miRTarBase - #MIRT051316 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HIST1H2BK   
Synonyms H2B/S, H2BFAiii, H2BFT, H2BK
Description histone cluster 1 H2B family member k
Transcript NM_080593   
Expression
Putative miRNA Targets on HIST1H2BK
3'UTR of HIST1H2BK
(miRNA target sites are highlighted)
>HIST1H2BK|NM_080593|3'UTR
   1 ACTTGCCAAGGAGGGACTTTCTCTGGAATTTCCTGATATGACCAAGAAAGCTTCTTATCAAAAGAAGCACAATTGCCTTC
  81 GGTTACCTCATTATCTACTGCAGAAAAGAAGACGAGAATGCAACCATACCTAGATGGACTTTTCCACAAGCTAAAGCTGG
 161 CCTCTTGATCTCATTCAGATTCCAAAGAGAATCATTTACAAGTTAATTTCTGTCTCCTTGGTCCATTCCTTCTCTCTAAT
 241 AATCATTTACTGTTCCTCAAAGAATTGTCTACATTACCCATCTCCTCTTTTGCCTCTGAGAAAGAGTATATAAGCTTCTG
 321 TACCCCACTGGGGGGTTGGGGTAATATTCTGTGGTCCTCAGCCCTGTACCTTAATAAATTTGTATGCCTTTTCTCTTAAA
 401 AAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGau 5'
                :|||||| | ||||  
Target 5' gttaccTCATTATCTACTGCag 3'
82 - 103 116.00 -7.50
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | ||: || || | |||:| 
Target 5' ctCTAATAATCATTTACTGTTc 3'
234 - 255 116.00 -6.20
3
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               | :||| |||| | || 
Target 5' ggggtAATATTCTGTGGTCCTc 3'
338 - 359 101.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
780599 6804 ClinVar
COSN23584890 6629 COSMIC
COSN31771059 6652 COSMIC
COSN24391417 6653 COSMIC
COSN9778837 6673 COSMIC
COSN2158027 6722 COSMIC
COSN30168175 6738 COSMIC
COSN25437072 6742 COSMIC
COSN14214291 6751 COSMIC
COSN28828830 6752 COSMIC
COSN8513875 6752 COSMIC
COSN30151476 6760 COSMIC
COSN26978856 6765 COSMIC
COSN25298481 6773 COSMIC
COSN30115822 6777 COSMIC
COSN23071927 6779 COSMIC
COSN23071926 6780 COSMIC
COSM5694324 6802 COSMIC
COSM5709992 6802 COSMIC
COSM28378 6804 COSMIC
COSM8072746 6806 COSMIC
COSM5694323 6807 COSMIC
COSM7797525 6807 COSMIC
COSM3248948 6810 COSMIC
COSM6106094 6812 COSMIC
COSM3248947 6813 COSMIC
COSM6513827 6813 COSMIC
COSM7130660 6816 COSMIC
COSM9040837 6822 COSMIC
COSM6289892 6825 COSMIC
COSM451060 6837 COSMIC
COSM9033482 6841 COSMIC
COSM1567890 6842 COSMIC
COSM7287413 6844 COSMIC
COSM3777403 6848 COSMIC
COSM1076882 6851 COSMIC
COSM6288607 6852 COSMIC
COSM5416671 6857 COSMIC
COSM3669570 6859 COSMIC
COSM1076881 6864 COSMIC
COSM3248946 6867 COSMIC
COSM5061692 6868 COSMIC
COSM420945 6870 COSMIC
COSM5947401 6875 COSMIC
COSM1442709 6882 COSMIC
COSM6585944 6882 COSMIC
COSM8863169 6886 COSMIC
COSM7132962 6889 COSMIC
COSM3861051 6892 COSMIC
COSM3248943 6897 COSMIC
COSM8558986 6899 COSMIC
COSM1076880 6900 COSMIC
COSM3623587 6903 COSMIC
COSM1582006 6904 COSMIC
COSM3248942 6906 COSMIC
COSM8435058 6915 COSMIC
COSM5419253 6918 COSMIC
COSM6106095 6918 COSMIC
COSM6106096 6920 COSMIC
COSM8682117 6924 COSMIC
COSM1076879 6938 COSMIC
COSM3623586 6940 COSMIC
COSM5472219 6942 COSMIC
COSM1442708 6944 COSMIC
COSM420946 6953 COSMIC
COSM1311901 6957 COSMIC
COSM7652290 6960 COSMIC
COSM8913055 6964 COSMIC
COSM7120388 6967 COSMIC
COSM8517307 6974 COSMIC
COSM1209725 6977 COSMIC
COSM8210606 6978 COSMIC
COSM9574380 6978 COSMIC
COSM8401148 6980 COSMIC
COSM8626198 6981 COSMIC
COSM1442707 6987 COSMIC
COSM6173358 6988 COSMIC
COSM7538121 7001 COSMIC
COSM4845995 7004 COSMIC
COSM4609987 7013 COSMIC
COSM9602256 7017 COSMIC
COSM5818660 7020 COSMIC
COSM6895473 7022 COSMIC
COSM4567782 7024 COSMIC
COSM3861050 7033 COSMIC
COSM3861049 7038 COSMIC
COSM8945291 7044 COSMIC
COSM8944796 7047 COSMIC
COSM740820 7057 COSMIC
COSM9007403 7057 COSMIC
COSM9192446 7058 COSMIC
COSM1209726 7063 COSMIC
COSM8391228 7071 COSMIC
COSM9713645 7074 COSMIC
COSM740821 7075 COSMIC
COSM8993681 7082 COSMIC
COSM8838852 7084 COSMIC
COSM5931836 7090 COSMIC
COSM4886805 7099 COSMIC
COSM4970404 7100 COSMIC
COSM5404995 7103 COSMIC
COSM9236507 7106 COSMIC
COSN21789534 7126 COSMIC
COSN29032378 7258 COSMIC
COSN7869019 7279 COSMIC
COSN22143669 7307 COSMIC
COSN9905445 7503 COSMIC
COSN20605479 7555 COSMIC
COSN15713498 7676 COSMIC
COSN9905444 7804 COSMIC
COSN21076545 7827 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201471590 2 dbSNP
rs200919564 5 dbSNP
rs1443308196 6 dbSNP
rs373212385 7 dbSNP
rs550725747 8 dbSNP
rs1014668981 9 dbSNP
rs1221846887 10 dbSNP
rs1323079049 11 dbSNP
rs1338424128 13 dbSNP
rs766829673 14 dbSNP
rs775793592 15 dbSNP
rs760700467 16 dbSNP
rs1279053003 18 dbSNP
rs755754110 22 dbSNP
rs1342332817 23 dbSNP
rs923573306 24 dbSNP
rs1230294828 26 dbSNP
rs1287004347 27 dbSNP
rs979183774 30 dbSNP
rs1429796318 31 dbSNP
rs773298679 32 dbSNP
rs546322798 33 dbSNP
rs748077213 34 dbSNP
rs770329983 35 dbSNP
rs762091096 37 dbSNP
rs1170823219 38 dbSNP
rs774120407 39 dbSNP
rs760017496 46 dbSNP
rs1186390493 47 dbSNP
rs768546805 50 dbSNP
rs749151134 51 dbSNP
rs968199542 52 dbSNP
rs536838527 57 dbSNP
rs143491879 61 dbSNP
rs1012478332 62 dbSNP
rs35216950 63 dbSNP
rs1039825531 64 dbSNP
rs1249123335 65 dbSNP
rs796468174 67 dbSNP
rs1345149666 68 dbSNP
rs187358353 70 dbSNP
rs528343118 72 dbSNP
rs1224303929 74 dbSNP
rs1258147314 75 dbSNP
rs1337934807 75 dbSNP
rs1463814912 80 dbSNP
rs1195576498 82 dbSNP
rs1274385252 83 dbSNP
rs1255201556 84 dbSNP
rs944070468 85 dbSNP
rs745362294 89 dbSNP
rs1267500520 90 dbSNP
rs1480569373 93 dbSNP
rs778483326 97 dbSNP
rs1200472080 99 dbSNP
rs1355794299 101 dbSNP
rs559230714 105 dbSNP
rs569389881 106 dbSNP
rs546554001 110 dbSNP
rs994044975 113 dbSNP
rs912738689 114 dbSNP
rs1474991974 115 dbSNP
rs1168255811 116 dbSNP
rs977984267 126 dbSNP
rs530057382 127 dbSNP
rs897195573 128 dbSNP
rs1038378616 129 dbSNP
rs1309190148 131 dbSNP
rs754652364 133 dbSNP
rs1405784917 134 dbSNP
rs914789423 135 dbSNP
rs990393395 136 dbSNP
rs561025600 140 dbSNP
rs1298171387 141 dbSNP
rs780275815 143 dbSNP
rs1344968965 144 dbSNP
rs9393790 145 dbSNP
rs1049806267 148 dbSNP
rs1259288067 149 dbSNP
rs1327546236 150 dbSNP
rs1193668576 152 dbSNP
rs1391734999 156 dbSNP
rs1442719020 157 dbSNP
rs182316858 159 dbSNP
rs1162779019 161 dbSNP
rs1386965535 162 dbSNP
rs1385770504 163 dbSNP
rs189635978 164 dbSNP
rs1295330500 165 dbSNP
rs1383112369 167 dbSNP
rs1381812817 171 dbSNP
rs16894325 175 dbSNP
rs1014795872 177 dbSNP
rs934905688 184 dbSNP
rs1005112769 185 dbSNP
rs529382873 188 dbSNP
rs1258394016 190 dbSNP
rs979489236 192 dbSNP
rs1349536091 195 dbSNP
rs1168505328 197 dbSNP
rs536234343 199 dbSNP
rs573713605 200 dbSNP
rs76605486 203 dbSNP
rs537197448 205 dbSNP
rs996079983 208 dbSNP
rs757115556 209 dbSNP
rs916327263 209 dbSNP
rs1362073709 212 dbSNP
rs1397248799 217 dbSNP
rs184979509 218 dbSNP
rs1391084179 224 dbSNP
rs1451281947 233 dbSNP
rs1039687768 235 dbSNP
rs1008356049 237 dbSNP
rs551511585 241 dbSNP
rs960529750 242 dbSNP
rs1265449788 243 dbSNP
rs1197643183 244 dbSNP
rs1380572355 244 dbSNP
rs891202928 245 dbSNP
rs1375073853 246 dbSNP
rs368086602 246 dbSNP
rs1269682491 247 dbSNP
rs961268328 248 dbSNP
rs1227529327 249 dbSNP
rs1263473693 253 dbSNP
rs1484201245 255 dbSNP
rs565610794 256 dbSNP
rs140001930 262 dbSNP
rs1233621474 266 dbSNP
rs753885277 268 dbSNP
rs181257556 272 dbSNP
rs1414522501 277 dbSNP
rs1298728220 280 dbSNP
rs1468398075 284 dbSNP
rs1392695403 287 dbSNP
rs1370605448 294 dbSNP
rs1176193396 304 dbSNP
rs1360053824 304 dbSNP
rs1468034802 307 dbSNP
rs1297032641 308 dbSNP
rs1055122535 313 dbSNP
rs1289636466 314 dbSNP
rs937554308 315 dbSNP
rs530018344 322 dbSNP
rs1377754664 323 dbSNP
rs1202160608 326 dbSNP
rs560984943 326 dbSNP
rs1250734399 334 dbSNP
rs1480903052 337 dbSNP
rs981067590 338 dbSNP
rs1254013140 339 dbSNP
rs1337392899 347 dbSNP
rs1477871322 349 dbSNP
rs971151241 352 dbSNP
rs1435340255 353 dbSNP
rs1168738856 354 dbSNP
rs1354498445 360 dbSNP
rs150002575 368 dbSNP
rs1309328501 370 dbSNP
rs1363088717 371 dbSNP
rs1053213177 372 dbSNP
rs1293808819 375 dbSNP
rs1369253628 375 dbSNP
rs1212633686 376 dbSNP
rs764281303 377 dbSNP
rs550791455 380 dbSNP
rs1472980497 381 dbSNP
rs926194586 381 dbSNP
rs1221827515 382 dbSNP
rs189656330 383 dbSNP
rs760526639 385 dbSNP
rs12193820 386 dbSNP
rs996098752 390 dbSNP
rs115036092 391 dbSNP
rs146064119 394 dbSNP
rs1253921921 398 dbSNP
rs774110932 402 dbSNP
rs1423502673 407 dbSNP
rs1018315307 408 dbSNP
rs927807319 411 dbSNP
rs1428161271 413 dbSNP
rs541536574 414 dbSNP
rs770733125 415 dbSNP
rs1288089489 424 dbSNP
rs891104077 428 dbSNP
rs1042206270 433 dbSNP
rs961173866 434 dbSNP
rs560076200 437 dbSNP
rs1357929854 439 dbSNP
rs1358616391 449 dbSNP
rs543383549 450 dbSNP
rs1290621947 468 dbSNP
rs1323744339 474 dbSNP
rs573676718 477 dbSNP
rs1335433474 478 dbSNP
rs1414325681 479 dbSNP
rs984016481 479 dbSNP
rs1190879700 486 dbSNP
rs1400470988 487 dbSNP
rs1160561738 491 dbSNP
rs1457983099 494 dbSNP
rs1444525016 498 dbSNP
rs1163362558 502 dbSNP
rs1411428771 505 dbSNP
rs1180130342 520 dbSNP
rs556870674 523 dbSNP
rs1054626158 531 dbSNP
rs1458663412 534 dbSNP
rs1381972690 535 dbSNP
rs1284857003 537 dbSNP
rs140607024 537 dbSNP
rs901246399 537 dbSNP
rs111276112 545 dbSNP
rs927538153 546 dbSNP
rs1267792020 549 dbSNP
rs1330047046 550 dbSNP
rs998989203 552 dbSNP
rs1261608438 554 dbSNP
rs1442367564 556 dbSNP
rs1045397893 565 dbSNP
rs1239722323 566 dbSNP
rs1043702225 574 dbSNP
rs948963099 580 dbSNP
rs138820175 582 dbSNP
rs1412308357 582 dbSNP
rs894844859 584 dbSNP
rs1253846298 590 dbSNP
rs1414819758 591 dbSNP
rs1336151363 596 dbSNP
rs1210319686 599 dbSNP
rs181786292 600 dbSNP
rs117424961 603 dbSNP
rs534794585 604 dbSNP
rs930370797 605 dbSNP
rs1230407611 609 dbSNP
rs920463692 615 dbSNP
rs972456008 616 dbSNP
rs1201376031 618 dbSNP
rs1281412806 618 dbSNP
rs1436546564 619 dbSNP
rs190516554 622 dbSNP
rs1251834769 632 dbSNP
rs939840591 633 dbSNP
rs1196921916 636 dbSNP
rs1376702698 638 dbSNP
rs964646814 642 dbSNP
rs1018891482 644 dbSNP
rs1447911313 648 dbSNP
rs987357095 649 dbSNP
rs73739601 654 dbSNP
rs1417329792 656 dbSNP
rs12205921 657 dbSNP
rs754061366 662 dbSNP
rs1274585217 663 dbSNP
rs1301590056 667 dbSNP
rs1330720461 668 dbSNP
rs1010774532 671 dbSNP
rs34566419 673 dbSNP
rs893211277 684 dbSNP
rs1234472401 688 dbSNP
rs542566888 693 dbSNP
rs1338044119 698 dbSNP
rs1228224631 700 dbSNP
rs1275971618 706 dbSNP
rs569615405 711 dbSNP
rs1463119478 718 dbSNP
rs1001641087 721 dbSNP
rs16894323 723 dbSNP
rs1451774615 729 dbSNP
rs1200756144 732 dbSNP
rs1371073541 733 dbSNP
rs1472445268 738 dbSNP
rs1045978599 739 dbSNP
rs530834486 741 dbSNP
rs1391937578 745 dbSNP
rs571695350 754 dbSNP
rs1161505868 756 dbSNP
rs779057239 766 dbSNP
rs1387518768 773 dbSNP
rs1247100510 783 dbSNP
rs1325119550 787 dbSNP
rs1434806091 788 dbSNP
rs1299056632 790 dbSNP
rs930424253 795 dbSNP
rs1344895254 800 dbSNP
rs112804618 806 dbSNP
rs998856529 807 dbSNP
rs920338878 811 dbSNP
rs577802734 812 dbSNP
rs1211200841 813 dbSNP
rs1289993338 817 dbSNP
rs551621156 818 dbSNP
rs757446688 819 dbSNP
rs943196867 823 dbSNP
rs1201797506 824 dbSNP
rs1021786566 826 dbSNP
rs751783180 828 dbSNP
rs528689956 837 dbSNP
rs1354863422 839 dbSNP
rs1185542322 848 dbSNP
rs185594644 852 dbSNP
rs1458468877 854 dbSNP
rs1165276588 858 dbSNP
rs1386697347 862 dbSNP
rs966647601 871 dbSNP
rs1057497586 883 dbSNP
rs1367999009 886 dbSNP
rs939017440 893 dbSNP
rs906162323 898 dbSNP
rs1036791913 902 dbSNP
rs1246341764 907 dbSNP
rs1258643094 911 dbSNP
rs1328013434 915 dbSNP
rs1209157925 919 dbSNP
rs939745845 928 dbSNP
rs1181275714 929 dbSNP
rs1459936740 929 dbSNP
rs1318843722 932 dbSNP
rs192426665 933 dbSNP
rs529572756 935 dbSNP
rs563840635 936 dbSNP
rs777703600 937 dbSNP
rs756232515 949 dbSNP
rs752510092 952 dbSNP
rs1322980818 959 dbSNP
rs1464857050 960 dbSNP
rs367870459 963 dbSNP
rs1302836161 964 dbSNP
rs1403618036 979 dbSNP
rs1033076898 986 dbSNP
rs1048205724 992 dbSNP
rs1285864916 995 dbSNP
rs932586913 997 dbSNP
rs1411607954 1002 dbSNP
rs1289989442 1003 dbSNP
rs1321227532 1006 dbSNP
rs1001547777 1008 dbSNP
rs1256556015 1009 dbSNP
rs1170407158 1014 dbSNP
rs188343651 1018 dbSNP
rs746833096 1025 dbSNP
rs965351330 1025 dbSNP
rs1186382319 1029 dbSNP
rs544004104 1032 dbSNP
rs977508179 1037 dbSNP
rs1414452816 1038 dbSNP
rs573388351 1040 dbSNP
rs886687750 1045 dbSNP
rs371638380 1046 dbSNP
rs1175763646 1055 dbSNP
rs1047880860 1058 dbSNP
rs1467984994 1059 dbSNP
rs577592029 1061 dbSNP
rs1013099117 1070 dbSNP
rs930343141 1071 dbSNP
rs959103419 1071 dbSNP
rs1369328962 1072 dbSNP
rs1409888471 1075 dbSNP
rs1309520675 1078 dbSNP
rs764362610 1079 dbSNP
rs60765842 1080 dbSNP
rs1035948825 1081 dbSNP
rs1313891349 1081 dbSNP
rs1491190966 1081 dbSNP
rs55633061 1081 dbSNP
rs1254298857 1083 dbSNP
rs774864423 1083 dbSNP
rs775560682 1083 dbSNP
rs1206473552 1085 dbSNP
rs1268424570 1085 dbSNP
rs1487607500 1085 dbSNP
rs1003095047 1087 dbSNP
rs1342013088 1087 dbSNP
rs1390076479 1091 dbSNP
rs1038809771 1102 dbSNP
rs1169895284 1103 dbSNP
rs1429875700 1103 dbSNP
rs1295904110 1110 dbSNP
rs1221229479 1111 dbSNP
rs1368593144 1112 dbSNP
rs1274471007 1113 dbSNP
rs1434484658 1114 dbSNP
rs1347779704 1117 dbSNP
rs1293898087 1118 dbSNP
rs1435231895 1118 dbSNP
rs1372447961 1119 dbSNP
rs1309825422 1122 dbSNP
rs1221024970 1123 dbSNP
rs1229274725 1123 dbSNP
rs1275147379 1123 dbSNP
rs1296853207 1123 dbSNP
rs1320157787 1123 dbSNP
rs1342752769 1123 dbSNP
rs1369543446 1123 dbSNP
rs1432623021 1123 dbSNP
rs1491336809 1123 dbSNP
rs372631241 1123 dbSNP
rs577779510 1123 dbSNP
rs57882884 1123 dbSNP
rs66501850 1123 dbSNP
rs71546528 1123 dbSNP
rs749667586 1123 dbSNP
rs753045095 1123 dbSNP
rs772489439 1123 dbSNP
rs867971278 1123 dbSNP
rs573829681 1125 dbSNP
rs906234411 1126 dbSNP
rs1036697402 1133 dbSNP
rs58304090 1134 dbSNP
rs866024077 1134 dbSNP
rs943058072 1148 dbSNP
rs555013181 1150 dbSNP
rs1048588477 1151 dbSNP
rs1051588373 1152 dbSNP
rs945313231 1158 dbSNP
rs1425515445 1160 dbSNP
rs76804831 1161 dbSNP
rs1476784410 1166 dbSNP
rs989781406 1170 dbSNP
rs1158166834 1171 dbSNP
rs1040947704 1175 dbSNP
rs957408688 1177 dbSNP
rs1332182651 1178 dbSNP
rs1182224749 1179 dbSNP
rs925923713 1180 dbSNP
rs571906444 1184 dbSNP
rs149580707 1187 dbSNP
rs1483020071 1193 dbSNP
rs924653344 1201 dbSNP
rs1284803907 1205 dbSNP
rs977380512 1213 dbSNP
rs1273040510 1215 dbSNP
rs1287955811 1217 dbSNP
rs970113617 1220 dbSNP
rs1330313869 1223 dbSNP
rs535277028 1224 dbSNP
rs1024463913 1225 dbSNP
rs1225806326 1229 dbSNP
rs569906810 1237 dbSNP
rs1442311569 1238 dbSNP
rs914681114 1244 dbSNP
rs1258938361 1248 dbSNP
rs950924446 1255 dbSNP
rs377205699 1262 dbSNP
rs572107508 1262 dbSNP
rs556213362 1263 dbSNP
rs1412238015 1264 dbSNP
rs995463552 1265 dbSNP
rs1289100376 1267 dbSNP
rs1035855024 1275 dbSNP
rs1414912148 1277 dbSNP
rs1334931332 1284 dbSNP
rs898834728 1287 dbSNP
rs1408060967 1288 dbSNP
rs1038714978 1292 dbSNP
rs962269119 1294 dbSNP
rs1015295239 1298 dbSNP
rs1444858157 1302 dbSNP
rs1007348441 1303 dbSNP
rs888083901 1309 dbSNP
rs183634329 1316 dbSNP
rs1283085088 1317 dbSNP
rs1052055456 1320 dbSNP
rs1175030134 1324 dbSNP
rs566088178 1325 dbSNP
rs1413633596 1327 dbSNP
rs1159279770 1328 dbSNP
rs1252127090 1336 dbSNP
rs1439141777 1342 dbSNP
rs1196497421 1346 dbSNP
rs1471971993 1350 dbSNP
rs558036046 1354 dbSNP
rs1175499402 1355 dbSNP
rs772971551 1359 dbSNP
rs551852364 1361 dbSNP
rs1053719847 1362 dbSNP
rs936547639 1364 dbSNP
rs1184073407 1370 dbSNP
rs1371430138 1377 dbSNP
rs1393306576 1396 dbSNP
rs1483809577 1406 dbSNP
rs1321997572 1409 dbSNP
rs1437615283 1411 dbSNP
rs1040852684 1414 dbSNP
rs1363606400 1423 dbSNP
rs925995646 1423 dbSNP
rs1274655042 1424 dbSNP
rs1237284280 1431 dbSNP
rs1207768765 1434 dbSNP
rs1208409651 1435 dbSNP
rs943987857 1448 dbSNP
rs1331487303 1458 dbSNP
rs980064017 1459 dbSNP
rs1268937435 1460 dbSNP
rs1373655694 1461 dbSNP
rs769123735 1462 dbSNP
rs917314439 1463 dbSNP
rs993292746 1464 dbSNP
rs903122267 1466 dbSNP
rs1387105010 1467 dbSNP
rs1434925225 1467 dbSNP
rs1041594036 1470 dbSNP
rs1327735059 1471 dbSNP
rs12111326 1473 dbSNP
rs914526479 1477 dbSNP
rs1026859821 1480 dbSNP
rs995137109 1481 dbSNP
rs139294464 1484 dbSNP
rs377688716 1499 dbSNP
rs549566227 1500 dbSNP
rs529531455 1508 dbSNP
rs1185473370 1518 dbSNP
rs1007212843 1540 dbSNP
rs1475623885 1551 dbSNP
rs890104637 1553 dbSNP
rs1386988339 1557 dbSNP
rs1051537091 1560 dbSNP
rs191793180 1568 dbSNP
rs543793712 1570 dbSNP
rs1332874330 1578 dbSNP
rs1166221233 1584 dbSNP
rs1054025701 1585 dbSNP
rs962173852 1587 dbSNP
rs1328295173 1590 dbSNP
rs188252250 1598 dbSNP
rs563972683 1599 dbSNP
rs150860077 1607 dbSNP
rs948735208 1614 dbSNP
rs917203891 1619 dbSNP
rs1208322780 1620 dbSNP
rs992928585 1623 dbSNP
rs1027058073 1632 dbSNP
rs1190400618 1632 dbSNP
rs1463674428 1633 dbSNP
rs1472491329 1636 dbSNP
rs929379293 1640 dbSNP
rs996647902 1642 dbSNP
rs919465114 1643 dbSNP
rs899573042 1644 dbSNP
rs1245533512 1653 dbSNP
rs1019294848 1659 dbSNP
rs1008034711 1665 dbSNP
rs1375596100 1675 dbSNP
rs1416076536 1680 dbSNP
rs1305853564 1700 dbSNP
rs540114559 1704 dbSNP
rs1311908627 1705 dbSNP
rs1391792397 1707 dbSNP
rs973964543 1709 dbSNP
rs772588708 1712 dbSNP
rs1320867351 1715 dbSNP
rs569395348 1716 dbSNP
rs1256499082 1718 dbSNP
rs1348746401 1719 dbSNP
rs745415638 1719 dbSNP
rs746422622 1720 dbSNP
rs1382267924 1724 dbSNP
rs571766219 1734 dbSNP
rs561461503 1737 dbSNP
rs1178150725 1738 dbSNP
rs1041643057 1744 dbSNP
rs1457917185 1748 dbSNP
rs954370442 1749 dbSNP
rs34471161 1761 dbSNP
rs796456630 1761 dbSNP
rs541604573 1765 dbSNP
rs576192051 1772 dbSNP
rs1391194313 1773 dbSNP
rs1166132841 1779 dbSNP
rs556414900 1781 dbSNP
rs1188283303 1783 dbSNP
rs1462116741 1785 dbSNP
rs1426968766 1787 dbSNP
rs1365295793 1788 dbSNP
rs1269669832 1794 dbSNP
rs1009359844 1799 dbSNP
rs892202508 1808 dbSNP
rs1032205572 1812 dbSNP
rs1000637352 1813 dbSNP
rs905011700 1816 dbSNP
rs539398612 1834 dbSNP
rs1272494029 1836 dbSNP
rs928715291 1840 dbSNP
rs1341730693 1842 dbSNP
rs577073715 1851 dbSNP
rs558145788 1855 dbSNP
rs1487738012 1859 dbSNP
rs1254217214 1871 dbSNP
rs1455929840 1872 dbSNP
rs535033506 1876 dbSNP
rs1389086194 1877 dbSNP
rs1428577772 1879 dbSNP
rs566148729 1880 dbSNP
rs1457244974 1883 dbSNP
rs919315327 1887 dbSNP
rs183605450 1899 dbSNP
rs942190147 1900 dbSNP
rs141516145 1901 dbSNP
rs1296779297 1916 dbSNP
rs1227310300 1920 dbSNP
rs1324334484 1922 dbSNP
rs1361433669 1923 dbSNP
rs1215216309 1926 dbSNP
rs1298056999 1927 dbSNP
rs1302937649 1931 dbSNP
rs986386517 1932 dbSNP
rs1320104143 1934 dbSNP
rs963658868 1939 dbSNP
rs1332987660 1940 dbSNP
rs1187724411 1941 dbSNP
rs1300691880 1941 dbSNP
rs1411209571 1942 dbSNP
rs1419848637 1942 dbSNP
rs1019325808 1943 dbSNP
rs1432205933 1943 dbSNP
rs955128455 1945 dbSNP
rs1030032626 1946 dbSNP
rs187288443 1947 dbSNP
rs544585232 1948 dbSNP
rs1032526009 1949 dbSNP
rs1000535928 1950 dbSNP
rs1402317879 1951 dbSNP
rs866542540 1951 dbSNP
rs796513840 1952 dbSNP
rs866268062 1952 dbSNP
rs1013490827 1953 dbSNP
rs1279277989 1953 dbSNP
rs1210942459 1954 dbSNP
rs896377595 1954 dbSNP
rs1189449607 1955 dbSNP
rs1471039146 1955 dbSNP
rs1057154324 1956 dbSNP
rs993923042 1957 dbSNP
rs1207749659 1958 dbSNP
rs1281775266 1958 dbSNP
rs1327520038 1958 dbSNP
rs1328428832 1958 dbSNP
rs1336782492 1958 dbSNP
rs1371223743 1958 dbSNP
rs1427990631 1958 dbSNP
rs1444787472 1958 dbSNP
rs1491530813 1958 dbSNP
rs59570458 1958 dbSNP
rs757445252 1958 dbSNP
rs771068134 1958 dbSNP
rs1167608751 1959 dbSNP
rs1194343474 1959 dbSNP
rs1270638102 1959 dbSNP
rs1454615221 1959 dbSNP
rs1491453158 1959 dbSNP
rs1275192952 1960 dbSNP
rs897795517 1971 dbSNP
rs1321934845 1988 dbSNP
rs112505155 1996 dbSNP
rs942056250 1997 dbSNP
rs550445742 1999 dbSNP
rs1270439093 2000 dbSNP
rs1050577560 2004 dbSNP
rs1226409184 2008 dbSNP
rs1272238585 2010 dbSNP
rs1280814757 2012 dbSNP
rs1411068210 2014 dbSNP
rs1351714493 2016 dbSNP
rs1307959181 2024 dbSNP
rs933617109 2025 dbSNP
rs908074546 2026 dbSNP
rs1282527819 2030 dbSNP
rs923499993 2037 dbSNP
rs1173471866 2041 dbSNP
rs988387863 2042 dbSNP
rs1465755351 2048 dbSNP
rs1462285432 2053 dbSNP
rs1427375228 2057 dbSNP
rs777041939 2063 dbSNP
rs1472951207 2064 dbSNP
rs1252531381 2068 dbSNP
rs956588030 2069 dbSNP
rs930938018 2070 dbSNP
rs924909099 2073 dbSNP
rs979188765 2077 dbSNP
rs1180959658 2079 dbSNP
rs969102492 2082 dbSNP
rs1242238424 2083 dbSNP
rs374889203 2084 dbSNP
rs1023452807 2086 dbSNP
rs1335291111 2090 dbSNP
rs1234872466 2094 dbSNP
rs147313328 2098 dbSNP
rs963689828 2118 dbSNP
rs144191555 2119 dbSNP
rs369049375 2120 dbSNP
rs567022476 2120 dbSNP
rs1448811598 2126 dbSNP
rs138630666 2128 dbSNP
rs994066732 2129 dbSNP
rs1475754983 2131 dbSNP
rs1020146966 2136 dbSNP
rs1362579075 2160 dbSNP
rs1011839495 2163 dbSNP
rs1159646693 2165 dbSNP
rs193080645 2166 dbSNP
rs897825269 2167 dbSNP
rs1229775601 2173 dbSNP
rs1329204183 2176 dbSNP
rs576415429 2177 dbSNP
rs111380108 2179 dbSNP
rs1416414527 2179 dbSNP
rs1006346798 2183 dbSNP
rs889191727 2190 dbSNP
rs1001416528 2191 dbSNP
rs1353001948 2197 dbSNP
rs1050607000 2208 dbSNP
rs907236726 2209 dbSNP
rs879712134 2219 dbSNP
rs1190516120 2224 dbSNP
rs933503475 2228 dbSNP
rs1248940654 2229 dbSNP
rs1335275577 2230 dbSNP
rs1395746444 2231 dbSNP
rs1366025812 2234 dbSNP
rs188894484 2235 dbSNP
rs1172422092 2243 dbSNP
rs1375694375 2244 dbSNP
rs760895411 2258 dbSNP
rs886508900 2259 dbSNP
rs1296092857 2260 dbSNP
rs1053117964 2265 dbSNP
rs1372425528 2281 dbSNP
rs773602058 2288 dbSNP
rs935594014 2288 dbSNP
rs1391743256 2290 dbSNP
rs562500511 2295 dbSNP
rs1411299621 2297 dbSNP
rs924984033 2311 dbSNP
rs1156854196 2315 dbSNP
rs1368629349 2319 dbSNP
rs1468540761 2320 dbSNP
rs1232193186 2327 dbSNP
rs1370059679 2331 dbSNP
rs1188069276 2333 dbSNP
rs979052976 2340 dbSNP
rs1302673221 2345 dbSNP
rs1348677943 2346 dbSNP
rs1460704733 2350 dbSNP
rs1049121994 2370 dbSNP
rs1240935364 2378 dbSNP
rs868376524 2380 dbSNP
rs1210190517 2382 dbSNP
rs1196707256 2383 dbSNP
rs183367235 2388 dbSNP
rs969130639 2390 dbSNP
rs1390540545 2398 dbSNP
rs930810552 2400 dbSNP
rs1395232774 2408 dbSNP
rs377582578 2414 dbSNP
rs991893201 2424 dbSNP
rs944960063 2436 dbSNP
rs1462337527 2461 dbSNP
rs1299607318 2463 dbSNP
rs1392205562 2464 dbSNP
rs912255115 2470 dbSNP
rs1359088382 2474 dbSNP
rs1371876960 2477 dbSNP
rs370467154 2481 dbSNP
rs967043692 2482 dbSNP
rs960829000 2483 dbSNP
rs1228631468 2485 dbSNP
rs1245786684 2489 dbSNP
rs1411473832 2492 dbSNP
rs1253380791 2498 dbSNP
rs1467414660 2499 dbSNP
rs912989560 2502 dbSNP
rs1254154515 2515 dbSNP
rs1469454302 2519 dbSNP
rs528497544 2521 dbSNP
rs1428668876 2525 dbSNP
rs989875040 2525 dbSNP
rs973101913 2528 dbSNP
rs1415468312 2532 dbSNP
rs554132034 2537 dbSNP
rs1165611143 2539 dbSNP
rs1436131527 2539 dbSNP
rs1438729465 2544 dbSNP
rs1016304861 2545 dbSNP
rs1361534556 2546 dbSNP
rs1491412613 2546 dbSNP
rs1491524134 2547 dbSNP
rs59258736 2548 dbSNP
rs76329937 2548 dbSNP
rs1407142547 2549 dbSNP
rs1274390643 2550 dbSNP
rs1333214962 2550 dbSNP
rs889098384 2550 dbSNP
rs1323982932 2551 dbSNP
rs1392881016 2569 dbSNP
rs1163745009 2570 dbSNP
rs1443833726 2571 dbSNP
rs1164509949 2572 dbSNP
rs1165318413 2572 dbSNP
rs1187947849 2572 dbSNP
rs1241079312 2572 dbSNP
rs1254919948 2572 dbSNP
rs1259434182 2572 dbSNP
rs1419957005 2572 dbSNP
rs1474775642 2572 dbSNP
rs1485900204 2572 dbSNP
rs34292040 2572 dbSNP
rs70981140 2572 dbSNP
rs758416292 2572 dbSNP
rs1383183289 2575 dbSNP
rs1468398279 2575 dbSNP
rs1024339986 2576 dbSNP
rs1419782622 2580 dbSNP
rs1160484000 2581 dbSNP
rs534993727 2583 dbSNP
rs1373888798 2595 dbSNP
rs1472801912 2599 dbSNP
rs1029096716 2601 dbSNP
rs1004899453 2603 dbSNP
rs1361310058 2612 dbSNP
rs1440428283 2618 dbSNP
rs1279519424 2622 dbSNP
rs1374624618 2623 dbSNP
rs1241700763 2630 dbSNP
rs752850612 2632 dbSNP
rs1346517706 2644 dbSNP
rs879864058 2648 dbSNP
rs1280271777 2649 dbSNP
rs997577887 2652 dbSNP
rs768234866 2656 dbSNP
rs572504629 2660 dbSNP
rs902047538 2661 dbSNP
rs1452829026 2662 dbSNP
rs1191661365 2665 dbSNP
rs1393406503 2669 dbSNP
rs1052605766 2672 dbSNP
rs564463550 2681 dbSNP
rs190767384 2699 dbSNP
rs1043932833 2700 dbSNP
rs900707996 2711 dbSNP
rs1039162067 2713 dbSNP
rs1229525161 2720 dbSNP
rs535619450 2722 dbSNP
rs944991291 2736 dbSNP
rs751612357 2745 dbSNP
rs1369676090 2749 dbSNP
rs1234346698 2756 dbSNP
rs766260458 2756 dbSNP
rs916213439 2762 dbSNP
rs185126810 2764 dbSNP
rs550065123 2765 dbSNP
rs990338618 2768 dbSNP
rs1211790621 2770 dbSNP
rs918451212 2774 dbSNP
rs935761087 2775 dbSNP
rs1423962399 2778 dbSNP
rs182184849 2783 dbSNP
rs962645418 2786 dbSNP
rs1248685269 2794 dbSNP
rs1474511059 2796 dbSNP
rs1167552054 2797 dbSNP
rs1363562277 2800 dbSNP
rs56066652 2806 dbSNP
rs145745218 2814 dbSNP
rs985347735 2821 dbSNP
rs979918516 2822 dbSNP
rs1394342005 2839 dbSNP
rs1418434016 2845 dbSNP
rs971191207 2855 dbSNP
rs1184374042 2858 dbSNP
rs1478751862 2860 dbSNP
rs1324888447 2871 dbSNP
rs1024232108 2875 dbSNP
rs983355112 2878 dbSNP
rs1429657652 2882 dbSNP
rs1270385770 2891 dbSNP
rs1319778024 2892 dbSNP
rs1231181111 2893 dbSNP
rs1246805225 2902 dbSNP
rs533233802 2911 dbSNP
rs1490007320 2913 dbSNP
rs116030475 2917 dbSNP
rs1269642309 2927 dbSNP
rs995357047 2930 dbSNP
rs1206404079 2932 dbSNP
rs1307254056 2937 dbSNP
rs191336021 2939 dbSNP
rs1479026590 2944 dbSNP
rs900573563 2950 dbSNP
rs879324651 2957 dbSNP
rs1221179844 2961 dbSNP
rs1345933271 2965 dbSNP
rs901911462 2973 dbSNP
rs1031608476 2990 dbSNP
rs999717130 2993 dbSNP
rs1009040583 3011 dbSNP
rs1341947696 3014 dbSNP
rs1412708429 3017 dbSNP
rs547786259 3020 dbSNP
rs1292386621 3024 dbSNP
rs761178116 3025 dbSNP
rs779529359 3032 dbSNP
rs890582128 3051 dbSNP
rs202136381 3052 dbSNP
rs869165324 3053 dbSNP
rs948266505 3054 dbSNP
rs10558149 3055 dbSNP
rs777148970 3055 dbSNP
rs1209189228 3060 dbSNP
rs200203669 3060 dbSNP
rs1257324483 3062 dbSNP
rs1424734235 3063 dbSNP
rs891492226 3063 dbSNP
rs1054108888 3064 dbSNP
rs1343624098 3064 dbSNP
rs1158656271 3067 dbSNP
rs1362080678 3069 dbSNP
rs935778179 3069 dbSNP
rs1309766749 3073 dbSNP
rs894855116 3074 dbSNP
rs1442708702 3075 dbSNP
rs373419186 3080 dbSNP
rs939127695 3081 dbSNP
rs1397538391 3084 dbSNP
rs1304811782 3085 dbSNP
rs918324502 3086 dbSNP
rs1335053858 3087 dbSNP
rs6927247 3088 dbSNP
rs1415850973 3089 dbSNP
rs763631891 3090 dbSNP
rs941188956 3092 dbSNP
rs949872773 3096 dbSNP
rs1175161839 3100 dbSNP
rs1479168904 3101 dbSNP
rs1279859504 3105 dbSNP
rs909684026 3113 dbSNP
rs545653390 3119 dbSNP
rs985378829 3131 dbSNP
rs1480565756 3135 dbSNP
rs1231563820 3142 dbSNP
rs149042407 3144 dbSNP
rs1179801392 3177 dbSNP
rs1381698035 3181 dbSNP
rs1452000074 3181 dbSNP
rs1172679087 3189 dbSNP
rs1377792160 3199 dbSNP
rs950646405 3200 dbSNP
rs560461289 3205 dbSNP
rs2021278 3207 dbSNP
rs563380944 3210 dbSNP
rs966414702 3211 dbSNP
rs1331286986 3215 dbSNP
rs1031098684 3221 dbSNP
rs964660794 3221 dbSNP
rs113850979 3233 dbSNP
rs1008901546 3235 dbSNP
rs555751009 3237 dbSNP
rs186437176 3240 dbSNP
rs1296255545 3245 dbSNP
rs1466767099 3248 dbSNP
rs1449938799 3260 dbSNP
rs1010257376 3261 dbSNP
rs1012487780 3263 dbSNP
rs1434481422 3269 dbSNP
rs895387402 3272 dbSNP
rs1167860130 3277 dbSNP
rs1372352386 3285 dbSNP
rs894044277 3288 dbSNP
rs1172763803 3299 dbSNP
rs1054416736 3303 dbSNP
rs1392155600 3311 dbSNP
rs999881713 3312 dbSNP
rs1406451639 3314 dbSNP
rs1388814417 3319 dbSNP
rs1056557446 3320 dbSNP
rs1003231886 3326 dbSNP
rs781041943 3327 dbSNP
rs1260582471 3335 dbSNP
rs181830065 3337 dbSNP
rs1212533667 3342 dbSNP
rs1467821840 3346 dbSNP
rs1265574955 3356 dbSNP
rs556638096 3374 dbSNP
rs757241652 3379 dbSNP
rs1184443737 3382 dbSNP
rs1478045646 3383 dbSNP
rs905493493 3384 dbSNP
rs1230169104 3389 dbSNP
rs1415601830 3397 dbSNP
rs190319278 3403 dbSNP
rs1159150377 3404 dbSNP
rs1165391936 3415 dbSNP
rs1419013725 3415 dbSNP
rs1406346018 3423 dbSNP
rs1287358334 3425 dbSNP
rs150336607 3425 dbSNP
rs1340073038 3433 dbSNP
rs1483779198 3441 dbSNP
rs1280425207 3442 dbSNP
rs1353936310 3444 dbSNP
rs1242803184 3446 dbSNP
rs1228316596 3450 dbSNP
rs909749505 3464 dbSNP
rs1323046959 3467 dbSNP
rs1212991082 3468 dbSNP
rs1049574000 3472 dbSNP
rs932576676 3481 dbSNP
rs72843607 3482 dbSNP
rs777723224 3482 dbSNP
rs1255224516 3491 dbSNP
rs1201982614 3493 dbSNP
rs534175082 3494 dbSNP
rs966079243 3499 dbSNP
rs1415811977 3506 dbSNP
rs923897546 3523 dbSNP
rs964688562 3530 dbSNP
rs140252312 3531 dbSNP
rs547845061 3532 dbSNP
rs1300270752 3533 dbSNP
rs1374064826 3534 dbSNP
rs753032779 3539 dbSNP
rs1304779703 3566 dbSNP
rs1381895437 3573 dbSNP
rs1229863326 3577 dbSNP
rs113421188 3580 dbSNP
rs1307974953 3581 dbSNP
rs1009749783 3584 dbSNP
rs959781673 3592 dbSNP
rs1314051208 3593 dbSNP
rs1441656786 3599 dbSNP
rs1210510552 3605 dbSNP
rs1239137509 3609 dbSNP
rs1032597169 3612 dbSNP
rs1035294384 3616 dbSNP
rs372837026 3619 dbSNP
rs1002449964 3627 dbSNP
rs905566999 3629 dbSNP
rs1393446216 3637 dbSNP
rs1044067513 3639 dbSNP
rs1014042972 3640 dbSNP
rs1004171603 3641 dbSNP
rs1361249136 3644 dbSNP
rs1440738281 3654 dbSNP
rs1331227564 3659 dbSNP
rs1321006455 3667 dbSNP
rs1288959559 3678 dbSNP
rs568839098 3688 dbSNP
rs1300848044 3689 dbSNP
rs1343765205 3691 dbSNP
rs552282437 3693 dbSNP
rs1344013897 3696 dbSNP
rs1197977160 3701 dbSNP
rs896822711 3709 dbSNP
rs1458286582 3712 dbSNP
rs1036698696 3725 dbSNP
rs1445668782 3727 dbSNP
rs1245219273 3732 dbSNP
rs532335522 3733 dbSNP
rs895583882 3737 dbSNP
rs1427747189 3738 dbSNP
rs560433456 3742 dbSNP
rs888177380 3743 dbSNP
rs1451564344 3751 dbSNP
rs1466735843 3752 dbSNP
rs1323239429 3753 dbSNP
rs1262679965 3757 dbSNP
rs1329986379 3757 dbSNP
rs1478808156 3758 dbSNP
rs1230887094 3759 dbSNP
rs796084440 3760 dbSNP
rs868605493 3761 dbSNP
rs10668011 3762 dbSNP
rs1217732941 3762 dbSNP
rs1319840982 3766 dbSNP
rs1211733012 3771 dbSNP
rs1287903704 3774 dbSNP
rs1451081601 3780 dbSNP
rs1047912591 3782 dbSNP
rs1193314280 3782 dbSNP
rs1199913900 3782 dbSNP
rs1248623895 3782 dbSNP
rs1348054563 3782 dbSNP
rs1477064711 3782 dbSNP
rs759784250 3782 dbSNP
rs867969166 3782 dbSNP
rs1231424328 3783 dbSNP
rs1342139981 3783 dbSNP
rs1283506724 3784 dbSNP
rs1364531485 3784 dbSNP
rs1360018905 3786 dbSNP
rs1290770481 3787 dbSNP
rs540428449 3787 dbSNP
rs929159830 3789 dbSNP
rs932511615 3791 dbSNP
rs1264430181 3792 dbSNP
rs1368347318 3792 dbSNP
rs759580218 3792 dbSNP
rs920391497 3797 dbSNP
rs1037656114 3798 dbSNP
rs1377935705 3801 dbSNP
rs1418785520 3802 dbSNP
rs11753378 3803 dbSNP
rs1366982374 3807 dbSNP
rs1362278902 3809 dbSNP
rs1040969589 3810 dbSNP
rs987419599 3815 dbSNP
rs1340922822 3819 dbSNP
rs1381198596 3819 dbSNP
rs1359223929 3823 dbSNP
rs954681163 3823 dbSNP
rs1286084792 3826 dbSNP
rs561181398 3843 dbSNP
rs1239747066 3851 dbSNP
rs1286978678 3852 dbSNP
rs1405503016 3853 dbSNP
rs1489486043 3853 dbSNP
rs556452838 3854 dbSNP
rs988592125 3860 dbSNP
rs1365428328 3862 dbSNP
rs978050796 3865 dbSNP
rs1377996910 3866 dbSNP
rs770039633 3869 dbSNP
rs915344930 3874 dbSNP
rs576410149 3886 dbSNP
rs990838051 3887 dbSNP
rs1032921379 3890 dbSNP
rs1402625468 3891 dbSNP
rs753971117 3896 dbSNP
rs1329186030 3899 dbSNP
rs1374827972 3902 dbSNP
rs1035560703 3903 dbSNP
rs1192720353 3911 dbSNP
rs375325503 3912 dbSNP
rs1255844574 3913 dbSNP
rs961914966 3918 dbSNP
rs1015290254 3919 dbSNP
rs1456955657 3924 dbSNP
rs1025204446 3930 dbSNP
rs1239634792 3934 dbSNP
rs781419767 3940 dbSNP
rs556374724 3944 dbSNP
rs546326393 3945 dbSNP
rs576927872 3946 dbSNP
rs386698271 3947 dbSNP
rs1005238238 3952 dbSNP
rs1343996146 3955 dbSNP
rs561378705 3956 dbSNP
rs1226265422 3958 dbSNP
rs141134616 3963 dbSNP
rs1302771837 3980 dbSNP
rs899035160 3981 dbSNP
rs1404967243 3987 dbSNP
rs1037919377 3988 dbSNP
rs185955653 3989 dbSNP
rs115324655 3998 dbSNP
rs568389381 3999 dbSNP
rs1235834251 4005 dbSNP
rs1256721992 4006 dbSNP
rs1397686096 4008 dbSNP
rs1167664195 4014 dbSNP
rs1199808674 4016 dbSNP
rs996961595 4017 dbSNP
rs746883528 4023 dbSNP
rs1190320802 4024 dbSNP
rs1267549960 4025 dbSNP
rs1041267803 4027 dbSNP
rs780042084 4028 dbSNP
rs933325788 4029 dbSNP
rs1428560226 4042 dbSNP
rs371396521 4052 dbSNP
rs1042930893 4053 dbSNP
rs1439437420 4053 dbSNP
rs1251010871 4055 dbSNP
rs35301021 4056 dbSNP
rs946732403 4059 dbSNP
rs537426583 4060 dbSNP
rs1219824101 4064 dbSNP
rs1298343230 4076 dbSNP
rs990869143 4077 dbSNP
rs1220133768 4078 dbSNP
rs1265664110 4082 dbSNP
rs1489222919 4084 dbSNP
rs1213985392 4094 dbSNP
rs1262259310 4097 dbSNP
rs938093873 4109 dbSNP
rs568873401 4110 dbSNP
rs369026272 4116 dbSNP
rs961541641 4117 dbSNP
rs1280755222 4123 dbSNP
rs868820983 4124 dbSNP
rs1426866547 4139 dbSNP
rs201977751 4139 dbSNP
rs925505120 4139 dbSNP
rs984335628 4143 dbSNP
rs1400942288 4145 dbSNP
rs952359148 4147 dbSNP
rs1227253687 4148 dbSNP
rs1377528724 4148 dbSNP
rs1312879628 4152 dbSNP
rs1027989301 4153 dbSNP
rs1360967677 4153 dbSNP
rs1237574358 4170 dbSNP
rs1328622016 4176 dbSNP
rs996641564 4178 dbSNP
rs758085672 4180 dbSNP
rs750254820 4182 dbSNP
rs969524200 4194 dbSNP
rs1025235313 4200 dbSNP
rs992379626 4202 dbSNP
rs1235676610 4203 dbSNP
rs1482919253 4206 dbSNP
rs959769397 4207 dbSNP
rs764685736 4216 dbSNP
rs1337597043 4218 dbSNP
rs1026395046 4222 dbSNP
rs1446495796 4224 dbSNP
rs146524851 4225 dbSNP
rs1161409439 4242 dbSNP
rs1161655724 4244 dbSNP
rs1471121792 4248 dbSNP
rs898895829 4248 dbSNP
rs1303915321 4259 dbSNP
rs1019468778 4270 dbSNP
rs1015935735 4273 dbSNP
rs374887801 4277 dbSNP
rs1225101313 4282 dbSNP
rs1276328246 4285 dbSNP
rs1311361555 4287 dbSNP
rs1210787310 4288 dbSNP
rs1264871785 4296 dbSNP
rs999113161 4299 dbSNP
rs1007365231 4308 dbSNP
rs902996392 4312 dbSNP
rs11757963 4316 dbSNP
rs1051638915 4318 dbSNP
rs947269139 4328 dbSNP
rs933231548 4330 dbSNP
rs1177469403 4331 dbSNP
rs892491360 4349 dbSNP
rs1463622774 4361 dbSNP
rs1330165611 4364 dbSNP
rs1244648821 4366 dbSNP
rs1443977336 4374 dbSNP
rs181948985 4382 dbSNP
rs529935130 4385 dbSNP
rs938131554 4389 dbSNP
rs1219546568 4400 dbSNP
rs775968052 4410 dbSNP
rs1260715162 4419 dbSNP
rs1285118555 4424 dbSNP
rs1197915644 4428 dbSNP
rs1257576337 4433 dbSNP
rs555991460 4436 dbSNP
rs1206329000 4440 dbSNP
rs1477904954 4440 dbSNP
rs1245165022 4454 dbSNP
rs1200529447 4456 dbSNP
rs1352112663 4456 dbSNP
rs1477166920 4457 dbSNP
rs936657626 4457 dbSNP
rs372249280 4458 dbSNP
rs756870759 4460 dbSNP
rs925379075 4464 dbSNP
rs1045135127 4465 dbSNP
rs1321209344 4467 dbSNP
rs1348869667 4470 dbSNP
rs948212203 4471 dbSNP
rs1237379159 4473 dbSNP
rs918084653 4475 dbSNP
rs992448282 4476 dbSNP
rs753553365 4492 dbSNP
rs557729445 4495 dbSNP
rs951696712 4502 dbSNP
rs561002711 4515 dbSNP
rs1452228597 4522 dbSNP
rs972151645 4523 dbSNP
rs940176711 4527 dbSNP
rs550893358 4534 dbSNP
rs539770748 4543 dbSNP
rs1223496123 4549 dbSNP
rs1271550896 4550 dbSNP
rs984412126 4553 dbSNP
rs1193604957 4554 dbSNP
rs1374095251 4557 dbSNP
rs766751163 4562 dbSNP
rs952931599 4564 dbSNP
rs1322658006 4567 dbSNP
rs1401344044 4575 dbSNP
rs1160889662 4578 dbSNP
rs920959633 4588 dbSNP
rs1385664100 4590 dbSNP
rs963052619 4598 dbSNP
rs1245543920 4601 dbSNP
rs79265769 4602 dbSNP
rs965051963 4604 dbSNP
rs1019796431 4605 dbSNP
rs1304546133 4605 dbSNP
rs1358439259 4625 dbSNP
rs1399125469 4634 dbSNP
rs998581956 4641 dbSNP
rs1328072969 4642 dbSNP
rs967188986 4645 dbSNP
rs142778673 4647 dbSNP
rs1355691564 4654 dbSNP
rs1247054920 4655 dbSNP
rs997471644 4667 dbSNP
rs1351998502 4668 dbSNP
rs774800787 4675 dbSNP
rs1263062244 4678 dbSNP
rs1240874103 4689 dbSNP
rs1186043771 4697 dbSNP
rs1194787777 4697 dbSNP
rs879655226 4698 dbSNP
rs1378030196 4701 dbSNP
rs1418883286 4705 dbSNP
rs867628633 4706 dbSNP
rs545888330 4707 dbSNP
rs894385749 4709 dbSNP
rs903824065 4715 dbSNP
rs1386867189 4723 dbSNP
rs148518366 4724 dbSNP
rs1333407956 4725 dbSNP
rs1203917222 4726 dbSNP
rs1453421135 4737 dbSNP
rs1317429793 4741 dbSNP
rs1362165785 4749 dbSNP
rs560237517 4768 dbSNP
rs1245625011 4771 dbSNP
rs766931569 4772 dbSNP
rs189282574 4775 dbSNP
rs1272140021 4786 dbSNP
rs34588683 4808 dbSNP
rs574729079 4811 dbSNP
rs1278475610 4823 dbSNP
rs376488656 4835 dbSNP
rs1184843687 4840 dbSNP
rs930130165 4845 dbSNP
rs940083445 4855 dbSNP
rs1182049096 4860 dbSNP
rs1316264328 4861 dbSNP
rs1365375269 4864 dbSNP
rs1464316483 4864 dbSNP
rs1171959658 4874 dbSNP
rs1470350570 4882 dbSNP
rs528184325 4882 dbSNP
rs1338845750 4884 dbSNP
rs1398192334 4885 dbSNP
rs1380464494 4886 dbSNP
rs1307949646 4888 dbSNP
rs1367308949 4894 dbSNP
rs1164040417 4903 dbSNP
rs908744717 4908 dbSNP
rs554953429 4909 dbSNP
rs1337923091 4917 dbSNP
rs1423766368 4923 dbSNP
rs1274792683 4924 dbSNP
rs1324960019 4925 dbSNP
rs144730994 4928 dbSNP
rs1456917056 4929 dbSNP
rs931576696 4929 dbSNP
rs1252183729 4932 dbSNP
rs1431236762 4933 dbSNP
rs575848730 4937 dbSNP
rs1241046247 4940 dbSNP
rs1168406592 4942 dbSNP
rs1481413761 4942 dbSNP
rs1398263100 4944 dbSNP
rs908874463 4950 dbSNP
rs1298991890 4957 dbSNP
rs773597493 4960 dbSNP
rs1385297330 4963 dbSNP
rs1398820904 4963 dbSNP
rs558484797 4965 dbSNP
rs1302996581 4971 dbSNP
rs1346507402 4975 dbSNP
rs1276808628 4977 dbSNP
rs138554874 4977 dbSNP
rs536078103 4980 dbSNP
rs1030009633 4987 dbSNP
rs1252712544 4995 dbSNP
rs149799268 4999 dbSNP
rs912193430 5005 dbSNP
rs9461333 5007 dbSNP
rs1269378011 5010 dbSNP
rs1031345192 5020 dbSNP
rs1275496129 5023 dbSNP
rs967095155 5026 dbSNP
rs1427998404 5033 dbSNP
rs903897688 5035 dbSNP
rs183963988 5050 dbSNP
rs1406834003 5051 dbSNP
rs1456620634 5052 dbSNP
rs1163149604 5053 dbSNP
rs1347394366 5058 dbSNP
rs1407109816 5064 dbSNP
rs568622522 5069 dbSNP
rs1011380710 5071 dbSNP
rs1361804476 5076 dbSNP
rs1383254238 5079 dbSNP
rs1404165119 5083 dbSNP
rs1297179028 5085 dbSNP
rs1319367285 5086 dbSNP
rs1347919558 5089 dbSNP
rs896583335 5095 dbSNP
rs958501148 5101 dbSNP
rs1410184470 5118 dbSNP
rs1214093409 5120 dbSNP
rs1262401248 5122 dbSNP
rs1486193219 5131 dbSNP
rs1188170679 5135 dbSNP
rs1418276514 5143 dbSNP
rs1165708204 5148 dbSNP
rs536434502 5152 dbSNP
rs1386024707 5153 dbSNP
rs547156786 5162 dbSNP
rs772486440 5167 dbSNP
rs1344967273 5171 dbSNP
rs1454796473 5172 dbSNP
rs1291117975 5174 dbSNP
rs1376369787 5187 dbSNP
rs906566750 5197 dbSNP
rs1451225168 5204 dbSNP
rs567501270 5206 dbSNP
rs1046385339 5209 dbSNP
rs1237503512 5214 dbSNP
rs1004327507 5218 dbSNP
rs1317269888 5222 dbSNP
rs985772858 5227 dbSNP
rs1254135720 5230 dbSNP
rs1460044498 5248 dbSNP
rs550506405 5252 dbSNP
rs192692170 5258 dbSNP
rs1243812661 5262 dbSNP
rs1205595428 5265 dbSNP
rs372247696 5266 dbSNP
rs1437519588 5276 dbSNP
rs1176965799 5282 dbSNP
rs1407772692 5288 dbSNP
rs1419994375 5288 dbSNP
rs1048485551 5289 dbSNP
rs879604691 5302 dbSNP
rs923028306 5305 dbSNP
rs565049413 5311 dbSNP
rs975824938 5314 dbSNP
rs1336882695 5325 dbSNP
rs762591133 5326 dbSNP
rs1225469845 5339 dbSNP
rs535120582 5340 dbSNP
rs1282674483 5344 dbSNP
rs1222864400 5348 dbSNP
rs1322812234 5350 dbSNP
rs1204212917 5353 dbSNP
rs1040363162 5354 dbSNP
rs1365326538 5355 dbSNP
rs1232476486 5356 dbSNP
rs1462690470 5356 dbSNP
rs1481167092 5356 dbSNP
rs944302645 5357 dbSNP
rs552126951 5358 dbSNP
rs967941522 5359 dbSNP
rs1233377319 5362 dbSNP
rs1480420374 5362 dbSNP
rs532401278 5367 dbSNP
rs1224097707 5368 dbSNP
rs1327775298 5368 dbSNP
rs1354699314 5368 dbSNP
rs1443909720 5368 dbSNP
rs1463571679 5368 dbSNP
rs372575502 5368 dbSNP
rs1285057398 5372 dbSNP
rs1012269863 5373 dbSNP
rs111766648 5373 dbSNP
rs2393916 5374 dbSNP
rs945825852 5377 dbSNP
rs189734362 5378 dbSNP
rs914334338 5379 dbSNP
rs3999105 5386 dbSNP
rs1206882832 5393 dbSNP
rs1431958411 5395 dbSNP
rs1267273742 5397 dbSNP
rs989823059 5413 dbSNP
rs1035521376 5434 dbSNP
rs540370216 5436 dbSNP
rs1034182257 5438 dbSNP
rs35779522 5441 dbSNP
rs1166872800 5447 dbSNP
rs1419610653 5451 dbSNP
rs1411341299 5455 dbSNP
rs897354879 5456 dbSNP
rs981799233 5465 dbSNP
rs1405283792 5500 dbSNP
rs1304882676 5503 dbSNP
rs574929268 5508 dbSNP
rs1231438523 5512 dbSNP
rs1205827241 5516 dbSNP
rs1429921457 5517 dbSNP
rs941503870 5526 dbSNP
rs1025418327 5528 dbSNP
rs1461915469 5533 dbSNP
rs1289813771 5536 dbSNP
rs570887719 5547 dbSNP
rs775164777 5559 dbSNP
rs544486306 5568 dbSNP
rs1193066513 5572 dbSNP
rs1445843707 5572 dbSNP
rs1049929942 5580 dbSNP
rs931658451 5582 dbSNP
rs1027081086 5585 dbSNP
rs1224170084 5589 dbSNP
rs1384145147 5591 dbSNP
rs138530889 5594 dbSNP
rs1425079901 5597 dbSNP
rs995552298 5599 dbSNP
rs1372316084 5601 dbSNP
rs1165301361 5615 dbSNP
rs1358385449 5617 dbSNP
rs1400084818 5620 dbSNP
rs1306758330 5640 dbSNP
rs3999104 5641 dbSNP
rs900040679 5644 dbSNP
rs976278433 5646 dbSNP
rs3999103 5649 dbSNP
rs1382387078 5650 dbSNP
rs935079335 5651 dbSNP
rs1294456667 5657 dbSNP
rs1348951079 5665 dbSNP
rs546811085 5690 dbSNP
rs944318261 5691 dbSNP
rs891362190 5693 dbSNP
rs559009714 5694 dbSNP
rs1041921020 5702 dbSNP
rs945721520 5723 dbSNP
rs1241971502 5726 dbSNP
rs923797563 5728 dbSNP
rs1185018245 5733 dbSNP
rs979270802 5737 dbSNP
rs1464098612 5745 dbSNP
rs867078167 5756 dbSNP
rs552530243 5766 dbSNP
rs1386978344 5775 dbSNP
rs1160436207 5777 dbSNP
rs1334877247 5778 dbSNP
rs1405408088 5784 dbSNP
rs377140229 5785 dbSNP
rs1317359950 5787 dbSNP
rs1334381875 5795 dbSNP
rs530780115 5805 dbSNP
rs1378892966 5812 dbSNP
rs1185744542 5835 dbSNP
rs937099028 5838 dbSNP
rs1222215527 5844 dbSNP
rs1445486916 5849 dbSNP
rs150916187 5861 dbSNP
rs981279613 5866 dbSNP
rs1247898987 5873 dbSNP
rs1437032538 5889 dbSNP
rs1181898115 5890 dbSNP
rs1182330559 5893 dbSNP
rs1365323182 5895 dbSNP
rs990699932 5900 dbSNP
rs1470319522 5901 dbSNP
rs367970256 5902 dbSNP
rs1394525767 5904 dbSNP
rs201464937 5904 dbSNP
rs375430049 5904 dbSNP
rs1330048857 5906 dbSNP
rs778711752 5906 dbSNP
rs1262474010 5910 dbSNP
rs971613547 5917 dbSNP
rs1216437594 5918 dbSNP
rs960731176 5919 dbSNP
rs1283161303 5920 dbSNP
rs1014863346 5921 dbSNP
rs1316200912 5923 dbSNP
rs371730842 5923 dbSNP
rs1323631573 5934 dbSNP
rs1224755965 5941 dbSNP
rs1283638436 5951 dbSNP
rs1249102569 5953 dbSNP
rs1035024798 5956 dbSNP
rs983334946 5965 dbSNP
rs951363220 5968