miRTarBase - #MIRT051311 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLA2G2D   
Synonyms PLA2IID, SPLASH, sPLA2-IID, sPLA2S
Description phospholipase A2 group IID
Transcript NM_012400   
Expression
Putative miRNA Targets on PLA2G2D
3'UTR of PLA2G2D
(miRNA target sites are highlighted)
>PLA2G2D|NM_012400|3'UTR
   1 AAGCCCACACCCTCTACCCTGTTCCTCAGCATGGAGCTCTGGCATCCCCACCTCAGTATCTAACCTGAACCAGCCTGGCT
  81 TTTCAAACACTCCGGGGGGAGGTAGTCCCAGCCTCCCCCGGAACCCTCTACCAATGCCTTCTGACCTTCTGAAGCTTTCC
 161 GAATCCTCCCAGTTGAGGCAGTAGCTGTGTCCTCTGAGGGTGGATGGGAATCTTGGGAGAAGCCCAAGCAAGGGAGCCCT
 241 CAGAGGTGGTGTTTGGACCAAAGCATCGGGGTGGGGGAGGGGTCTGCCGCTGTCCCCCACCTGCTGGCCCCCTTGTCCTT
 321 CCTCACCCCCTCCAATATAGTCTCGGAGCTACAACCGCAGCAGCCACTATAAAGGGCAATATTGATCTTTCTGTCCATGT
 401 GGCTCTATCTTTTAAAACCTCAAGGCCCTCCACTGTCCTAAGATAAAGCCTCTCATAGGCACTGGGGACCCTGCACAGTC
 481 TGGCCATGTGACCCTCTCCCCAGGCAAGCTCTGAAGTCCCTGCAGGTGGAGGCCATGCCTGTCTTAAACTCAGTTGCATC
 561 CCTGGTGCCCAAAGCAACACCAGAACCAAGAAGGAGCTCCATAAATCCTTCTTGGGTGAAGCCTAGACAAAGCCGCCAGG
 641 TCTTGTGGCTCCAGGCACCAGAGCCTTGAGTACTTTCTCCTGCCTCCAGGCATTGGCTCAGGGTGAATTACAAGGGGCTA
 721 CTGAATGGCTATTACTTTCATCACGACTGATCCCCACCTCCTCAGGGTCAAAGGGCTACTTTCTGGAAGTCTCCCCAGGC
 801 TGACTCCTTCTCCCTGACTGCAAGGGCTCACTCCCTCCTCCAAGCTCCCACAATGCTTCATGGCTCTGCCGCTTACCTAG
 881 CTTGGCCTAGAGTGGCAAATGGAACTTCTCTGATCTCCCCCAACTAGACTGGAGCCCCCGAAGGATGGAGACCATGTCTG
 961 TGCCATCTCTGTTTCCCCTGTTTTCCCACATACTAGGTGCTCAATTCATGCCTGTGAATGGCGTGAGCCCATAATGGATA
1041 CACAGAGGTTGCAGCAGATGGTGTGGGTACCTCACCCAGATATCATCCAGGCCCAAGGCCCCTCTCCCTGAGTGAGGCCA
1121 GGTGTTGGCAGCCAACTGCTCCAATCTGCCTCCTTCCCCTAAATACTGCCCTGGTCTAGTGGGAGCTGCCTTCCCCCTGC
1201 CCCACCTCTCCCACCAAGAGGCCACCTGTCACTCATGGCCAGGAGAGTGACACCATGGAGGGTACAATTGCCAGCTCCCC
1281 CGTGTCTGTGCAGGATTGTCTGGGTTGAATGACACTCTCAAATTGTTCCTGGGATCGGGCTGAGGCCAGGCCTCTCCTGG
1361 AACCACCTCTCTGCTTGGTCTGACCCCTTGGCCTATCCAGTTTTCCTGGTTCCCTCACAGGTTTCTCCAGAAAGTACTCC
1441 CTCAGTAAAGCATTTGCACAAGAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUAC----ACGACGAu 5'
            |||  | | |||    ||| ||| 
Target 5' caCAATGCTTCATGGCTCTGCCGCTt 3'
849 - 874 122.00 -10.20
2
miRNA  3' guguuugguaaUACACGACGAu 5'
                     :| ||| ||| 
Target 5' gtgggggagggGTCTGCCGCTg 3'
271 - 292 111.00 -10.40
3
miRNA  3' gugUUUGGUA--AUACACGACGAu 5'
             :|:|| |   | ||| ||:| 
Target 5' aggGAGCCCTCAGAGGTGGTGTTt 3'
231 - 254 105.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30448933 24 COSMIC
COSN30147712 27 COSMIC
COSN30478285 33 COSMIC
COSN2531294 34 COSMIC
COSN30472765 52 COSMIC
COSN30471650 93 COSMIC
COSN30476295 96 COSMIC
COSN30476278 97 COSMIC
COSN30449791 159 COSMIC
COSN31567973 161 COSMIC
COSN17321337 267 COSMIC
COSN7198919 939 COSMIC
COSN4747241 975 COSMIC
COSN17671800 1249 COSMIC
COSN8429408 1383 COSMIC
COSN19179469 1431 COSMIC
COSN26610360 1607 COSMIC
COSN8429407 1694 COSMIC
COSN8429406 1698 COSMIC
COSN22290739 1753 COSMIC
COSN9057198 1765 COSMIC
COSN25427253 1832 COSMIC
COSN25722498 2040 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1190905902 2 dbSNP
rs777235085 3 dbSNP
rs769019431 7 dbSNP
rs1264591462 8 dbSNP
rs747170739 9 dbSNP
rs1445422916 10 dbSNP
rs62541902 11 dbSNP
rs1201194556 21 dbSNP
rs772074739 27 dbSNP
rs1260965787 31 dbSNP
rs912207075 32 dbSNP
rs746103648 46 dbSNP
rs1202724359 47 dbSNP
rs779059382 48 dbSNP
rs373127263 51 dbSNP
rs368897965 55 dbSNP
rs986523580 56 dbSNP
rs1230322976 58 dbSNP
rs1348775212 74 dbSNP
rs545383125 75 dbSNP
rs1288268201 76 dbSNP
rs577947420 79 dbSNP
rs138526396 93 dbSNP
rs534957481 94 dbSNP
rs972178897 95 dbSNP
rs963533840 96 dbSNP
rs1016261115 99 dbSNP
rs1318527567 100 dbSNP
rs1409215573 102 dbSNP
rs1044321219 109 dbSNP
rs1480749086 115 dbSNP
rs1248187808 117 dbSNP
rs573898014 124 dbSNP
rs949926710 125 dbSNP
rs555499764 127 dbSNP
rs1002704846 133 dbSNP
rs1451197350 137 dbSNP
rs3767232 146 dbSNP
rs1410544253 150 dbSNP
rs916935366 160 dbSNP
rs969532143 161 dbSNP
rs1025392114 172 dbSNP
rs1013610134 173 dbSNP
rs62541904 182 dbSNP
rs1385983127 187 dbSNP
rs1185472874 199 dbSNP
rs569726677 203 dbSNP
rs1241774476 216 dbSNP
rs1370404020 219 dbSNP
rs752782755 222 dbSNP
rs925723469 238 dbSNP
rs1327447763 247 dbSNP
rs186605964 249 dbSNP
rs1216700344 258 dbSNP
rs1436876262 263 dbSNP
rs979372898 267 dbSNP
rs964892153 268 dbSNP
rs903696586 271 dbSNP
rs576528514 273 dbSNP
rs1427202066 275 dbSNP
rs553205578 279 dbSNP
rs942442355 281 dbSNP
rs1190731293 288 dbSNP
rs62541905 289 dbSNP
rs1247451895 290 dbSNP
rs1051190277 292 dbSNP
rs987698748 296 dbSNP
rs56009438 302 dbSNP
rs919489134 303 dbSNP
rs1317018369 305 dbSNP
rs878949773 325 dbSNP
rs755465051 326 dbSNP
rs1360585616 327 dbSNP
rs1319221378 328 dbSNP
rs972293445 333 dbSNP
rs56070498 335 dbSNP
rs1332081061 340 dbSNP
rs909375419 344 dbSNP
rs1005822676 345 dbSNP
rs41264131 356 dbSNP
rs1044223486 357 dbSNP
rs1203952361 360 dbSNP
rs969858401 369 dbSNP
rs761151082 377 dbSNP
rs1025085618 382 dbSNP
rs750002332 388 dbSNP
rs949958343 394 dbSNP
rs956709686 396 dbSNP
rs62541909 400 dbSNP
rs1000777142 406 dbSNP
rs1209999642 409 dbSNP
rs903812648 411 dbSNP
rs1018507401 420 dbSNP
rs895698724 424 dbSNP
rs1226652176 425 dbSNP
rs1006755456 432 dbSNP
rs890843279 434 dbSNP
rs1228575218 455 dbSNP
rs549942561 457 dbSNP
rs929607585 467 dbSNP
rs1281947275 469 dbSNP
rs1447148415 476 dbSNP
rs1371094488 493 dbSNP
rs1309562772 494 dbSNP
rs1427565290 497 dbSNP
rs767280525 506 dbSNP
rs530955031 508 dbSNP
rs925720910 516 dbSNP
rs1266576495 522 dbSNP
rs575949084 523 dbSNP
rs563781726 524 dbSNP
rs1411653455 527 dbSNP
rs1181381783 532 dbSNP
rs1254609304 538 dbSNP
rs1203721325 541 dbSNP
rs1490441852 543 dbSNP
rs943097402 545 dbSNP
rs1221789930 554 dbSNP
rs1202282777 558 dbSNP
rs41264129 566 dbSNP
rs987565441 567 dbSNP
rs62541911 571 dbSNP
rs147591150 580 dbSNP
rs909488919 594 dbSNP
rs1343230141 595 dbSNP
rs981334440 596 dbSNP
rs1349627155 597 dbSNP
rs1293914975 612 dbSNP
rs1282189883 628 dbSNP
rs1348359893 629 dbSNP
rs948259469 634 dbSNP
rs577632734 635 dbSNP
rs917970013 647 dbSNP
rs1472566784 652 dbSNP
rs559273858 654 dbSNP
rs1268446543 658 dbSNP
rs1193292030 659 dbSNP
rs1354053084 661 dbSNP
rs1263303007 670 dbSNP
rs956809420 679 dbSNP
rs1031006150 680 dbSNP
rs1467209751 684 dbSNP
rs1427504769 689 dbSNP
rs1328426410 690 dbSNP
rs1301632137 691 dbSNP
rs1388308065 693 dbSNP
rs1198891632 701 dbSNP
rs1293132126 713 dbSNP
rs541333653 715 dbSNP
rs1436158106 717 dbSNP
rs979452420 727 dbSNP
rs972507383 729 dbSNP
rs1157081252 730 dbSNP
rs182279292 731 dbSNP
rs773984586 740 dbSNP
rs369930166 744 dbSNP
rs1007114311 745 dbSNP
rs890966846 753 dbSNP
rs1029794649 754 dbSNP
rs1465082409 757 dbSNP
rs145080836 761 dbSNP
rs1249302692 764 dbSNP
rs1206286162 767 dbSNP
rs1349793657 786 dbSNP
rs993867975 791 dbSNP
rs1256501271 795 dbSNP
rs896946886 798 dbSNP
rs1037981027 812 dbSNP
rs1005202941 815 dbSNP
rs1302443065 817 dbSNP
rs905244599 826 dbSNP
rs1367631656 827 dbSNP
rs537626759 829 dbSNP
rs1318561605 830 dbSNP
rs1434450998 834 dbSNP
rs1403090745 841 dbSNP
rs887997072 853 dbSNP
rs1465023827 854 dbSNP
rs1014095599 856 dbSNP
rs576088268 857 dbSNP
rs190396502 862 dbSNP
rs62541912 866 dbSNP
rs1186343973 868 dbSNP
rs1445911747 869 dbSNP
rs1056686761 870 dbSNP
rs377060892 871 dbSNP
rs1279258177 880 dbSNP
rs62541913 886 dbSNP
rs1344123657 895 dbSNP
rs762763771 896 dbSNP
rs924052129 908 dbSNP
rs1227022922 911 dbSNP
rs775543893 918 dbSNP
rs553764571 923 dbSNP
rs535792509 924 dbSNP
rs968095854 927 dbSNP
rs755245807 932 dbSNP
rs1324804764 933 dbSNP
rs1402123736 934 dbSNP
rs1308952821 939 dbSNP
rs985405265 939 dbSNP
rs753936832 940 dbSNP
rs1166309610 944 dbSNP
rs1474891370 948 dbSNP
rs1303823203 949 dbSNP
rs955504966 955 dbSNP
rs1029493105 956 dbSNP
rs1189025361 971 dbSNP
rs1421931172 976 dbSNP
rs993984010 995 dbSNP
rs1256707532 997 dbSNP
rs1390218283 1000 dbSNP
rs1483897386 1004 dbSNP
rs1272269434 1015 dbSNP
rs961097641 1022 dbSNP
rs536753484 1023 dbSNP
rs1267224351 1026 dbSNP
rs183539696 1036 dbSNP
rs1005150784 1044 dbSNP
rs1403930394 1048 dbSNP
rs549738027 1051 dbSNP
rs933481341 1052 dbSNP
rs919526717 1055 dbSNP
rs1348966810 1056 dbSNP
rs1176048319 1070 dbSNP
rs578459 1085 dbSNP
rs1379191513 1091 dbSNP
rs1455934190 1103 dbSNP
rs1045690263 1107 dbSNP
rs1182787705 1108 dbSNP
rs1418238572 1122 dbSNP
rs963936907 1126 dbSNP
rs1452343449 1136 dbSNP
rs559067477 1139 dbSNP
rs980731986 1144 dbSNP
rs969502985 1158 dbSNP
rs1268875734 1159 dbSNP
rs1180356355 1166 dbSNP
rs1230732546 1172 dbSNP
rs551854829 1177 dbSNP
rs1327707280 1180 dbSNP
rs376772271 1182 dbSNP
rs1437618609 1191 dbSNP
rs1333261954 1193 dbSNP
rs1056634007 1194 dbSNP
rs1203952754 1198 dbSNP
rs554516836 1202 dbSNP
rs935501079 1206 dbSNP
rs1462361508 1207 dbSNP
rs191731124 1218 dbSNP
rs1159294571 1249 dbSNP
rs1237377946 1249 dbSNP
rs1405715306 1254 dbSNP
rs1043837999 1258 dbSNP
rs62541914 1265 dbSNP
rs911220065 1268 dbSNP
rs1308359279 1270 dbSNP
rs1196995146 1278 dbSNP
rs1468230065 1279 dbSNP
rs529567392 1281 dbSNP
rs1242938708 1282 dbSNP
rs1210687109 1284 dbSNP
rs1463645373 1286 dbSNP
rs998794709 1288 dbSNP
rs617180 1294 dbSNP
rs543721274 1297 dbSNP
rs576597364 1299 dbSNP
rs558024173 1311 dbSNP
rs1287291153 1316 dbSNP
rs1452794082 1317 dbSNP
rs1369790780 1319 dbSNP
rs545925874 1325 dbSNP
rs888898869 1336 dbSNP
rs62541917 1337 dbSNP
rs1317513290 1339 dbSNP
rs1415019472 1342 dbSNP
rs1426962780 1343 dbSNP
rs58928085 1344 dbSNP
rs1016600220 1345 dbSNP
rs1005266898 1354 dbSNP
rs970245794 1367 dbSNP
rs759926244 1369 dbSNP
rs1036904503 1373 dbSNP
rs1014366075 1374 dbSNP
rs942300341 1376 dbSNP
rs896706176 1378 dbSNP
rs1447705595 1381 dbSNP
rs1241649696 1382 dbSNP
rs755092800 1388 dbSNP
rs1211385305 1389 dbSNP
rs1444663508 1392 dbSNP
rs1276861667 1396 dbSNP
rs1425001363 1397 dbSNP
rs999653705 1398 dbSNP
rs1204130097 1400 dbSNP
rs1343385636 1402 dbSNP
rs980804192 1410 dbSNP
rs553852603 1416 dbSNP
rs902689513 1441 dbSNP
rs617694 1445 dbSNP
rs1269099626 1450 dbSNP
rs946821292 1456 dbSNP
rs371725230 1461 dbSNP
rs1311053991 1467 dbSNP
rs1433865080 1478 dbSNP
rs1370986636 1487 dbSNP
rs1049739809 1488 dbSNP
rs1357892402 1504 dbSNP
rs956975012 1509 dbSNP
rs934000203 1512 dbSNP
rs1031509363 1514 dbSNP
rs556437664 1522 dbSNP
rs1293718222 1525 dbSNP
rs1483568675 1535 dbSNP
rs968702755 1541 dbSNP
rs1206794706 1546 dbSNP
rs972627895 1553 dbSNP
rs1305409662 1556 dbSNP
rs1299788231 1564 dbSNP
rs1228382235 1570 dbSNP
rs939824005 1572 dbSNP
rs1021487559 1574 dbSNP
rs537722824 1580 dbSNP
rs570634514 1582 dbSNP
rs1414148916 1584 dbSNP
rs1364918523 1585 dbSNP
rs1350833474 1588 dbSNP
rs888800923 1590 dbSNP
rs1051345428 1594 dbSNP
rs1165816545 1596 dbSNP
rs1407146329 1598 dbSNP
rs984383893 1606 dbSNP
rs969820019 1607 dbSNP
rs1370832005 1613 dbSNP
rs897530817 1614 dbSNP
rs1428710874 1617 dbSNP
rs1254367354 1621 dbSNP
rs61770058 1625 dbSNP
rs58075877 1635 dbSNP
rs909497199 1636 dbSNP
rs1196320432 1639 dbSNP
rs992482931 1642 dbSNP
rs1045324456 1643 dbSNP
rs1291696175 1647 dbSNP
rs533296952 1647 dbSNP
rs199528289 1650 dbSNP
rs1329782922 1654 dbSNP
rs796678476 1656 dbSNP
rs959695609 1661 dbSNP
rs1294304670 1668 dbSNP
rs148882262 1670 dbSNP
rs1392313841 1673 dbSNP
rs1325338217 1676 dbSNP
rs1458176216 1681 dbSNP
rs924018572 1683 dbSNP
rs1157640866 1685 dbSNP
rs1418830327 1693 dbSNP
rs547419750 1697 dbSNP
rs756365654 1698 dbSNP
rs1022455850 1699 dbSNP
rs1280293638 1703 dbSNP
rs1402877265 1721 dbSNP
rs1021518643 1730 dbSNP
rs750813267 1733 dbSNP
rs768051416 1734 dbSNP
rs1262413850 1736 dbSNP
rs1236836317 1740 dbSNP
rs1316094825 1744 dbSNP
rs1301745568 1746 dbSNP
rs1221112565 1751 dbSNP
rs1369054990 1752 dbSNP
rs1325551750 1753 dbSNP
rs1435899988 1755 dbSNP
rs986025696 1758 dbSNP
rs1287609973 1769 dbSNP
rs756961789 1772 dbSNP
rs1050290320 1773 dbSNP
rs62541918 1775 dbSNP
rs1029957319 1784 dbSNP
rs869165011 1786 dbSNP
rs373304452 1789 dbSNP
rs77297636 1792 dbSNP
rs139119817 1826 dbSNP
rs112240215 1833 dbSNP
rs1449506764 1838 dbSNP
rs1037028132 1844 dbSNP
rs187274935 1854 dbSNP
rs939938400 1862 dbSNP
rs1425363212 1864 dbSNP
rs1015077176 1865 dbSNP
rs1212739371 1866 dbSNP
rs1345551034 1870 dbSNP
rs1006414071 1872 dbSNP
rs1229478396 1877 dbSNP
rs531873042 1880 dbSNP
rs181763288 1884 dbSNP
rs1173729621 1885 dbSNP
rs1293566305 1887 dbSNP
rs1382094950 1889 dbSNP
rs909831901 1890 dbSNP
rs762544259 1893 dbSNP
rs1479668840 1902 dbSNP
rs34934263 1906 dbSNP
rs948577385 1910 dbSNP
rs1453812801 1914 dbSNP
rs1248975639 1919 dbSNP
rs1195332173 1920 dbSNP
rs572202458 1925 dbSNP
rs1256774179 1931 dbSNP
rs189735588 1945 dbSNP
rs1279372722 1948 dbSNP
rs1206092559 1959 dbSNP
rs959809293 1966 dbSNP
rs1249634832 1968 dbSNP
rs1226772399 1982 dbSNP
rs924268220 1986 dbSNP
rs1322471439 1990 dbSNP
rs935321597 1991 dbSNP
rs977111652 1994 dbSNP
rs1409983171 1995 dbSNP
rs966940041 1997 dbSNP
rs1022985025 2002 dbSNP
rs1398201469 2003 dbSNP
rs946794771 2012 dbSNP
rs1461016721 2013 dbSNP
rs1368592637 2019 dbSNP
rs1166950491 2023 dbSNP
rs541915318 2026 dbSNP
rs991299570 2034 dbSNP
rs1474204749 2041 dbSNP
rs185259240 2046 dbSNP
rs954359054 2047 dbSNP
rs1439406608 2053 dbSNP
rs1028374576 2054 dbSNP
rs1195481405 2055 dbSNP
rs1357113776 2057 dbSNP
rs567339755 2060 dbSNP
rs901305142 2062 dbSNP
rs1328049228 2071 dbSNP
rs1036980568 2072 dbSNP
rs1030199882 2073 dbSNP
rs555843457 2076 dbSNP
rs1004182460 2084 dbSNP
rs180807919 2085 dbSNP
rs762734302 2086 dbSNP
rs149715509 2087 dbSNP
rs1479187812 2091 dbSNP
rs1459759963 2092 dbSNP
rs1417068419 2098 dbSNP
rs1159913052 2099 dbSNP
rs1006395256 2104 dbSNP
rs1181648015 2106 dbSNP
rs915720335 2110 dbSNP
rs1361894260 2113 dbSNP
rs1057001696 2114 dbSNP
rs1181295669 2117 dbSNP
rs1452436624 2121 dbSNP
rs1254895103 2124 dbSNP
rs1468138512 2127 dbSNP
rs1240102344 2129 dbSNP
rs200926946 2131 dbSNP
rs59890193 2132 dbSNP
rs1269315735 2135 dbSNP
rs887489752 2135 dbSNP
rs1461018620 2136 dbSNP
rs1237802253 2141 dbSNP
rs575346020 2141 dbSNP
rs938391876 2141 dbSNP
rs1023808993 2142 dbSNP
rs1279535816 2142 dbSNP
rs1393143169 2145 dbSNP
rs1318860227 2146 dbSNP
rs1402395644 2149 dbSNP
rs924387676 2150 dbSNP
rs1220765807 2160 dbSNP
rs1382458241 2161 dbSNP
rs1157785879 2164 dbSNP
rs1454828898 2165 dbSNP
rs1012416799 2166 dbSNP
rs1348188698 2166 dbSNP
rs1397103156 2166 dbSNP
rs557662987 2166 dbSNP
rs1278898074 2167 dbSNP
rs1248748383 2171 dbSNP
rs1218512777 2172 dbSNP
rs1445781761 2173 dbSNP
rs1240768079 2176 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER+ ER+ breast cancer 0.399 4.1e-2 0.316 8.7e-2 20 Click to see details
GSE19350 CNS germ cell tumors -0.495 5.1e-2 -0.413 9.1e-2 12 Click to see details
GSE42095 Differentiated embryonic stem cells -0.331 6.1e-2 -0.244 1.3e-1 23 Click to see details
GSE27834 Pluripotent stem cells -0.349 9.3e-2 -0.409 5.8e-2 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.24 1.2e-1 -0.260 1.0e-1 25 Click to see details
GSE38226 Liver fibrosis -0.241 1.5e-1 -0.164 2.4e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.217 1.5e-1 -0.307 7.2e-2 24 Click to see details
GSE14794 Lymphoblastoid cells -0.099 1.8e-1 -0.115 1.4e-1 90 Click to see details
GSE28544 Breast cancer -0.184 1.9e-1 0.201 1.7e-1 24 Click to see details
GSE21032 Prostate cancer -0.095 2.0e-1 -0.086 2.2e-1 83 Click to see details
GSE17498 Multiple myeloma 0.129 2.1e-1 0.133 2.1e-1 40 Click to see details
GSE21849 B cell lymphoma 0.152 2.2e-1 0.009 4.8e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.192 2.6e-1 0.022 4.7e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.115 2.7e-1 0.041 4.1e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.069 3.7e-1 0.195 1.8e-1 25 Click to see details
GSE17306 Multiple myeloma -0.028 4.2e-1 -0.021 4.4e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.024 4.3e-1 0.020 4.4e-1 64 Click to see details
GSE19783 ER- ER- breast cancer -0.016 4.4e-1 0.013 4.5e-1 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.029 4.5e-1 -0.017 4.7e-1 20 Click to see details
GSE19536 Breast cancer 0.001 5.0e-1 -0.004 4.8e-1 100 Click to see details
GSE19536 Breast cancer 0.001 5.0e-1 -0.004 4.8e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.44 0 0.353 0 68 Click to see details
STAD 0.504 0 0.496 0 32 Click to see details
KICH 0.428 0.02 0.200 0.17 25 Click to see details
LIHC 0.29 0.02 0.350 0.01 49 Click to see details
CESC -0.942 0.11 -1.000 0.5 3 Click to see details
COAD 0.422 0.15 0.452 0.13 8 Click to see details
THCA 0.125 0.17 0.218 0.05 59 Click to see details
BRCA 0.102 0.18 0.116 0.15 84 Click to see details
KIRP 0.132 0.24 0.121 0.25 32 Click to see details
UCEC -0.154 0.26 -0.175 0.24 19 Click to see details
LUSC 0.088 0.3 0.099 0.28 38 Click to see details
CHOL -0.191 0.31 -0.300 0.22 9 Click to see details
PAAD 0.325 0.34 0.400 0.3 4 Click to see details
PRAD -0.05 0.37 -0.006 0.48 50 Click to see details
ESCA -0.11 0.37 -0.164 0.31 11 Click to see details
BLCA 0.076 0.38 -0.026 0.46 18 Click to see details
LUAD -0.085 0.4 -0.161 0.31 12 Click to see details
PCPG 0.087 0.47 0.500 0.33 3 Click to see details
HNSC 0.001 0.5 -0.032 0.42 42 Click to see details
HNSC 0.001 0.5 -0.032 0.42 42 Click to see details
HNSC 0.001 0.5 -0.032 0.42 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*