miRTarBase - #MIRT051315 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PCF11   
Synonyms -
Description PCF11 cleavage and polyadenylation factor subunit
Transcript NM_015885   
Expression
Putative miRNA Targets on PCF11
3'UTR of PCF11
(miRNA target sites are highlighted)
>PCF11|NM_015885|3'UTR
   1 ATAAAATGAGAAAGGTATGTTTTTCTTTTTTAAAAAAGCTGCTGTTGGATCTAGAAGGTGAAGAATTTTTTTATGTATAT
  81 ATAGACATATCTATATAAATTGTCTGGCTGAGGCAGGGCCTTCAGCTATCATTTGGTTAATAAATACATTTTAGTATTTG
 161 CATTTCCTACTGCCTGCAGAGTTTCAGGTGCTTGTTGTGTGAAAGTTCTGTAGATGTGTGCAAATTTAACGAAATGAAAT
 241 TGTATGTGTAAAAATGTACGATTTTTCACTGTGCAACTGTAAATTATAAATAAAAAATATTTTTGCTATTCATGGAGTGT
 321 AATATTTATGCACACCATCAAATAGTTTCTGTACTTTTTATTGGGTAAAAATGGAATTGAACAGCAACCTCAACATAAGA
 401 TTTTTTTTCTAGTAGCCTCCCACTGATTAAAGAAGCAAGTTTGAGGTTTCATCCTTCAAAAGGGGGTTCCGAGAGAGCAC
 481 CGTAGGGCTTTTCTCAAATAGAAAAGCCAGATTTTGAAAAAATTTTAAAGATAAAATAGGACATATTTTGCAGATATATA
 561 TATATATATACACAAACACATCTCCAGGTATAGAGAACCATCCAGATGTTCACTTTTGAAAATATCTAATGATGCAAAGT
 641 TTTATTCTTGAACTTGGACACTGATGCCATCAAACAATTAACAAATATATTTAAGTACTAAAGGTGATTTTTTTTTTAAA
 721 GACTTTTTCAAATTGTCAAATGATTTAATGCAGATGAACATATTTCTATTTTAAGTAACGGGAATCTGTAAGAATGTTTG
 801 CTTGAGATATGGTTAACTTTTTTCTTTTGTTGGTTTTGACTTAGATGGACACCATGAGATGTTAATATTCATACATGTAA
 881 TAAATAGAATGATGAAGAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        |||||:| 
Target 5' ttttttaaaaaagcTGCTGTTg 3'
26 - 47 124.00 -10.90
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||| :||| | |||| :| 
Target 5' taaAAAATATT-TTTGCTATTc 3'
291 - 311 114.00 -5.40
3
miRNA  3' guGUUUGGUAAUACACG-ACGAu 5'
            ||:| : | | |||| ||:| 
Target 5' tgCAGAGTTTCAGGTGCTTGTTg 3'
175 - 197 112.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN29842029 14 COSMIC
COSN8584803 16 COSMIC
COSN30116683 32 COSMIC
COSN1138900 60 COSMIC
COSN30134807 64 COSMIC
COSN30130530 66 COSMIC
COSN30170196 70 COSMIC
COSN5921430 81 COSMIC
COSN26881052 180 COSMIC
COSN20108531 181 COSMIC
COSN31959562 241 COSMIC
COSN31595888 278 COSMIC
COSN31541516 318 COSMIC
COSN20092399 356 COSMIC
COSN1546514 359 COSMIC
COSN31538873 385 COSMIC
COSN31610895 478 COSMIC
COSN27455095 570 COSMIC
COSN29086859 575 COSMIC
COSN27177095 718 COSMIC
COSN8284704 719 COSMIC
COSN22782164 908 COSMIC
COSN16757921 1380 COSMIC
COSN5310706 1393 COSMIC
COSN8284705 1448 COSMIC
COSN5921431 1512 COSMIC
COSN5310707 1527 COSMIC
COSN1546515 1583 COSMIC
COSN20807196 2024 COSMIC
COSN7287850 2100 COSMIC
COSN21945909 2349 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs756339567 4 dbSNP
rs1047782063 7 dbSNP
rs1268366185 15 dbSNP
rs1428136405 16 dbSNP
rs1168496060 18 dbSNP
rs1323329540 18 dbSNP
rs753700685 23 dbSNP
rs1403175584 24 dbSNP
rs754774904 24 dbSNP
rs778628225 29 dbSNP
rs1163533143 30 dbSNP
rs1364232348 32 dbSNP
rs748066532 33 dbSNP
rs1467197258 38 dbSNP
rs375346998 38 dbSNP
rs371395981 40 dbSNP
rs374330760 41 dbSNP
rs1020104807 43 dbSNP
rs1292912955 51 dbSNP
rs532374259 52 dbSNP
rs1197977483 53 dbSNP
rs1438320020 54 dbSNP
rs547357452 55 dbSNP
rs1371940822 59 dbSNP
rs1221777618 65 dbSNP
rs1316691904 66 dbSNP
rs559562845 66 dbSNP
rs1009924440 73 dbSNP
rs1020017219 74 dbSNP
rs1222260763 76 dbSNP
rs1274631212 77 dbSNP
rs968483264 81 dbSNP
rs774550604 83 dbSNP
rs756477328 87 dbSNP
rs953461846 87 dbSNP
rs557264667 88 dbSNP
rs1222912750 89 dbSNP
rs1406836352 94 dbSNP
rs1232442653 95 dbSNP
rs764748067 97 dbSNP
rs1000416764 101 dbSNP
rs1468655047 101 dbSNP
rs987507506 105 dbSNP
rs1178966925 108 dbSNP
rs780577458 111 dbSNP
rs1412967722 113 dbSNP
rs543264479 115 dbSNP
rs139556298 120 dbSNP
rs976659305 132 dbSNP
rs922543116 140 dbSNP
rs954684372 157 dbSNP
rs920737141 168 dbSNP
rs535305306 178 dbSNP
rs983447547 181 dbSNP
rs1211706552 187 dbSNP
rs1440311598 192 dbSNP
rs927067740 192 dbSNP
rs1439406138 198 dbSNP
rs937000767 207 dbSNP
rs1310765141 210 dbSNP
rs1307541125 215 dbSNP
rs781572634 220 dbSNP
rs1239982790 228 dbSNP
rs907947966 231 dbSNP
rs942167569 232 dbSNP
rs554271294 236 dbSNP
rs775772935 238 dbSNP
rs186316304 243 dbSNP
rs973972737 245 dbSNP
rs1319167989 246 dbSNP
rs1421782953 250 dbSNP
rs927451081 251 dbSNP
rs191906001 255 dbSNP
rs1362145415 257 dbSNP
rs553151937 261 dbSNP
rs1439003892 263 dbSNP
rs1183078044 270 dbSNP
rs1211022178 270 dbSNP
rs1057374229 274 dbSNP
rs1236419245 276 dbSNP
rs1272941428 277 dbSNP
rs1215981178 278 dbSNP
rs1436510117 278 dbSNP
rs866273533 282 dbSNP
rs1041636868 286 dbSNP
rs1216429099 292 dbSNP
rs1315490796 292 dbSNP
rs538976193 292 dbSNP
rs896083062 292 dbSNP
rs1000033007 296 dbSNP
rs777115634 299 dbSNP
rs1227124764 309 dbSNP
rs1378474051 321 dbSNP
rs182950686 324 dbSNP
rs1270847733 326 dbSNP
rs1029488438 327 dbSNP
rs945681278 331 dbSNP
rs1041424640 332 dbSNP
rs1181941739 334 dbSNP
rs746577833 338 dbSNP
rs1383219633 343 dbSNP
rs953520352 349 dbSNP
rs1473646262 361 dbSNP
rs1008889173 362 dbSNP
rs1412374323 363 dbSNP
rs571486208 368 dbSNP
rs904268695 370 dbSNP
rs1418756390 380 dbSNP
rs999981223 389 dbSNP
rs962056580 390 dbSNP
rs1332852116 392 dbSNP
rs572768135 396 dbSNP
rs1196897047 401 dbSNP
rs1321656623 401 dbSNP
rs142721367 401 dbSNP
rs1220590928 417 dbSNP
rs752030133 421 dbSNP
rs1277756844 422 dbSNP
rs1451552454 431 dbSNP
rs554089344 434 dbSNP
rs1367962302 436 dbSNP
rs1295085057 442 dbSNP
rs1434197992 453 dbSNP
rs1349293369 458 dbSNP
rs1341833372 459 dbSNP
rs1170736288 463 dbSNP
rs1029523420 464 dbSNP
rs1466776029 466 dbSNP
rs1245993900 471 dbSNP
rs572672491 471 dbSNP
rs981004344 473 dbSNP
rs983414708 475 dbSNP
rs937137037 476 dbSNP
rs1014912770 478 dbSNP
rs1239375630 482 dbSNP
rs1201103846 484 dbSNP
rs963717469 500 dbSNP
rs1257510219 508 dbSNP
rs1258840207 512 dbSNP
rs1322908692 514 dbSNP
rs916893608 518 dbSNP
rs1314225218 523 dbSNP
rs945731528 524 dbSNP
rs1217303689 528 dbSNP
rs1366791164 540 dbSNP
rs1180981512 554 dbSNP
rs1381356940 554 dbSNP
rs1491086368 554 dbSNP
rs34956679 554 dbSNP
rs757650229 554 dbSNP
rs867531700 554 dbSNP
rs1202070896 555 dbSNP
rs148172009 555 dbSNP
rs1237627609 556 dbSNP
rs1258544106 556 dbSNP
rs1443148459 560 dbSNP
rs1041574774 566 dbSNP
rs927386890 570 dbSNP
rs935823523 570 dbSNP
rs200691301 572 dbSNP
rs1309716322 583 dbSNP
rs1242154830 591 dbSNP
rs937496238 592 dbSNP
rs1374645613 596 dbSNP
rs1188030100 598 dbSNP
rs1396158702 605 dbSNP
rs369393297 606 dbSNP
rs917484796 609 dbSNP
rs1241287483 611 dbSNP
rs1050301863 617 dbSNP
rs1361510205 623 dbSNP
rs946318820 631 dbSNP
rs748406718 636 dbSNP
rs1008962774 643 dbSNP
rs1019051885 665 dbSNP
rs1425579031 667 dbSNP
rs1041394889 671 dbSNP
rs1200019701 671 dbSNP
rs1488747338 675 dbSNP
rs769959297 676 dbSNP
rs776696900 677 dbSNP
rs993499529 686 dbSNP
rs904153852 688 dbSNP
rs187585115 689 dbSNP
rs1351391426 690 dbSNP
rs1173546232 702 dbSNP
rs1245471962 704 dbSNP
rs759484529 705 dbSNP
rs952364768 707 dbSNP
rs1300405951 708 dbSNP
rs141819514 708 dbSNP
rs1491511045 708 dbSNP
rs1418304432 709 dbSNP
rs1318128502 716 dbSNP
rs935685069 718 dbSNP
rs960881117 718 dbSNP
rs1325014942 719 dbSNP
rs573353097 721 dbSNP
rs992509881 724 dbSNP
rs1327754204 741 dbSNP
rs1366734050 744 dbSNP
rs1478267295 748 dbSNP
rs1265681050 753 dbSNP
rs1191807799 755 dbSNP
rs372074539 757 dbSNP
rs1323374567 759 dbSNP
rs1221764314 760 dbSNP
rs1210304580 767 dbSNP
rs1358461493 768 dbSNP
rs899611828 769 dbSNP
rs539619949 780 dbSNP
rs1029490578 781 dbSNP
rs1279641084 783 dbSNP
rs935956293 789 dbSNP
rs1326143619 795 dbSNP
rs554593955 798 dbSNP
rs1324632498 809 dbSNP
rs1389020421 810 dbSNP
rs576152647 812 dbSNP
rs112844238 814 dbSNP
rs1162706263 815 dbSNP
rs1283382855 818 dbSNP
rs1425914175 818 dbSNP
rs543521807 821 dbSNP
rs1168712914 822 dbSNP
rs1487179458 828 dbSNP
rs565004557 830 dbSNP
rs1050790400 831 dbSNP
rs1199396486 834 dbSNP
rs1453226052 842 dbSNP
rs10801 851 dbSNP
rs1016809706 863 dbSNP
rs1196159142 875 dbSNP
rs1457787011 878 dbSNP
rs112293216 886 dbSNP
rs1259430457 888 dbSNP
rs1216344670 889 dbSNP
rs1338411381 892 dbSNP
rs1406600666 893 dbSNP
rs1275805833 894 dbSNP
rs1235938337 895 dbSNP
rs557041505 902 dbSNP
rs944530357 902 dbSNP
rs1448173352 906 dbSNP
rs1466267552 910 dbSNP
rs139014507 912 dbSNP
rs868296969 912 dbSNP
rs764586852 913 dbSNP
rs1426193836 914 dbSNP
rs1172927864 915 dbSNP
rs777084617 916 dbSNP
rs1299108927 919 dbSNP
rs1440248932 919 dbSNP
rs963386139 924 dbSNP
rs1345467048 927 dbSNP
rs993489734 930 dbSNP
rs1403618251 936 dbSNP
rs1303554642 941 dbSNP
rs1278952242 942 dbSNP
rs1027685051 946 dbSNP
rs1303148095 949 dbSNP
rs1379851543 950 dbSNP
rs888010145 950 dbSNP
rs973823830 955 dbSNP
rs12804306 957 dbSNP
rs541190802 963 dbSNP
rs191581770 968 dbSNP
rs992991087 973 dbSNP
rs960829497 974 dbSNP
rs917453894 980 dbSNP
rs529961761 983 dbSNP
rs1013744452 985 dbSNP
rs1023998886 991 dbSNP
rs548230337 999 dbSNP
rs1286404676 1013 dbSNP
rs1382140563 1016 dbSNP
rs1490180272 1020 dbSNP
rs1469137450 1030 dbSNP
rs763131533 1036 dbSNP
rs1268926855 1044 dbSNP
rs560947426 1044 dbSNP
rs1440396491 1045 dbSNP
rs1280064818 1048 dbSNP
rs1217865128 1050 dbSNP
rs1356443738 1050 dbSNP
rs1433248609 1052 dbSNP
rs1284446566 1056 dbSNP
rs1223743148 1062 dbSNP
rs1286038511 1063 dbSNP
rs572813154 1063 dbSNP
rs1446070771 1065 dbSNP
rs1312013182 1066 dbSNP
rs977629841 1067 dbSNP
rs140165390 1069 dbSNP
rs1378097606 1075 dbSNP
rs935669293 1082 dbSNP
rs925616733 1097 dbSNP
rs1413870013 1103 dbSNP
rs1441112514 1112 dbSNP
rs1039802512 1130 dbSNP
rs1159681956 1133 dbSNP
rs1193965858 1139 dbSNP
rs986031164 1140 dbSNP
rs1489454205 1141 dbSNP
rs1365312217 1143 dbSNP
rs1456902593 1148 dbSNP
rs1322909219 1152 dbSNP
rs1321080118 1155 dbSNP
rs1292103652 1157 dbSNP
rs12295872 1159 dbSNP
rs1040265924 1160 dbSNP
rs574086779 1160 dbSNP
rs542705833 1165 dbSNP
rs919329645 1166 dbSNP
rs571373952 1167 dbSNP
rs1379424049 1171 dbSNP
rs1049632577 1173 dbSNP
rs1350444606 1189 dbSNP
rs887758616 1190 dbSNP
rs1241118807 1203 dbSNP
rs760556237 1204 dbSNP
rs538780425 1205 dbSNP
rs1050810547 1218 dbSNP
rs1013692251 1219 dbSNP
rs1417791023 1221 dbSNP
rs1186365428 1222 dbSNP
rs1249018296 1223 dbSNP
rs1489075003 1223 dbSNP
rs1220029633 1234 dbSNP
rs555400154 1234 dbSNP
rs1488727204 1239 dbSNP
rs1004022134 1242 dbSNP
rs764780419 1245 dbSNP
rs1194761007 1248 dbSNP
rs1235772039 1253 dbSNP
rs998585436 1263 dbSNP
rs1458847627 1265 dbSNP
rs1368072048 1268 dbSNP
rs1038260138 1269 dbSNP
rs547925220 1272 dbSNP
rs1178865784 1280 dbSNP
rs1393019558 1282 dbSNP
rs1331505406 1304 dbSNP
rs1466856067 1309 dbSNP
rs1033182779 1312 dbSNP
rs1170162257 1325 dbSNP
rs566182217 1326 dbSNP
rs1385070082 1327 dbSNP
rs1422452413 1331 dbSNP
rs1427729853 1339 dbSNP
rs994828942 1340 dbSNP
rs1167267503 1345 dbSNP
rs182707709 1349 dbSNP
rs986240777 1354 dbSNP
rs77541077 1355 dbSNP
rs1211126760 1364 dbSNP
rs975897172 1365 dbSNP
rs1303148714 1379 dbSNP
rs919070799 1380 dbSNP
rs929145907 1383 dbSNP
rs1014312896 1385 dbSNP
rs1348340416 1389 dbSNP
rs1402511435 1389 dbSNP
rs371164952 1389 dbSNP
rs1447880532 1393 dbSNP
rs1448414465 1398 dbSNP
rs1370568159 1401 dbSNP
rs865823363 1403 dbSNP
rs967511730 1404 dbSNP
rs1172239138 1405 dbSNP
rs1434608812 1420 dbSNP
rs77502125 1426 dbSNP
rs1181081577 1433 dbSNP
rs1394070631 1440 dbSNP
rs1182609573 1443 dbSNP
rs938016502 1443 dbSNP
rs1055075304 1446 dbSNP
rs1484391649 1446 dbSNP
rs1208509074 1449 dbSNP
rs1322276447 1451 dbSNP
rs1226567246 1472 dbSNP
rs1347026861 1479 dbSNP
rs926209556 1480 dbSNP
rs1241136234 1481 dbSNP
rs1333408487 1497 dbSNP
rs957899705 1501 dbSNP
rs540344359 1504 dbSNP
rs575622183 1507 dbSNP
rs1396245918 1509 dbSNP
rs558605600 1510 dbSNP
rs1311420358 1513 dbSNP
rs1414501862 1516 dbSNP
rs920895727 1517 dbSNP
rs576823713 1524 dbSNP
rs373273191 1534 dbSNP
rs1160909930 1538 dbSNP
rs1452282989 1540 dbSNP
rs1050779536 1545 dbSNP
rs1013766038 1546 dbSNP
rs1042631098 1549 dbSNP
rs908311995 1552 dbSNP
rs902654542 1553 dbSNP
rs1485198419 1563 dbSNP
rs1263637525 1564 dbSNP
rs939842077 1569 dbSNP
rs1348538604 1573 dbSNP
rs1259598025 1587 dbSNP
rs1244948464 1589 dbSNP
rs1038633366 1591 dbSNP
rs1291017816 1593 dbSNP
rs1232308790 1598 dbSNP
rs1341462019 1599 dbSNP
rs1300499750 1603 dbSNP
rs553124931 1612 dbSNP
rs1384919980 1617 dbSNP
rs1169160546 1618 dbSNP
rs1294164305 1622 dbSNP
rs1425942647 1629 dbSNP
rs7940710 1632 dbSNP
rs757965073 1633 dbSNP
rs1478278714 1635 dbSNP
rs1055058347 1636 dbSNP
rs370021623 1637 dbSNP
rs1195112618 1639 dbSNP
rs894440920 1641 dbSNP
rs1014281937 1645 dbSNP
rs1445188204 1651 dbSNP
rs1260901240 1658 dbSNP
rs75689522 1664 dbSNP
rs1304419866 1666 dbSNP
rs1469367483 1667 dbSNP
rs749921800 1669 dbSNP
rs1379621185 1670 dbSNP
rs1024384133 1671 dbSNP
rs892910925 1677 dbSNP
rs1399394699 1678 dbSNP
rs967480381 1684 dbSNP
rs1007213826 1685 dbSNP
rs1016950657 1686 dbSNP
rs777538856 1687 dbSNP
rs1225756034 1694 dbSNP
rs962902027 1710 dbSNP
rs1326229558 1713 dbSNP
rs1302534950 1730 dbSNP
rs1342227034 1731 dbSNP
rs563277970 1737 dbSNP
rs1466310865 1741 dbSNP
rs746494868 1755 dbSNP
rs1402791729 1758 dbSNP
rs965721526 1758 dbSNP
rs975969530 1761 dbSNP
rs530729353 1764 dbSNP
rs139559219 1765 dbSNP
rs1455580893 1765 dbSNP
rs985061064 1765 dbSNP
rs1261917112 1775 dbSNP
rs957571911 1777 dbSNP
rs1274613345 1778 dbSNP
rs1457913919 1778 dbSNP
rs1193745157 1782 dbSNP
rs909284143 1787 dbSNP
rs543385081 1788 dbSNP
rs1485737578 1800 dbSNP
rs544503752 1801 dbSNP
rs564940807 1811 dbSNP
rs761485362 1811 dbSNP
rs917886958 1815 dbSNP
rs879835695 1823 dbSNP
rs1198813009 1825 dbSNP
rs1028593839 1834 dbSNP
rs79823488 1842 dbSNP
rs986456220 1845 dbSNP
rs908279855 1846 dbSNP
rs1409626697 1849 dbSNP
rs547620898 1850 dbSNP
rs1395494467 1853 dbSNP
rs745765365 1860 dbSNP
rs1416449518 1862 dbSNP
rs1192953591 1863 dbSNP
rs374541893 1863 dbSNP
rs939810825 1864 dbSNP
rs973922787 1867 dbSNP
rs1179152004 1877 dbSNP
rs1418874629 1878 dbSNP
rs562742767 1879 dbSNP
rs11233513 1880 dbSNP
rs1241514245 1885 dbSNP
rs1055427468 1886 dbSNP
rs1277916879 1896 dbSNP
rs1273773648 1898 dbSNP
rs1364869645 1908 dbSNP
rs1220651454 1915 dbSNP
rs1301559219 1924 dbSNP
rs186987973 1925 dbSNP
rs1214943104 1932 dbSNP
rs192227232 1937 dbSNP
rs1045801291 1939 dbSNP
rs950719622 1940 dbSNP
rs903260759 1945 dbSNP
rs1488930012 1949 dbSNP
rs1409511773 1952 dbSNP
rs999314137 1965 dbSNP
rs184476254 1979 dbSNP
rs893272821 2003 dbSNP
rs1479057418 2010 dbSNP
rs997039413 2011 dbSNP
rs1016486024 2013 dbSNP
rs1028517907 2018 dbSNP
rs558545875 2022 dbSNP
rs1282211479 2029 dbSNP
rs768759443 2031 dbSNP
rs1357166007 2032 dbSNP
rs111768451 2034 dbSNP
rs1407575687 2039 dbSNP
rs918003407 2040 dbSNP
rs193094013 2044 dbSNP
rs1156665035 2045 dbSNP
rs1431383453 2048 dbSNP
rs1346935672 2053 dbSNP
rs1316159571 2059 dbSNP
rs145830558 2064 dbSNP
rs1399573892 2065 dbSNP
rs978098051 2075 dbSNP
rs1166578098 2076 dbSNP
rs924204531 2079 dbSNP
rs1417591740 2082 dbSNP
rs767583255 2082 dbSNP
rs1420303658 2089 dbSNP
rs936943516 2091 dbSNP
rs1476664105 2102 dbSNP
rs1322794350 2109 dbSNP
rs1015244873 2112 dbSNP
rs889924372 2114 dbSNP
rs961079479 2126 dbSNP
rs942855542 2131 dbSNP
rs1334521062 2132 dbSNP
rs1038766194 2134 dbSNP
rs1214993906 2135 dbSNP
rs1437992191 2136 dbSNP
rs558502335 2138 dbSNP
rs573347004 2138 dbSNP
rs574563062 2138 dbSNP
rs901624754 2138 dbSNP
rs541590449 2139 dbSNP
rs750558741 2140 dbSNP
rs1170730979 2141 dbSNP
rs556760054 2143 dbSNP
rs1006529368 2150 dbSNP
rs1237475214 2150 dbSNP
rs990692981 2152 dbSNP
rs1016186246 2154 dbSNP
rs867109602 2156 dbSNP
rs1783633 2157 dbSNP
rs1228051113 2158 dbSNP
rs1254958098 2164 dbSNP
rs1012069382 2169 dbSNP
rs959434260 2169 dbSNP
rs1025012146 2170 dbSNP
rs1258909869 2172 dbSNP
rs904441315 2188 dbSNP
rs575149532 2191 dbSNP
rs545702989 2192 dbSNP
rs1042336518 2199 dbSNP
rs547504619 2199 dbSNP
rs1222432231 2206 dbSNP
rs115627375 2209 dbSNP
rs532428622 2210 dbSNP
rs1353104102 2216 dbSNP
rs541498963 2216 dbSNP
rs1054921472 2219 dbSNP
rs1170269816 2220 dbSNP
rs559554499 2223 dbSNP
rs997403865 2227 dbSNP
rs530236934 2228 dbSNP
rs1453802660 2229 dbSNP
rs376536319 2233 dbSNP
rs1180740956 2234 dbSNP
rs891368489 2236 dbSNP
rs1230936438 2239 dbSNP
rs1008398086 2240 dbSNP
rs1204243538 2265 dbSNP
rs1348358587 2267 dbSNP
rs1440090832 2268 dbSNP
rs1162362077 2270 dbSNP
rs1231992539 2271 dbSNP
rs1411573788 2271 dbSNP
rs1346441541 2272 dbSNP
rs184655735 2278 dbSNP
rs1392766891 2281 dbSNP
rs961309998 2283 dbSNP
rs370991656 2291 dbSNP
rs189219394 2292 dbSNP
rs1415729858 2305 dbSNP
rs1332968950 2308 dbSNP
rs1172254534 2311 dbSNP
rs1434707260 2313 dbSNP
rs1377101905 2314 dbSNP
rs1161429388 2317 dbSNP
rs1447806074 2318 dbSNP
rs1407472280 2319 dbSNP
rs959192797 2321 dbSNP
rs766041851 2322 dbSNP
rs11233514 2337 dbSNP
rs1229362403 2339 dbSNP
rs534359056 2346 dbSNP
rs1482922549 2347 dbSNP
rs970554432 2351 dbSNP
rs142586456 2353 dbSNP
rs886067412 2354 dbSNP
rs923868929 2356 dbSNP
rs1025766987 2358 dbSNP
rs566323 2366 dbSNP
rs1054483293 2367 dbSNP
rs1239023093 2368 dbSNP
rs914637195 2376 dbSNP
rs895106997 2377 dbSNP
rs1442017954 2380 dbSNP
rs1414670497 2385 dbSNP
rs1012016886 2393 dbSNP
rs535180088 2397 dbSNP
rs932783555 2406 dbSNP
rs1451666914 2407 dbSNP
rs970547264 2411 dbSNP
rs1235496725 2412 dbSNP
rs1476344813 2415 dbSNP
rs1419760232 2422 dbSNP
rs1049806485 2426 dbSNP
rs999993662 2427 dbSNP
rs1185583666 2428 dbSNP
rs1423153586 2432 dbSNP
rs755435869 2434 dbSNP
rs556698772 2443 dbSNP
rs1473758346 2445 dbSNP
rs180698790 2448 dbSNP
rs897432922 2449 dbSNP
rs995579520 2456 dbSNP
rs1213924718 2457 dbSNP
rs1336544726 2459 dbSNP
rs184075999 2460 dbSNP
rs1291794009 2462 dbSNP
rs765523498 2465 dbSNP
rs17144761 2466 dbSNP
rs79124114 2467 dbSNP
rs541036026 2471 dbSNP
rs756892700 2472 dbSNP
rs1463183971 2476 dbSNP
rs977017235 2494 dbSNP
rs202131508 2496 dbSNP
rs1342634287 2502 dbSNP
rs780650433 2504 dbSNP
rs1426730289 2505 dbSNP
rs748144673 2505 dbSNP
rs745432488 2509 dbSNP
rs1246843652 2513 dbSNP
rs1193770757 2515 dbSNP
rs1469435508 2521 dbSNP
rs756086826 2522 dbSNP
rs1339002759 2523 dbSNP
rs1220577604 2527 dbSNP
rs1340418224 2527 dbSNP
rs778926893 2527 dbSNP
rs923838428 2532 dbSNP
rs958018785 2534 dbSNP
rs922743870 2535 dbSNP
rs371775045 2542 dbSNP
rs756035383 2557 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGAcgau 5'
            ::||  | | ||||||    
Target 5' caTGAAGAAGT-TGTGCTcaaa 3'
17 - 37
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer 0.296 4.0e-3 0.320 2.0e-3 79 Click to see details
GSE19536 Breast cancer 0.256 5.1e-3 0.244 7.2e-3 100 Click to see details
GSE21687 Ependynoma primary tumors 0.267 1.6e-2 0.249 2.4e-2 64 Click to see details
GSE19350 CNS germ cell tumors 0.609 1.8e-2 0.406 9.5e-2 12 Click to see details
GSE28260 Renal cortex and medulla -0.566 2.2e-2 -0.484 4.7e-2 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.448 2.4e-2 0.480 1.6e-2 20 Click to see details
GSE38226 Liver fibrosis -0.274 1.1e-1 -0.037 4.4e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.193 1.4e-1 0.143 2.2e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.181 2.0e-1 -0.145 2.5e-1 24 Click to see details
GSE28544 Breast cancer -0.14 2.6e-1 -0.419 2.1e-2 24 Click to see details
GSE27834 Pluripotent stem cells -0.16 2.8e-1 -0.079 3.9e-1 16 Click to see details
GSE14794 Lymphoblastoid cells 0.049 3.2e-1 0.120 1.3e-1 90 Click to see details
GSE17306 Multiple myeloma -0.065 3.3e-1 -0.099 2.5e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells 0.088 3.4e-1 0.115 3.0e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.034 4.4e-1 0.180 1.9e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.033 4.5e-1 0.050 4.2e-1 20 Click to see details
GSE21849 B cell lymphoma -0.017 4.7e-1 0.292 6.2e-2 29 Click to see details
GSE17498 Multiple myeloma -0.012 4.7e-1 -0.097 2.8e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.012 4.8e-1 0.008 4.8e-1 25 Click to see details
GSE21032 Prostate cancer 0.004 4.9e-1 -0.027 4.0e-1 83 Click to see details
GSE21032 Prostate cancer 0.004 4.9e-1 -0.027 4.0e-1 83 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.996 0 1.000 0.5 4 Click to see details
UCEC 0.507 0.01 0.547 0.01 19 Click to see details
LUAD 0.563 0.03 0.580 0.02 12 Click to see details
PRAD 0.239 0.05 0.230 0.05 50 Click to see details
LIHC 0.235 0.05 0.204 0.08 49 Click to see details
PCPG -0.949 0.1 -1.000 0.5 3 Click to see details
LUSC 0.208 0.11 0.215 0.1 38 Click to see details
BRCA -0.131 0.12 -0.148 0.09 84 Click to see details
CESC -0.85 0.18 -1.000 0.5 3 Click to see details
KIRP 0.156 0.2 0.209 0.13 32 Click to see details
STAD -0.103 0.29 -0.105 0.28 32 Click to see details
COAD -0.222 0.3 -0.619 0.05 8 Click to see details
KICH -0.101 0.32 -0.102 0.31 25 Click to see details
ESCA -0.134 0.35 -0.218 0.26 11 Click to see details
KIRC 0.048 0.35 0.085 0.25 68 Click to see details
HNSC 0.059 0.36 0.092 0.28 42 Click to see details
CHOL -0.092 0.41 -0.133 0.37 9 Click to see details
THCA 0.011 0.47 0.030 0.41 59 Click to see details
BLCA -0.016 0.47 0.018 0.47 18 Click to see details
BLCA -0.016 0.47 0.018 0.47 18 Click to see details
BLCA -0.016 0.47 0.018 0.47 18 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*