP
rs568358157 2726 dbSNP
rs1437494870 2727 dbSNP
rs1025416307 2733 dbSNP
rs1187688104 2738 dbSNP
rs1470857211 2740 dbSNP
rs1173841459 2743 dbSNP
rs1020091982 2746 dbSNP
rs56329822 2748 dbSNP
rs182634675 2749 dbSNP
rs529142731 2754 dbSNP
rs1219232103 2762 dbSNP
rs187195759 2766 dbSNP
rs952935007 2767 dbSNP
rs996402113 2770 dbSNP
rs1029088934 2772 dbSNP
rs1398102152 2787 dbSNP
rs1414162426 2795 dbSNP
rs1361070991 2801 dbSNP
rs751638532 2802 dbSNP
rs1015254087 2803 dbSNP
rs970778226 2804 dbSNP
rs924086756 2806 dbSNP
rs755106790 2809 dbSNP
rs926334208 2810 dbSNP
rs937780855 2815 dbSNP
rs989271599 2816 dbSNP
rs915110814 2820 dbSNP
rs945283022 2821 dbSNP
rs1224569320 2824 dbSNP
rs1196348612 2834 dbSNP
rs549989002 2846 dbSNP
rs565785055 2847 dbSNP
rs1338063025 2857 dbSNP
rs1358729681 2860 dbSNP
rs1195764482 2863 dbSNP
rs1263815478 2864 dbSNP
rs1232724581 2865 dbSNP
rs1341093993 2875 dbSNP
rs944007208 2879 dbSNP
rs534393012 2884 dbSNP
rs899876353 2885 dbSNP
rs919741747 2888 dbSNP
rs557817501 2892 dbSNP
rs1406805532 2897 dbSNP
rs1196568772 2901 dbSNP
rs1267822128 2902 dbSNP
rs1162181265 2903 dbSNP
rs191955291 2911 dbSNP
rs888644803 2912 dbSNP
rs1241826135 2920 dbSNP
rs1004448425 2921 dbSNP
rs1371155787 2927 dbSNP
rs571183127 2928 dbSNP
rs1015826817 2943 dbSNP
rs1047244214 2944 dbSNP
rs886828731 2952 dbSNP
rs1461249169 2953 dbSNP
rs1259928973 2954 dbSNP
rs1168435100 2955 dbSNP
rs1008396272 2957 dbSNP
rs1040690565 2958 dbSNP
rs899520640 2958 dbSNP
rs1329035154 2960 dbSNP
rs756985059 2961 dbSNP
rs113744506 2962 dbSNP
rs1033392646 2964 dbSNP
rs368936271 2966 dbSNP
rs956791826 2967 dbSNP
rs876374 2971 dbSNP
rs185368111 2976 dbSNP
rs534947214 2978 dbSNP
rs915058652 2990 dbSNP
rs557945984 2994 dbSNP
rs142740841 2995 dbSNP
rs1227078384 2997 dbSNP
rs977906706 2999 dbSNP
rs188638712 3000 dbSNP
rs1555406 3003 dbSNP
rs576033516 3007 dbSNP
rs117617949 3008 dbSNP
rs932707558 3009 dbSNP
rs1048532455 3012 dbSNP
rs1224275594 3015 dbSNP
rs1259155106 3017 dbSNP
rs888547116 3031 dbSNP
rs1427703727 3038 dbSNP
rs1193626777 3042 dbSNP
rs899489552 3044 dbSNP
rs1442674087 3046 dbSNP
rs868654564 3048 dbSNP
rs1382383764 3049 dbSNP
rs1175598341 3059 dbSNP
rs1015768599 3065 dbSNP
rs1161797792 3066 dbSNP
rs906778131 3071 dbSNP
rs1227366438 3079 dbSNP
rs1212083544 3081 dbSNP
rs1440493238 3083 dbSNP
rs1279430758 3084 dbSNP
rs1217053496 3086 dbSNP
rs876375 3087 dbSNP
rs1033751266 3088 dbSNP
rs904077839 3091 dbSNP
rs1001525416 3094 dbSNP
rs1306574096 3095 dbSNP
rs959055649 3102 dbSNP
rs1425325232 3107 dbSNP
rs773818149 3115 dbSNP
rs747870667 3122 dbSNP
rs527597715 3131 dbSNP
rs892658401 3132 dbSNP
rs531814177 3135 dbSNP
rs1013655886 3139 dbSNP
rs547683302 3140 dbSNP
rs1319378576 3144 dbSNP
rs1328759489 3150 dbSNP
rs966440170 3151 dbSNP
rs977854919 3155 dbSNP
rs1183669925 3157 dbSNP
rs980733959 3161 dbSNP
rs1026991335 3171 dbSNP
rs1194152974 3172 dbSNP
rs564330619 3176 dbSNP
rs1214549002 3178 dbSNP
rs770281479 3182 dbSNP
rs1321944535 3188 dbSNP
rs911767970 3191 dbSNP
rs143313277 3192 dbSNP
rs943892763 3204 dbSNP
rs550292411 3207 dbSNP
rs1359548245 3209 dbSNP
rs1247443653 3226 dbSNP
rs976468970 3228 dbSNP
rs921044310 3229 dbSNP
rs974713819 3233 dbSNP
rs570050782 3237 dbSNP
rs1042661062 3238 dbSNP
rs1485331875 3243 dbSNP
rs763436220 3246 dbSNP
rs193236672 3247 dbSNP
rs1417104512 3249 dbSNP
rs1048435969 3251 dbSNP
rs1478682633 3252 dbSNP
rs1053142403 3264 dbSNP
rs185661579 3265 dbSNP
rs1182936504 3277 dbSNP
rs940128941 3278 dbSNP
rs1385726398 3281 dbSNP
rs1185698377 3282 dbSNP
rs1445321501 3283 dbSNP
rs1488630206 3287 dbSNP
rs892635245 3293 dbSNP
rs1211316373 3304 dbSNP
rs1333461861 3308 dbSNP
rs1166998409 3317 dbSNP
rs1362340560 3320 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Andersen DC; Jensen CH; Schneider M; et al.
- Experimental cell research, 2010
Delta like 1 homolog (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal; however, little is known about the underlying mechanisms. We here report that miR-15a modulates DLK1 levels in preadipocytes thus providing a mechanism for DLK1 regulation that further links it to cell cycle arrest and cancer since miR-15a is deregulated in these processes. In preadipocytes, miR-15a increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct repression of DLK1 and a parallel effect on the protease that cleaves off the DLK1 from the membrane. In agreement with previous studies, we found that miR-15a represses cell numbers, but additionally, we report that miR-15a also increases cell size. Conversely, anti-miR-15a treatment decreases cell size while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling networks.
LinkOut: [PMID: 20385127]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.355 2.0e-3 -0.446 1.1e-4 64 Click to see details
GSE32688 Pancreatic cancer -0.44 5.9e-3 -0.042 4.1e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.285 8.4e-2 0.110 3.0e-1 25 Click to see details
GSE28260 Renal cortex and medulla 0.406 8.4e-2 0.412 8.1e-2 13 Click to see details
GSE21032 Prostate cancer -0.15 8.8e-2 -0.112 1.6e-1 83 Click to see details
GSE19350 CNS germ cell tumors 0.354 1.3e-1 0.287 1.8e-1 12 Click to see details
GSE19536 Breast cancer -0.102 1.6e-1 -0.214 1.6e-2 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.224 1.7e-1 -0.143 2.7e-1 20 Click to see details
GSE28544 Breast cancer 0.186 1.9e-1 0.180 2.0e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.17 2.2e-1 0.188 2.0e-1 23 Click to see details
GSE17498 Multiple myeloma 0.115 2.4e-1 0.139 2.0e-1 40 Click to see details
GSE27834 Pluripotent stem cells -0.174 2.6e-1 -0.232 1.9e-1 16 Click to see details
GSE19783 ER- ER- breast cancer -0.068 2.8e-1 -0.139 1.1e-1 79 Click to see details
GSE38226 Liver fibrosis -0.1 3.3e-1 -0.336 6.8e-2 21 Click to see details
GSE17306 Multiple myeloma 0.041 3.9e-1 0.032 4.1e-1 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.062 4.0e-1 -0.290 1.1e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.018 4.3e-1 0.007 4.7e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.035 4.4e-1 -0.105 3.1e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.02 4.6e-1 0.122 2.8e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.02 4.6e-1 0.122 2.8e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.02 4.6e-1 0.122 2.8e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.391 0 -0.271 0.03 50 Click to see details
HNSC -0.417 0 -0.424 0 42 Click to see details
STAD -0.471 0 -0.518 0 32 Click to see details
LUSC 0.36 0.01 0.362 0.01 38 Click to see details
KIRC 0.236 0.03 0.240 0.02 68 Click to see details
PAAD -0.912 0.04 -0.800 0.1 4 Click to see details
CESC -0.966 0.08 -1.000 0.5 3 Click to see details
ESCA 0.418 0.1 0.536 0.04 11 Click to see details
CHOL -0.409 0.14 -0.683 0.02 9 Click to see details
LUAD -0.315 0.16 -0.308 0.17 12 Click to see details
KIRP 0.179 0.16 0.162 0.19 32 Click to see details
BRCA 0.104 0.17 0.024 0.41 84 Click to see details
BLCA -0.195 0.22 -0.154 0.27 18 Click to see details
LIHC 0.103 0.24 0.089 0.27 49 Click to see details
THCA -0.059 0.33 0.130 0.16 59 Click to see details
COAD 0.133 0.38 0.024 0.48 8 Click to see details
PCPG -0.357 0.38 -0.500 0.33 3 Click to see details
UCEC 0.043 0.43 0.125 0.31 19 Click to see details
KICH 0.015 0.47 0.056 0.4 25 Click to see details
KICH 0.015 0.47 0.056 0.4 25 Click to see details
KICH 0.015 0.47 0.056 0.4 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7