miRTarBase - #MIRT051333 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BRWD1   
Synonyms C21orf107, DCAF19, N143, WDR9
Description bromodomain and WD repeat domain containing 1
Transcript NM_033656   
Other Transcripts NM_018963 , NM_001007246   
Expression
Putative miRNA Targets on BRWD1
3'UTR of BRWD1
(miRNA target sites are highlighted)
>BRWD1|NM_033656|3'UTR
   1 CCTTGAGGGAAAGCCAGTTCATTTAAGAGGAAATGGACTGGCATTTATGGTGAAAGCTGGCTGTTAAAATTATTTTTTTG
  81 TCTTACAATTCAGGGAATATATTTATATTTTTCTATGAAAAGTTATGAATGTGACTAAATCATGACTGTTATTTTTATTT
 161 GCACTTGCTGGTCTTTGTAGCAGCATTCAGCACAGGTGCCAAAATATGCTTCATTTTGGGGGCAGATCTATTTTGACAGT
 241 ATTTGACTACATATAGCAAGAGTTTGAAATATGTTAAACACTAGACATCCTGGTTATCAAAACCAATGAGCATTACTTTC
 321 ATGGCAGCAAGTGTCATGCAGTTATTTTCTGAATTTGTCAAAGAGGCAGTAGTTTCTAACCCCTGTTCTATAGTAGTTAC
 401 AACAATTTCACAACCTATGTTTACAGATTCTTCATAAATACATGCATACTGACACTATAATCATGGGAGGTGTAACCATG
 481 ATTAGTAGGCGAGGTACCTACCACTTTTTTTTTTTTCTTCCCCTGGCTACTTGAGTAGAATGCATTATACCAGATCTGGT
 561 CACTTTCATTGAAATGGTTTCTAATTTTCTTCCCAAGTGCTGTTGGGTTTTTTTCTTCTTAAGGAAAACGTTGTCACTTT
 641 TATGTTATAAACTTGAATTTATAAAGTGCTGGTAAATTATTTTTAATGATTTGAGTGCATGTTTTAAACCTCTAGGACCA
 721 GAGCATAGTCAGAGCATTTTCTTTTAAATTGTGCACTAACAAAATGCTATATAATCTGTCTTCTGTCCAAGATCTCCTGG
 801 TTTCCATTGTAAGGGATTTAACCAAAATCTTGCTCTTCCATAATCTTACTCTGTGAAATAGAGGAATTCGTGTGCCTTAG
 881 ATTTAGAAGTGTGTTCTTTAATAGAGTGTACAGGGCTAAAAGAGTATTTAAGTTAATATGTAGGTTTCCCCCATCTGTAT
 961 TCCAATTGTAGAGGTGAGTTTTGTTAAGAGTACAATTGCAAATCTTATCTATATAGGAAAATAGCTAAATGTCATTCTCC
1041 ATCTCTTTGTTTTAGTTTACTGCTTCCATGTGCAATCCTAAGCATTCTTTGCTGGGGCAACTAAATGTATCTTTATTAGT
1121 GACTTCTAGTCCAAATATAAGAAACTGTCATGTTTTGTGGGAAAATAATTTTATAATCCATTTAAAGTGAAAGTTTATCA
1201 CACAAATAGTACACTTATTTTCTAACCAAATACTTGATAGGTTATGCTACTCCAGTGTAGATGGCCATTCCTAACTTGTT
1281 TGTGCCTGAAGATGGACTTGATTCAAATGGTTTACATATTTAGTGGGTAAGGGATATGTTACAGTACCCCACCTGTAAGT
1361 TATTTATTAGCCCTAATTGTGTTTGATTTCAGACAAAATTAACCCTTTTCTCCTGTGTATCTTTGAAGTGGCAGATAAGG
1441 TGAAGCATCAGACTGGTATCAATATTAGACAATGTTATTTATTAGCCCTAATTGTGTTTGGTTTCAGACAAAACCTTTTC
1521 TCCTGTGTATCTTTGAAGTGGCAGACAAGGCGAAGCATCAGACTGGTATTAATGTTAGAGAATGTTCTGAAGTGTTCCTA
1601 TTTTGTAGTTATCTATTCCATTTGACATAGTAGAAGGTACATTTTCTTTCTACTCTGATGCATGGGGAAGGATGTTTTTG
1681 GACATTATCAACTGAGATAGGTGGGAAACCTCCTCTCATTTGTGGCTTAGAGAGCTATCACCATTTCAGAACTATGATGC
1761 TTTTCTTCTCAGAACTTGTGTTAAGTAGATAGTAAACAGATTGATTCATGATAATTGTCCTTGACTAAGACTGAAAAGAC
1841 TAATGGGATGCCTTTTACTTTGCTAATTTTAAAAACTGGTGATAGATGTCAAATCCATTAATTTATTTAAACTCTTCTTA
1921 ACCTTCTCTTTTATAATCTGTTCTCAGGTTTTAACTCCATGTTTACCATCATTTGCAAAAAGGTACCAAAAAAATCCATA
2001 AATAAATATGGAATACATTCATAAGTACATACATTCTTTTGGTATAAAACAATATTTTGACAGTTTAGGCTTCATTAATA
2081 GAACTATTCTGATTATTTGGACTGCATTAATTGGTCATTGACTGGCCATCCAATTACCATTTTTTCTTTCAGTCCAAAAT
2161 AGTTAGACCCTTGCATACAGAAGTGGTATTTTGGTTTTTAATCAGATTTGGTTTCATCAGAAGCAGCAAGAATGGACCTG
2241 ATGTCTTTAAAAGCATAGCCGACAATGGTAGCTTCTCAAGTTATGAAATAAAACTGAGAGATAATGGAGAAAATAATTTT
2321 TATGGGTTTTTTTGGTTATGGTGCTATTCCTAAGGTTAACTTTGAATATGTGACACACACACTCCTAAGTACCTTTAAGG
2401 AAAATTAATAAATCATTAATAGTTAAAATGTTTACATTGAGCACTAGAACATGTTTGGCCTTTTTTTTCTACGTTATGCA
2481 AAATGCCCAGGGATTTAATGCACAGGTGTACTTTAATGTTTAGGGTCAGTTTGTAGTATTCTTGAGAAAAAGATAAAGGG
2561 TTATAATTTGAATGTGAACTGATCCAGAAATAAGTGCTGTACCTTTCCACTGCACTTGAAGTTCAACTTAATGGTGTATG
2641 TGAAAAACAAAAACTACTTTGGTTGTGTATGTCCAAAGTCCTATGGTTTTATTCATTTATGGTTTTACAGGCTTTGAAGT
2721 ACTCAGATTTGATTTTTGCTTTCTTGGAAAGACTCACTTTACCAAGCATATAAAGGAAAAATGATTTCAAACATTGACAA
2801 GATAGATGAGTGTTAACAAAGCTTTCTTTTTTCGTGTCCTCCTTATTTAAAAAGGTATACTTACAATGTGAAGTAACTTA
2881 TGAATAAAAGGAAAAGTTTATCCCATATTCAAATAATTCCTAAGGTCAGCCTCCCTTTTTGTAAGTGGCAAATATCTGAT
2961 TAAATCATTTCTCAGTTTATTAATCCTTGGAAACAATGATATAGCAGTTACTCACAGCTTGTAAATTACAACAGAAAGGT
3041 TCCTTTCAAATAGTAGAGCTGCACCTAAAGAGGAAATTGGGTTTATAAGAAAATGGAGGCAAAGAACTTAAGTTTTAAGA
3121 AAAAGCACTTCAAAACAGAAGGGCAAATGGAAAAGGGGAATATAAAACAAACCAATAAAAATACCATCTGAGGGTGTTAC
3201 TGTCCAAAAGTAAAGAATAAGATGCATCACTAAGCCCTTTGCACTCGTTATGACCTCGTAAGTAAAAATTATCACTTAGA
3281 ATAAGGGGTGCACACTACATTCCCTCTGTCTTCTAGACTTTTTTTTTTGTAGAAGAATCAGAAAACAATTTACTAACCTC
3361 CCTGTTTGATATTAAAAATAGGAAGAATTTTAATATTTTCTGTTAGTACAAGTTGAACTTGATTGTGCCAACTGAAACCC
3441 CAGAGGTTTGTATATCAGTAGAATGCAAGAACATTGTTAAAGGTGCTTACGATCTTTTTTGTTTTCCTTTCCACTCCATT
3521 GTATCAATTTTTTGAGTAACTTTTAAATGGCTAGAAAATGGTCTTTTTGCTTTGCCCTTTTAAAGCTGAAATAACCAGCT
3601 CCATTCTTTTCATGAATAGTAAGTTGATATATTTATTTATCAGGTATCTTGCAGTTGTCACCAAATACTGTAGTTTTCTT
3681 ATGTTGTATGGAAATTATAGTTCAATTATTTTAATGTGATAGAGTGCAACAAGTCATTGTAGAACTTTTCACCTGTTAAT
3761 GTTGAAGTTATACCTCTGAATTTCTGCTGTGGATATCAAGGAAATAATAAAGCAGAAACCCCAAGAAATTTGCAACTTAA
3841 CAGTTTGAGACTGTCTCTTATCCTAGTATTTGGGAAGAGAAGGAATAAATTTGTCAAAACTAGGTGAGAAAATAGAGCAT
3921 TGTGGGAAAAACTGAGTCCAACTAGATTAGCAAATGTTAATTCCTAGCTCAAACTGTGAATAGTAAGGATTGAAAAGTAA
4001 AGTATGTAATGCTAAGGGCTGTGTTGTCTTTTCTTACGATTTTAAGTTTTAAAGGCTGTTAAATTACAGAGATGTTGCCC
4081 AAGGATACATGGGGATTCTCAAAAGTAAGAGATTTTTACCTTTTTCATAATCTGCCAAGCTGGTTCCTAATATATTGTTA
4161 AATTGGTAGAAAAATATCTTTAAATTGGTGTCTGCTCAAGAATTGCTTTTCTAGATTTGATGGAGGGAGGGGGAGAGTCA
4241 CATCATTTGGATTCTACCAATCTGCAGGCTCTATCTTTGGCAACATGTAAATAATTAGACTATACATCTGTTTCTCAAGT
4321 ATGGCAAGACCAATAGTTTGAATTTAATTATCAATGCTATGGTATACTTTCTGGTCATATTTTAGTTATGTCAGTTTTAA
4401 GGTAAGTTTTTTCATTTATTAAAGCCCTTAAATGAGATTTTAGACTGCCAAAGAGAAGAGGCAGTCCAATTGACCTAACT
4481 GAAATGAGATGACCAGTATATAGAGCCTAGATGGACTGTAGCAGCTCTACCCCTTTGTTTTACAAGGTAAATCATTTTAA
4561 AAATTACCTTTTTTGATCAGTGGGTAAAAGTTAAAGGGATCTTTAATTTTTGATATATTCAAGTTAATTTTCTAAATGTG
4641 AATCAGTCCTTGGACTGCAACTATATATTCACCTACAAAATCCCAATCAAAAAATTACATGAGCCTGTCAAGCAGATCTT
4721 TAGTTTTCCACTTCACATAAGATCGTTAATGTTCTAAATTAATCTATTCATTTAGATGATTTTTGTCAGTTCTTAAATGG
4801 GATATAATAAATTTAGCATTTTCATCTTAACAAGCAAAAGAGTTAAAAAACAAAACAAAACACTACTCCAAGCCAAATAC
4881 ATTCTAGCTGGTTAATTCCAGACTTGTCCCAAGTGGTTCCCCAACCTCTTTTCCACTGGTAATTTCTTTTCATGCAGGCA
4961 GAATATAGGGGTGCGAGCGCTGTGAGTTTTACATATGAGCTTGGATAGGGGAACTGAAGCGAGTCAGGAGCCCTGCTGGA
5041 AAAGGGGTTTGCCATTGGATTGTCTGTGGCCTGGTTTCTTTCCAGTAGTACAGTAATAGGGTAGATTGAAAACAAGTATT
5121 TACTTCTGATTCTGCCTGCATTTAGTGTGAAATGCTCTTAAGGTATTGCTTCTAAAAAGCAAATTAAGCAGTTAAGTATA
5201 AAGTCCCTGAATTCATATTTCAAAATAAGGCTTTTATGAGATTTTTATTAAAAATTGCAATAGCCATCACAAATCTGAGT
5281 TTTTCTAGGGGTGAGAGAAAACTGTATTGTGATGAGCTAGATTAGTTGTAGTTCCAGAATAAGAACAAAAATTCAGAGTT
5361 GTGTGGTGCCCATCATTGAGTAAATGAACCCTAAAAATGAATAAGCTAATGAACTAGTTCATGGAATTATTTCTGATGGT
5441 CTTTTGACCTGATGCTGCCATACTGCAGTGTTACCAGCTCCCCCTAGAAAACGGAACTGTTTAAAAACACAGCAAGTTAC
5521 AGAAACCATTTTATTCTACAGCCATTGGGGTACTTCAGTTTATGGGATGTTTTTGGAAACTTCTGCTTTGGGAGGGATGA
5601 AGATCATTGATAAATGTTATTTGCTTTCTGAGTTTTGGGGTCATTTCATTGCTTATCAATGAAGGGCAGACAGAGGAGAG
5681 AATATCTCAAGTCTTTTCTGATAAAAGGCTTGCTTGAGGGAGCTTATAACTTGCACCTAGAGGGTTTACCCACTTTGTGG
5761 ATTTGATTTATCCACCAACCACAGCAACCAATAATGTCAAGATTCTAGGAGTTTATGAAAGAGGCTAGTATGTTTTCATT
5841 TTGAGTCAGACATTCTTTTCTCATTCTCAAATCTGTTTTAAATGCTCCAATTTTAAAAATGCCAATGAAAATTTTATAAT
5921 GCTTCTGTAGTAACCATATGCAGTTTACTTTGAATTTAGGAAAACAGTTTTGTATGATGAAATATTGTGCAGAATCTGTA
6001 AATAAGGTAGCTTAAAAATTAAAAAAAAGTCTAATTAGAATATGATTAATCCTTGAAATGTAGAAACTAGAGATTGTGTT
6081 GAGTCAGAACTGTTATGTTTGTATCCAGGTTTCTATTCACCACATATACCATCTTAGAATACACACATATCTGTGAGTTA
6161 TAATTTAAAGTGGTCATCCAGGGAAATGATCATGGAGTGCTACTACAGATGTACAGTTTTACACTACTGATGTGTTCTTG
6241 CCATACCCAAGTAGGGAATCACTTCCAGGAAAACAAGTCCTCAAGCACTCAATGACTTTGTAAACCCATGACTGAAACAA
6321 GACTCATCTGAGGCAGTAGGACTGGTGGGATTCTACTGACTTCTTAGTATCACATGGCACCATCACAAATGCATTGTTAG
6401 AGCAGCAACATCCAGAGTTCTTAAGCTTGTACCCTAACACACAAATTTGACTTCTAACCCTGAAATATCCTATATATATT
6481 TCTAAAACTGTTTGTAGTTTTCTTGAGAAAAAGCACTTTATAATTTACTCAGTTTTCAGTAATAAAATTAACACTGACTT
6561 GAATGTATTTAAAAAAATTCTCCACAGTTTTGTCTTCCTCAGATTGTTTTTATCCTTATTCTCTGAAATTCCTGTTTTAT
6641 TGTCTAAGACTTAAGAGATTCAGCTTTATCAAGTTAGAGTACAGTGTAATTCAAATTCTCCCTCCCTTGGGCATAGTTAC
6721 TGAAGTTCAAATTTCCTTAAGTATTTTTTAAAAACCTGATTTTAGTTTTTTTTTTCCTGCAGAATCTTAACTTTTCCATT
6801 ATTCTGGATGACAAATAAACATTTATTAAAATGTGTTAGAATTAGTATTTACTAGGTTCCTAAATTGTCAGTATAGGTAC
6881 TTTGATCACACATCAAAATGGAATTTCTGCAACTTAAAGCATTTTGTTACAAATTGTAGTTGAAATAGAATTTTATCTAT
6961 TTGTCTGGATGAATAGGTTGTTGGGAATGAACCAGTTATCTGTTCTTTTCTTCCAAATGCAAATGGTGCAGCTAGTTGAT
7041 AATAGTATATTCTCATCCTACTATAAAGTGCAAATTTCACCTTAATTTTGCATATTTTAAAATTTTTGTTTACCCTTTGT
7121 AGCATATTTACATTTTAGCATTTGCTAACATTGATTTAATGTGTTAAAGATTCATTTTGGATATAGGGTTGACTTGTTGG
7201 AGATACTAGTTCATAATTTTAAAATTCCCAAGAGAAGTGTCTTTGAAGTGGTAAACACAGTGCACTTTAAGCCACTTCTC
7281 TTCCCACAGAGTCCAGCTGAAGGAGGTAAGGGCATGCTGCATGAGAGTAATGCCGTGATGAGTGTCTTACTCTGGTAAAA
7361 TGCCATTTACAATGCCTGGAGACTGAACACTGAACAAAACATAGTGCCCTTAGAATTTCACTGGAAAAACATGTGAATCA
7441 CATAAGTTAGTTGGCAAAAGGAACTGATGTGTATGTGGTGGGGTTGCTTTGAATAAAGTATTTCCTAACCTATTCTGGGG
7521 AGAACGCTCAACTGATCTTAGAGAAGTGTGAAATCAGTTTCATAGACTTAGGGAAAAATCTGAAGTGCTTGCACTGTGAG
7601 GGCAGAGGCCTGCCTCATTAGTCTAGCTGTATGAACATGTCAGTCCACAGAAGCAGTTTTTACCTGTACTCATCTGCCCT
7681 TCAGTCAGCTTTGTGACAGAAGGGCAAACATCTTCACAGAAGAAAAAGTTCAGAAGGTTGGCATTGGTGGTTTCATTGCT
7761 ACAGAATAATAGTGTTACTTGATAGTATCTGACTAAAAGAGCTCTCATTTTCTAGTACTTAGTAGTAAAAAGAATGTGGT
7841 GGAGTCCTCCAGATGTCTAGTGTGGGTGGAGGATATCAACTGGTTATTTCAGTGATCTACAGCCTTACCTTTTGAATGCT
7921 AAATGTCTGGAAACTTCAGGCAGGGTCCTACAAAACAAACTGCCATCAAGATTGGTGTGTACCATGAAGGCAGTTTTAGA
8001 TAGTTTGACTGTTCATGGCTGCAAGAAAGACCTAAAATTCAAGGGCCCGTGAACTTCAGATACGTAAAAGGAATATCACT
8081 TCTGTTCTAGAAGAGTACTAATTAGACTTGTTTGTGAAATTTGAAAATTTGGCTTTGAGACACTGGTAACAAACATATCT
8161 GAGCCCTCCTAAGTTTGGTCAGCACGGAGTAGTAGCTCTGGCATCATGTGGCTGTGTAGAGCTCCAGTGTGATTTCAAGC
8241 CCCCTCTAAAAACTGCCTTAGTCTGCATGAAGTAGTTAACTCTCCAAAGTGCTTTTTGTCTGGCAAATCCCTTCACAATT
8321 TTCACCTCTCGTCTAAAAGCTTCCTTAAAGGAAGCCTTCCTTGATCCCTTAGGCTAGGTTAGGTTTCCAGTCTGTGTTCT
8401 CATAGCACTCTGCACTTTTTGGTTCCTTAAAGCAACTCTGTGTTATTTTTTAGAATTTTAATCTGAATCTCGTGTGTCAC
8481 ATACCTAGGTCAGAAAATACTGGAACAATGAAGTTAAGATTTAGTAATTCAAATTATGTAAAATGCTCATATATATGTTT
8561 TTAGATTAGCAGCTTTATGATGCCGATGCTGAAGGAACTTTTCACCCCATTCTTACAAGTCTGCTACTGTTTTAAGTGAC
8641 ATCCTTATAGTTGTAGATAAGCAAATGTAAGGTTATATCAATGTGAAGAAGCCCTTAGTATCACATTTTAAAATTTATCA
8721 TTTAGCAATATGACTTTTAAATTTATTGTTTCCGAATGAGTGTTGTTGAGGAATGTTAGCAGTAGTAAAATCTTGTGTTA
8801 CAAGATTTTTGCATTTACATGAACTTTCACTCATTTTTCAGAATTTGTTCCTAGAGACAGAGAACCCAATACAAAAGTGA
8881 GAACATGTATGCATAATCAGAAGGATGCAGTGCAGATGCCTAGTGAAACTCTGAAAGCAAAAATGGTACCTGAGAAAGTT
8961 CCCCGCAGATGTGCTACTGTTGCTGCAAATAAAATAAAGATAATGAGTAATCTAAAAGAAACGATCTCAGGACCAGAAAA
9041 TGTCTGGATTAGGAAGAGTAGCAGAAAACTGCCCCATCGAAATGCTTCTGCTGCGGCTAAGAAAAAATTACTGAATGTTT
9121 ATAAAGAGGATGATACAACCATAAATTCTGAAAGTGAAAAAGAGCTAGAAGATATTAATAGAAAAATGCTTTTTTTAAGG
9201 GGGTTCAGATCCTGGAAAGAAAATGCACAATAGTGACTATGAGAATGTAGAAGTGGCATCTGAAAACAATTGGTACACAA
9281 GTAAACTGGCAGTTACATTCTGCTCCCAGCTCTAAAATTACTCCCTTATTGGCATCTTTGGAGGAATTTTCTAAAAGCCA
9361 TAATCCAGTGGGTTCCTCCCAGTCAGCTCTTGTACAGACATGTGCTCTGGGGAATTCTGAGGAGGAAATAAATTGCAGAG
9441 TCTGTAGGTGGAGAGGTGGAAAGAAAAGACAAATGGCCTGCTATAAGACTACTATTCCTTTCCAGAATGCAAGGCCTTGA
9521 AGACATGATTCCTTAGAGGAAGAATATAATGGGAAGTGTACAGGCTAGGAAGAACTTGAAGTGAACAAATTTCAAAATCT
9601 TAACCTGATGCTAATTTTCAGGGTTCTCCATTACAGTGTAAAAATTCAGACCACGACAACTATGGTGTCATGAGGAAAAA
9681 AAATCAGGCATTTTTCCAAAGGAAGTGCTAATGGGCCTATTTGACTTCTGAGTGAAGCAAAAACTACCCAGATCCATTCC
9761 CTACAATTCACATCCCCAAAGGTCAAAAACAAACTAGGAGGACCTGGGAATTTCAGCTGGAGATACTGATTATTGAGTTC
9841 TGAAGTAGAGTGTTGGAAATAGGCAATTAGAGAAAGTCCATTGATGTCATTTTGTTTATAATATTGCAGTTCATACTGAA
9921 TGACCACTTGATATGACTAATTCAGGGAATATATATTTTTCTATGAAAGCTATGAATGTTACTATCACGGCTTTTCCTTA
10001 TTTTTACTTGTATGTAGCAGCATTTACAGAAATGCCAAAAATGTGCCTCATTAAGAGGCAGGTCTTAATCAGTTAGATAA
10081 AAATAAAATGTATAGCTTAAGATCAAAACAGTCATATTTTTAGATACAGTGAAATCTTTTATGTTTCTCTACAGCACCTT
10161 AAAAATTAGAACTTGAATACTTTGAGTAAACTTACTACAATCTCATCCCAACAAACTTTAATGGTAGCATGTTTGGCCTA
10241 TTTCATTGTGGCCTGTACTAGGATTAGAAAATTTGGTCGTGGTATAACAAAGAAGTGTATTTACAATAGGATTTAATTTG
10321 TTGTTAATATGTATTTGTTGAAATTAAAATTGCCAGATTAAATGAATATACTGTCGCATCTTTTTAACATAGTAACGTGT
10401 TACTGGAAAAATTAAGTTGTTGAAAGTAAGTTGTTTTCCCATTTAAAAATATCTGAATATATGATTTGCATGTGTAAATC
10481 TGAAAAACTAAACTACAGAAACCTAGGGTTTTCTATTTCTTTTTTAAGTCAAATGCATTTTTTTTTTTTTGTTATACAGA
10561 TGAACCAAGTGTCTAAAATACTTGAGAAATTTGTGGTTGCATGTCTGTTTTAAAAAAAAGGCTTTTTGTTTTTTAGCATA
10641 AGCCAGAATATTCTAACCTACTAAGTCTGTGTCCTTTGCTCCTTTTGTAGTATACTTTCATCTAAATTACTGATCCCCAA
10721 TATGTTGATACACAGGTGAGAAAGGGAAGAATTCCTAATAAACTGCTATTACTTTTAGGTGAAAAAAAAAAAAAAAAAAA
10801 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUU----GGUAAUACACGACGau 5'
            ||:|    |:| |:| ||||||  
Target 5' cgCAGATGTGCTACTGT-TGCTGCaa 3'
8964 - 8988 133.00 -12.74
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            |:|| :: | | ||||||  
Target 5' atCGAAATGCT-TCTGCTGCgg 3'
9076 - 9096 131.00 -9.40
3
miRNA  3' guguuugguaaUACACGACGAu 5'
                     | ||||||:| 
Target 5' attttcttcccAAGTGCTGTTg 3'
584 - 605 131.00 -12.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31482754 5 COSMIC
COSN30149781 69 COSMIC
COSN30108400 93 COSMIC
COSN31605601 113 COSMIC
COSN8611721 161 COSMIC
COSN23604381 167 COSMIC
COSN31549869 181 COSMIC
COSN28797047 469 COSMIC
COSN20116972 505 COSMIC
COSN9158690 546 COSMIC
COSN31537090 638 COSMIC
COSN31595715 679 COSMIC
COSN7146082 681 COSMIC
COSN28648118 833 COSMIC
COSN27032786 1028 COSMIC
COSN27029350 1029 COSMIC
COSN31481883 1045 COSMIC
COSN20876015 1063 COSMIC
COSN26688579 1222 COSMIC
COSN26690575 1286 COSMIC
COSN26687239 1304 COSMIC
COSN26636636 1470 COSMIC
COSN30542906 1520 COSMIC
COSN16887530 1717 COSMIC
COSN31556812 2326 COSMIC
COSN24307290 2405 COSMIC
COSN31527475 2427 COSMIC
COSN31597232 2460 COSMIC
COSN31539961 2491 COSMIC
COSN30176179 2552 COSMIC
COSN27750242 2563 COSMIC
COSN30543794 2590 COSMIC
COSN31490086 2601 COSMIC
COSN15661257 2640 COSMIC
COSN23116005 2640 COSMIC
COSN17038351 3208 COSMIC
COSN28291017 3318 COSMIC
COSN20116967 3319 COSMIC
COSN21093278 3339 COSMIC
COSN20116965 3375 COSMIC
COSN1892655 3673 COSMIC
COSN20116964 3869 COSMIC
COSN20116959 3992 COSMIC
COSN27993836 4012 COSMIC
COSN16777084 4112 COSMIC
COSN25721785 4153 COSMIC
COSN1892654 4350 COSMIC
COSN5986842 4350 COSMIC
COSN17289550 4481 COSMIC
COSN2503683 4880 COSMIC
COSN2503682 4881 COSMIC
COSN1256655 5401 COSMIC
COSN24551801 5642 COSMIC
COSN20116954 6020 COSMIC
COSN6690431 6048 COSMIC
COSN5453238 6310 COSMIC
COSN9158689 6403 COSMIC
COSN22145194 6416 COSMIC
COSN6690430 6476 COSMIC
COSN29403153 6574 COSMIC
COSN5986841 6602 COSMIC
COSN10026626 6627 COSMIC
COSN5986840 6636 COSMIC
COSN5986839 6651 COSMIC
COSN18918844 6700 COSMIC
COSN1892653 6828 COSMIC
COSN20156523 7156 COSMIC
COSN16760085 8543 COSMIC
COSN10026625 8629 COSMIC
COSN24393871 8733 COSMIC
COSN19705079 8807 COSMIC
COSN24385463 8828 COSMIC
COSM478581 8847 COSMIC
COSM4977706 8847 COSMIC
COSM4666245 8861 COSMIC
COSM4972627 8862 COSMIC
COSM4666244 8885 COSMIC
COSM6161314 8893 COSMIC
COSM4666243 8898 COSMIC
COSM4621105 8915 COSMIC
COSM1030656 8948 COSMIC
COSM9335770 8973 COSMIC
COSM7163737 8980 COSMIC
COSM4582076 8981 COSMIC
COSM1030655 8982 COSMIC
COSM6055915 8989 COSMIC
COSM8545619 8992 COSMIC
COSM4666242 9013 COSMIC
COSM1030654 9018 COSMIC
COSM6198419 9023 COSMIC
COSM6161315 9028 COSMIC
COSM9887208 9031 COSMIC
COSM4666241 9036 COSMIC
COSM159421 9056 COSMIC
COSM9335769 9062 COSMIC
COSM1414080 9071 COSMIC
COSM8382956 9078 COSMIC
COSM1030653 9079 COSMIC
COSM9564969 9087 COSMIC
COSM259673 9088 COSMIC
COSM725160 9088 COSMIC
COSM9611553 9088 COSMIC
COSM5207471 9101 COSMIC
COSM9255246 9101 COSMIC
COSM9271205 9112 COSMIC
COSM9548516 9129 COSMIC
COSM1030652 9130 COSMIC
COSM4101583 9132 COSMIC
COSM419230 9148 COSMIC
COSM7096007 9150 COSMIC
COSM8685032 9151 COSMIC
COSM8174814 9156 COSMIC
COSM4666240 9157 COSMIC
COSM7215171 9167 COSMIC
COSM6394944 9188 COSMIC
COSM8971375 9189 COSMIC
COSM1180926 9190 COSMIC
COSM2818073 9196 COSMIC
COSM8416640 9197 COSMIC
COSM725161 9214 COSMIC
COSM8307471 9224 COSMIC
COSN30150418 9238 COSMIC
COSN30177624 9240 COSMIC
COSN26648371 9282 COSMIC
COSN30524882 9317 COSMIC
COSN31535432 9325 COSMIC
COSN31574280 9332 COSMIC
COSN30103671 9343 COSMIC
COSN30126415 9410 COSMIC
COSN27391125 9416 COSMIC
COSN17454781 9447 COSMIC
COSN26452465 9460 COSMIC
COSN20116948 9577 COSMIC
COSN20694547 10238 COSMIC
COSN5986838 10308 COSMIC
COSN20116936 10538 COSMIC
COSN20116930 10715 COSMIC
COSN20116924 10743 COSMIC
rs1910358 x rs998159 7507 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1461408755 2 dbSNP
rs527292833 3 dbSNP
rs772059099 5 dbSNP
rs943051359 8 dbSNP
rs1475442159 13 dbSNP
rs146641835 20 dbSNP
rs1308438525 22 dbSNP
rs774316966 23 dbSNP
rs770962831 26 dbSNP
rs749344817 34 dbSNP
rs1179128363 36 dbSNP
rs773185386 38 dbSNP
rs1456797353 41 dbSNP
rs1466062905 44 dbSNP
rs1046927315 48 dbSNP
rs1275650766 49 dbSNP
rs989924691 56 dbSNP
rs1383535373 62 dbSNP
rs957180672 73 dbSNP
rs200004870 80 dbSNP
rs973802947 80 dbSNP
rs1312736082 87 dbSNP
rs1238296323 99 dbSNP
rs571100522 101 dbSNP
rs1353011454 102 dbSNP
rs1236025978 105 dbSNP
rs1442952327 109 dbSNP
rs1268453263 111 dbSNP
rs1489945697 113 dbSNP
rs1202073541 114 dbSNP
rs1031478257 119 dbSNP
rs111597637 126 dbSNP
rs1157617884 135 dbSNP
rs745643845 140 dbSNP
rs1361546055 148 dbSNP
rs778917967 149 dbSNP
rs760309753 150 dbSNP
rs1158801483 152 dbSNP
rs926999451 176 dbSNP
rs1422461199 177 dbSNP
rs1304702028 178 dbSNP
rs1368104343 182 dbSNP
rs757315802 193 dbSNP
rs971704797 205 dbSNP
rs144491241 206 dbSNP
rs1240984732 207 dbSNP
rs1379361497 207 dbSNP
rs1024648488 216 dbSNP
rs1291252787 235 dbSNP
rs989037938 235 dbSNP
rs1012860756 237 dbSNP
rs1329431110 239 dbSNP
rs531398039 254 dbSNP
rs1480543812 256 dbSNP
rs1175983931 267 dbSNP
rs1253288412 272 dbSNP
rs562367888 284 dbSNP
rs894518254 289 dbSNP
rs1178736636 296 dbSNP
rs1384175986 303 dbSNP
rs1016955279 304 dbSNP
rs1442373115 306 dbSNP
rs1005620351 312 dbSNP
rs1413253008 330 dbSNP
rs887203036 333 dbSNP
rs1461298724 343 dbSNP
rs756938990 348 dbSNP
rs1296322125 376 dbSNP
rs542539744 376 dbSNP
rs867093082 380 dbSNP
rs964771889 381 dbSNP
rs146933378 385 dbSNP
rs1009306186 388 dbSNP
rs186070710 390 dbSNP
rs1177476843 397 dbSNP
rs560212812 398 dbSNP
rs1253545802 405 dbSNP
rs1047427189 408 dbSNP
rs1472800827 412 dbSNP
rs552604161 417 dbSNP
rs1241975633 423 dbSNP
rs1442315276 424 dbSNP
rs1208011211 434 dbSNP
rs368560058 434 dbSNP
rs1427654224 438 dbSNP
rs1168099796 439 dbSNP
rs1374627551 455 dbSNP
rs1466053562 457 dbSNP
rs780364705 463 dbSNP
rs748993353 467 dbSNP
rs1454649359 468 dbSNP
rs1065242 469 dbSNP
rs989830029 470 dbSNP
rs529557561 479 dbSNP
rs1213135426 484 dbSNP
rs1298143288 490 dbSNP
rs1045438108 491 dbSNP
rs1356152013 500 dbSNP
rs1261821437 502 dbSNP
rs34068682 503 dbSNP
rs1459548593 504 dbSNP
rs1211651477 506 dbSNP
rs190665106 515 dbSNP
rs1223299571 516 dbSNP
rs1485324440 517 dbSNP
rs35266341 517 dbSNP
rs397693307 517 dbSNP
rs74458832 517 dbSNP
rs78798486 517 dbSNP
rs796280430 517 dbSNP
rs924355746 520 dbSNP
rs1299634487 521 dbSNP
rs1427131639 525 dbSNP
rs1470968463 526 dbSNP
rs977245550 528 dbSNP
rs1380066217 532 dbSNP
rs539281933 533 dbSNP
rs758559718 540 dbSNP
rs1290926414 543 dbSNP
rs1341447076 547 dbSNP
rs1404734432 548 dbSNP
rs1024221262 552 dbSNP
rs991387870 555 dbSNP
rs1278690636 571 dbSNP
rs1315871041 602 dbSNP
rs1446510868 603 dbSNP
rs1375330797 607 dbSNP
rs1264881866 612 dbSNP
rs1198447688 615 dbSNP
rs1299215069 615 dbSNP
rs1266634534 621 dbSNP
rs957585848 621 dbSNP
rs1478950182 630 dbSNP
rs539184534 632 dbSNP
rs1421840148 634 dbSNP
rs926133394 635 dbSNP
rs1407346046 640 dbSNP
rs1399031182 642 dbSNP
rs1157743444 647 dbSNP
rs1161482615 648 dbSNP
rs974895599 651 dbSNP
rs56400223 665 dbSNP
rs1424382655 666 dbSNP
rs1301646221 674 dbSNP
rs140829861 675 dbSNP
rs556750520 687 dbSNP
rs1179581949 689 dbSNP
rs1008945361 692 dbSNP
rs1287658143 704 dbSNP
rs1354010261 708 dbSNP
rs1472446648 709 dbSNP
rs536466916 710 dbSNP
rs1289293492 712 dbSNP
rs1453181554 715 dbSNP
rs375251088 732 dbSNP
rs1195594855 733 dbSNP
rs1468622338 735 dbSNP
rs1026287822 749 dbSNP
rs1381046947 750 dbSNP
rs1285040414 751 dbSNP
rs1444215012 756 dbSNP
rs1215395988 758 dbSNP
rs1393320063 762 dbSNP
rs1406322071 775 dbSNP
rs994066010 781 dbSNP
rs1353288719 791 dbSNP
rs1322522451 802 dbSNP
rs752252980 804 dbSNP
rs1377057088 808 dbSNP
rs1244770419 809 dbSNP
rs1312472431 812 dbSNP
rs1210235872 815 dbSNP
rs1272159378 818 dbSNP
rs182818342 824 dbSNP
rs1200508437 828 dbSNP
rs2836936 833 dbSNP
rs1181905095 840 dbSNP
rs1460979796 840 dbSNP
rs758973490 841 dbSNP
rs1370426432 843 dbSNP
rs1279312102 849 dbSNP
rs1167728547 856 dbSNP
rs113837624 860 dbSNP
rs1045896588 866 dbSNP
rs949800322 869 dbSNP
rs190184875 870 dbSNP
rs1052752917 873 dbSNP
rs1341927659 880 dbSNP
rs1288635876 886 dbSNP
rs1458133860 889 dbSNP
rs1351223392 892 dbSNP
rs936266640 896 dbSNP
rs1220390736 906 dbSNP
rs926185532 908 dbSNP
rs1322836808 918 dbSNP
rs1404184880 918 dbSNP
rs1258478138 922 dbSNP
rs1424255487 924 dbSNP
rs1172818186 937 dbSNP
rs974947997 939 dbSNP
rs1479044753 940 dbSNP
rs1171939004 943 dbSNP
rs965249905 943 dbSNP
rs1468796504 948 dbSNP
rs912032319 952 dbSNP
rs1476793854 953 dbSNP
rs551037478 965 dbSNP
rs1191512972 968 dbSNP
rs765642988 974 dbSNP
rs1401629658 977 dbSNP
rs1248613228 983 dbSNP
rs1344834901 989 dbSNP
rs1221653356 994 dbSNP
rs1257811181 998 dbSNP
rs1345874714 1001 dbSNP
rs373902396 1008 dbSNP
rs1467477009 1009 dbSNP
rs531336360 1011 dbSNP
rs950601539 1013 dbSNP
rs1194887935 1015 dbSNP
rs1268676249 1022 dbSNP
rs762187443 1032 dbSNP
rs1201726092 1053 dbSNP
rs186205978 1054 dbSNP
rs973304936 1058 dbSNP
rs1258774859 1063 dbSNP
rs1157569222 1066 dbSNP
rs35532531 1068 dbSNP
rs962648969 1068 dbSNP
rs1421241547 1071 dbSNP
rs1298544162 1074 dbSNP
rs1221057710 1075 dbSNP
rs1344693898 1076 dbSNP
rs1384993980 1084 dbSNP
rs1316565870 1095 dbSNP
rs75386526 1104 dbSNP
rs1238450403 1108 dbSNP
rs1387662195 1118 dbSNP
rs1307300974 1140 dbSNP
rs1001525061 1147 dbSNP
rs1369302450 1160 dbSNP
rs753969645 1166 dbSNP
rs905930985 1169 dbSNP
rs1212086594 1172 dbSNP
rs149915536 1193 dbSNP
rs1400469008 1196 dbSNP
rs1180502516 1197 dbSNP
rs1332752926 1201 dbSNP
rs1441133147 1211 dbSNP
rs759117289 1215 dbSNP
rs1364726629 1217 dbSNP
rs560356930 1232 dbSNP
rs1456202583 1233 dbSNP
rs1014814249 1237 dbSNP
rs775695053 1241 dbSNP
rs1053330096 1242 dbSNP
rs1372381366 1245 dbSNP
rs1241148749 1250 dbSNP
rs936240260 1255 dbSNP
rs904814511 1265 dbSNP
rs1038711411 1268 dbSNP
rs943076756 1287 dbSNP
rs1480572321 1288 dbSNP
rs772131186 1291 dbSNP
rs911610435 1304 dbSNP
rs987253831 1309 dbSNP
rs1458762266 1320 dbSNP
rs929100015 1327 dbSNP
rs1384237565 1332 dbSNP
rs1192758238 1334 dbSNP
rs371861002 1350 dbSNP
rs1368887071 1351 dbSNP
rs1461409835 1358 dbSNP
rs1189750186 1362 dbSNP
rs371740906 1363 dbSNP
rs1447632229 1369 dbSNP
rs372884013 1371 dbSNP
rs181516806 1375 dbSNP
rs1200564250 1377 dbSNP
rs1033586582 1386 dbSNP
rs139099576 1403 dbSNP
rs1307341177 1404 dbSNP
rs980492983 1404 dbSNP
rs1260555160 1405 dbSNP
rs1251192880 1410 dbSNP
rs1319315940 1413 dbSNP
rs1198762846 1434 dbSNP
rs878893683 1436 dbSNP
rs1482059771 1439 dbSNP
rs878965635 1441 dbSNP
rs150733449 1442 dbSNP
rs1314378862 1456 dbSNP
rs1404150945 1459 dbSNP
rs879237218 1460 dbSNP
rs1024782299 1462 dbSNP
rs1334650544 1467 dbSNP
rs1292223200 1470 dbSNP
rs79678769 1472 dbSNP
rs774531737 1481 dbSNP
rs1168382611 1482 dbSNP
rs891929953 1486 dbSNP
rs748322096 1490 dbSNP
rs1175757325 1496 dbSNP
rs771045684 1500 dbSNP
rs1398000314 1509 dbSNP
rs1327873886 1511 dbSNP
rs1461707558 1520 dbSNP
rs1393472462 1527 dbSNP
rs774262535 1531 dbSNP
rs755451609 1533 dbSNP
rs1364637279 1543 dbSNP
rs200187639 1551 dbSNP
rs1361615964 1556 dbSNP
rs1437925253 1563 dbSNP
rs1255401747 1566 dbSNP
rs1194811948 1578 dbSNP
rs780747248 1580 dbSNP
rs1398555337 1582 dbSNP
rs904761960 1583 dbSNP
rs1395688592 1588 dbSNP
rs1039325363 1589 dbSNP
rs932718986 1593 dbSNP
rs1467506592 1594 dbSNP
rs1277282621 1598 dbSNP
rs1357260391 1601 dbSNP
rs1172751900 1610 dbSNP
rs890139327 1612 dbSNP
rs1454025580 1618 dbSNP
rs1487813351 1618 dbSNP
rs1051913556 1633 dbSNP
rs1191272165 1636 dbSNP
rs1265109067 1638 dbSNP
rs190704499 1645 dbSNP
rs561876518 1651 dbSNP
rs1180606461 1652 dbSNP
rs1423146863 1653 dbSNP
rs1416243462 1665 dbSNP
rs1437834278 1667 dbSNP
rs1344854052 1672 dbSNP
rs1418145204 1682 dbSNP
rs919044318 1684 dbSNP
rs1361641448 1686 dbSNP
rs1404875243 1698 dbSNP
rs973199538 1706 dbSNP
rs1364810806 1708 dbSNP
rs556385059 1711 dbSNP
rs1220478755 1712 dbSNP
rs1301494748 1714 dbSNP
rs941893424 1715 dbSNP
rs1214056603 1716 dbSNP
rs1287873078 1722 dbSNP
rs1488531480 1730 dbSNP
rs1220654068 1735 dbSNP
rs926519484 1737 dbSNP
rs980726562 1739 dbSNP
rs1191876997 1747 dbSNP
rs543165049 1754 dbSNP
rs1160750133 1768 dbSNP
rs1381237601 1783 dbSNP
rs1424440823 1783 dbSNP
rs1484513860 1784 dbSNP
rs1352155588 1785 dbSNP
rs1254658232 1793 dbSNP
rs917259178 1796 dbSNP
rs1293578377 1802 dbSNP
rs1375589518 1803 dbSNP
rs187025419 1811 dbSNP
rs2836935 1813 dbSNP
rs1310910477 1820 dbSNP
rs1227554130 1821 dbSNP
rs1287593147 1823 dbSNP
rs1237495819 1838 dbSNP
rs1453232365 1842 dbSNP
rs1031787347 1851 dbSNP
rs1265681235 1877 dbSNP
rs1237636830 1878 dbSNP
rs1456505081 1883 dbSNP
rs1180686591 1885 dbSNP
rs114669759 1886 dbSNP
rs777221733 1892 dbSNP
rs968890841 1897 dbSNP
rs531630500 1900 dbSNP
rs1376839879 1912 dbSNP
rs1312078753 1922 dbSNP
rs1416469161 1926 dbSNP
rs1406442619 1931 dbSNP
rs1018242023 1933 dbSNP
rs1443952245 1945 dbSNP
rs1420027528 1957 dbSNP
rs1361421041 1981 dbSNP
rs1446886539 1982 dbSNP
rs1282199930 1995 dbSNP
rs1358287067 1995 dbSNP
rs180924119 1997 dbSNP
rs1228748979 1998 dbSNP
rs1257364252 2000 dbSNP
rs769550448 2003 dbSNP
rs1451879847 2008 dbSNP
rs1316096239 2012 dbSNP
rs1363349327 2020 dbSNP
rs1188298968 2032 dbSNP
rs1426098014 2035 dbSNP
rs557293719 2036 dbSNP
rs537466846 2037 dbSNP
rs568891540 2052 dbSNP
rs1473331737 2053 dbSNP
rs747610738 2054 dbSNP
rs1193500027 2064 dbSNP
rs890744340 2066 dbSNP
rs548816677 2069 dbSNP
rs1172154563 2075 dbSNP
rs570384685 2077 dbSNP
rs1255952768 2081 dbSNP
rs1051431925 2091 dbSNP
rs1331797672 2100 dbSNP
rs1341984074 2102 dbSNP
rs1415197100 2106 dbSNP
rs1488860173 2111 dbSNP
rs3945 2118 dbSNP
rs1220453035 2125 dbSNP
rs1258774653 2134 dbSNP
rs566598402 2136 dbSNP
rs1344481436 2139 dbSNP
rs1198875304 2140 dbSNP
rs1281009821 2150 dbSNP
rs758883805 2151 dbSNP
rs1193434424 2156 dbSNP
rs1214056716 2159 dbSNP
rs1479075890 2162 dbSNP
rs897562366 2167 dbSNP
rs1037432868 2191 dbSNP
rs761408175 2199 dbSNP
rs1246294848 2208 dbSNP
rs1170397840 2218 dbSNP
rs1403948007 2223 dbSNP
rs115459607 2224 dbSNP
rs1292532385 2245 dbSNP
rs1358457352 2248 dbSNP
rs1400531077 2249 dbSNP
rs1401757756 2255 dbSNP
rs56311159 2257 dbSNP
rs1296208599 2260 dbSNP
rs1330532994 2261 dbSNP
rs1045346818 2265 dbSNP
rs949328935 2285 dbSNP
rs1296094339 2295 dbSNP
rs1380785332 2314 dbSNP
rs1345937852 2316 dbSNP
rs1384464789 2320 dbSNP
rs1216224436 2326 dbSNP
rs1163921747 2327 dbSNP
rs917860292 2331 dbSNP
rs1489478662 2334 dbSNP
rs958685044 2346 dbSNP
rs1217918695 2356 dbSNP
rs1267299768 2362 dbSNP
rs1450500204 2367 dbSNP
rs1196094285 2374 dbSNP
rs1378912511 2375 dbSNP
rs545378015 2376 dbSNP
rs1164897024 2383 dbSNP
rs956048004 2383 dbSNP
rs1257970855 2384 dbSNP
rs1478420146 2385 dbSNP
rs1265840665 2389 dbSNP
rs924665153 2408 dbSNP
rs978851726 2414 dbSNP
rs1389959585 2415 dbSNP
rs1005526970 2420 dbSNP
rs951462605 2438 dbSNP
rs1446090863 2443 dbSNP
rs1325583192 2446 dbSNP
rs968837528 2452 dbSNP
rs1211121107 2453 dbSNP
rs1307368273 2454 dbSNP
rs1332121099 2456 dbSNP
rs1356240850 2458 dbSNP
rs1240249938 2466 dbSNP
rs189371586 2468 dbSNP
rs1219226309 2469 dbSNP
rs571673392 2472 dbSNP
rs1268840750 2473 dbSNP
rs1468540019 2477 dbSNP
rs1177554910 2478 dbSNP
rs1236000315 2482 dbSNP
rs757553256 2489 dbSNP
rs998362877 2490 dbSNP
rs1159522316 2491 dbSNP
rs1367728807 2495 dbSNP
rs1456317099 2497 dbSNP
rs1226343429 2500 dbSNP
rs1164935592 2502 dbSNP
rs1395237835 2514 dbSNP
rs901362118 2516 dbSNP
rs1326077776 2520 dbSNP
rs1324533625 2527 dbSNP
rs1446162333 2528 dbSNP
rs1388728445 2535 dbSNP
rs1329515826 2548 dbSNP
rs1379359117 2552 dbSNP
rs754243865 2556 dbSNP
rs1312444762 2559 dbSNP
rs954973555 2560 dbSNP
rs1247533471 2568 dbSNP
rs1274363706 2584 dbSNP
rs1031026210 2585 dbSNP
rs1197491673 2590 dbSNP
rs1007121227 2595 dbSNP
rs1255648264 2596 dbSNP
rs1458798125 2600 dbSNP
rs1177484145 2604 dbSNP
rs993101630 2608 dbSNP
rs559737693 2609 dbSNP
rs768441981 2621 dbSNP
rs1037379252 2624 dbSNP
rs1054087328 2630 dbSNP
rs935670318 2639 dbSNP
rs748849732 2651 dbSNP
rs924374861 2652 dbSNP
rs904979665 2656 dbSNP
rs1402617486 2660 dbSNP
rs1166533338 2664 dbSNP
rs1475253059 2665 dbSNP
rs1041895291 2670 dbSNP
rs1378570938 2682 dbSNP
rs545374452 2683 dbSNP
rs1200631813 2684 dbSNP
rs1398182828 2684 dbSNP
rs531617010 2686 dbSNP
rs878911913 2696 dbSNP
rs1044897199 2699 dbSNP
rs1217391614 2713 dbSNP
rs1466843999 2726 dbSNP
rs1308817973 2730 dbSNP
rs949270728 2737 dbSNP
rs183569502 2740 dbSNP
rs1251883196 2746 dbSNP
rs917821799 2750 dbSNP
rs1198684349 2753 dbSNP
rs1459042334 2757 dbSNP
rs775394316 2763 dbSNP
rs1212712264 2765 dbSNP
rs1270711919 2766 dbSNP
rs1258021127 2769 dbSNP
rs542799898 2772 dbSNP
rs1195148470 2777 dbSNP
rs1477445314 2783 dbSNP
rs1345517864 2793 dbSNP
rs1276371732 2799 dbSNP
rs541476127 2808 dbSNP
rs1175571785 2814 dbSNP
rs1368997373 2815 dbSNP
rs934617385 2819 dbSNP
rs924612648 2821 dbSNP
rs978799244 2827 dbSNP
rs917107806 2833 dbSNP
rs947446664 2833 dbSNP
rs910658506 2834 dbSNP
rs8134728 2838 dbSNP
rs1214677763 2840 dbSNP
rs986299411 2844 dbSNP
rs1310050400 2850 dbSNP
rs991294527 2853 dbSNP
rs35307687 2854 dbSNP
rs955065617 2855 dbSNP
rs1447537225 2859 dbSNP
rs1280772091 2864 dbSNP
rs181276439 2864 dbSNP
rs1487840486 2866 dbSNP
rs764208161 2867 dbSNP
rs1243802910 2868 dbSNP
rs1190655858 2881 dbSNP
rs1409882865 2882 dbSNP
rs1455737079 2890 dbSNP
rs984131041 2905 dbSNP
rs1380001537 2910 dbSNP
rs1300540720 2912 dbSNP
rs1403421118 2919 dbSNP
rs868609166 2920 dbSNP
rs972297959 2928 dbSNP
rs1174648672 2933 dbSNP
rs951501394 2935 dbSNP
rs1442563298 2941 dbSNP
rs1015878442 2952 dbSNP
rs1005875921 2960 dbSNP
rs904927566 2971 dbSNP
rs1178717272 2980 dbSNP
rs1023827724 2983 dbSNP
rs574457230 2998 dbSNP
rs1286137356 3002 dbSNP
rs1441070505 3007 dbSNP
rs1220820809 3011 dbSNP
rs556709413 3016 dbSNP
rs1194442481 3017 dbSNP
rs572985240 3017 dbSNP
rs1237836597 3020 dbSNP
rs188428296 3024 dbSNP
rs370895116 3028 dbSNP
rs1442902708 3038 dbSNP
rs1409247311 3043 dbSNP
rs1405284365 3051 dbSNP
rs538103085 3052 dbSNP
rs965506236 3053 dbSNP
rs1347549468 3055 dbSNP
rs1442486862 3057 dbSNP
rs1326123883 3060 dbSNP
rs1018431892 3064 dbSNP
rs1375659622 3078 dbSNP
rs1444191038 3082 dbSNP
rs1208397283 3085 dbSNP
rs1007068902 3086 dbSNP
rs142178978 3087 dbSNP
rs903807990 3101 dbSNP
rs1339388811 3108 dbSNP
rs558035871 3113 dbSNP
rs111386718 3131 dbSNP
rs947399901 3135 dbSNP
rs577445586 3141 dbSNP
rs902869994 3142 dbSNP
rs1456599088 3143 dbSNP
rs986633964 3155 dbSNP
rs1233738773 3172 dbSNP
rs1375692408 3173 dbSNP
rs752687872 3173 dbSNP
rs568802260 3181 dbSNP
rs1420698414 3184 dbSNP
rs1462469385 3186 dbSNP
rs1164984511 3187 dbSNP
rs781102535 3188 dbSNP
rs933471051 3200 dbSNP
rs1041453161 3201 dbSNP
rs923436292 3201 dbSNP
rs949810353 3202 dbSNP
rs1447045875 3215 dbSNP
rs1336585035 3217 dbSNP
rs555440364 3219 dbSNP
rs972244372 3225 dbSNP
rs1433173112 3232 dbSNP
rs1375214514 3236 dbSNP
rs1158931342 3242 dbSNP
rs917014569 3246 dbSNP
rs1421113212 3247 dbSNP
rs767754413 3251 dbSNP
rs1197712446 3257 dbSNP
rs184384832 3258 dbSNP
rs937209275 3269 dbSNP
rs147227583 3273 dbSNP
rs1016498737 3286 dbSNP
rs984402764 3288 dbSNP
rs1473097182 3290 dbSNP
rs909800939 3291 dbSNP
rs1474149592 3300 dbSNP
rs2836934 3300 dbSNP
rs1169236434 3302 dbSNP
rs1396731520 3320 dbSNP
rs1413604235 3325 dbSNP
rs1377114392 3329 dbSNP
rs35812236 3329 dbSNP
rs397867686 3329 dbSNP
rs533185279 3331 dbSNP
rs1297518510 3343 dbSNP
rs896278350 3347 dbSNP
rs570718409 3351 dbSNP
rs1229739871 3355 dbSNP
rs1270891609 3366 dbSNP
rs1263615414 3372 dbSNP
rs146340883 3378 dbSNP
rs550933793 3378 dbSNP
rs145433936 3379 dbSNP
rs61549921 3379 dbSNP
rs142328475 3381 dbSNP
rs201814290 3381 dbSNP
rs1282910365 3382 dbSNP
rs531727132 3388 dbSNP
rs1486206807 3399 dbSNP
rs951400842 3400 dbSNP
rs1216454511 3402 dbSNP
rs1282290370 3411 dbSNP
rs1261684558 3418 dbSNP
rs1030833187 3419 dbSNP
rs1223248280 3420 dbSNP
rs1046284 3428 dbSNP
rs1194667182 3429 dbSNP
rs553304226 3431 dbSNP
rs1046285 3441 dbSNP
rs1477488063 3443 dbSNP
rs903755562 3450 dbSNP
rs1046286 3452 dbSNP
rs1396595996 3452 dbSNP
rs947381465 3456 dbSNP
rs1413456527 3472 dbSNP
rs1382652078 3486 dbSNP
rs1319055210 3490 dbSNP
rs1046289 3491 dbSNP
rs965416448 3500 dbSNP
rs933398718 3505 dbSNP
rs1401496367 3507 dbSNP
rs1239916588 3518 dbSNP
rs529332767 3521 dbSNP
rs1353453875 3522 dbSNP
rs1157749614 3534 dbSNP
rs1261729352 3538 dbSNP
rs1405370594 3549 dbSNP
rs923391538 3563 dbSNP
rs1254523599 3575 dbSNP
rs1415329320 3583 dbSNP
rs1018382226 3586 dbSNP
rs1162779643 3603 dbSNP
rs1036475900 3606 dbSNP
rs985616135 3608 dbSNP
rs1177755796 3609 dbSNP
rs1361911783 3610 dbSNP
rs1671 3616 dbSNP
rs143707409 3630 dbSNP
rs1474827853 3642 dbSNP
rs1390035327 3646 dbSNP
rs1459963977 3647 dbSNP
rs1046293 3660 dbSNP
rs958229073 3668 dbSNP
rs1263689509 3673 dbSNP
rs1328124627 3674 dbSNP
rs909444305 3674 dbSNP
rs1446394773 3678 dbSNP
rs1032575676 3682 dbSNP
rs1337903981 3695 dbSNP
rs192820029 3707 dbSNP
rs1265391159 3708 dbSNP
rs969045890 3715 dbSNP
rs916232161 3720 dbSNP
rs2410104 3721 dbSNP
rs577828015 3726 dbSNP
rs902777364 3748 dbSNP
rs960725643 3750 dbSNP
rs1248075882 3752 dbSNP
rs1215323976 3759 dbSNP
rs1182378049 3767 dbSNP
rs866841149 3773 dbSNP
rs1367852541 3783 dbSNP
rs1474208674 3791 dbSNP
rs1167166599 3797 dbSNP
rs1395397106 3801 dbSNP
rs1030782604 3806 dbSNP
rs370727796 3811 dbSNP
rs1399020084 3812 dbSNP
rs879812576 3813 dbSNP
rs1392363617 3816 dbSNP
rs1312507313 3817 dbSNP
rs1354085033 3819 dbSNP
rs999337917 3824 dbSNP
rs1294596481 3836 dbSNP
rs967888977 3843 dbSNP
rs189064105 3856 dbSNP
rs2898369 3861 dbSNP
rs1022187964 3863 dbSNP
rs1196128705 3869 dbSNP
rs35945460 3872 dbSNP
rs1484647075 3873 dbSNP
rs575157079 3879 dbSNP
rs1189985354 3895 dbSNP
rs895561620 3902 dbSNP
rs555104715 3905 dbSNP
rs1477549043 3912 dbSNP
rs1168547647 3935 dbSNP
rs1279256366 3935 dbSNP
rs1462729223 3937 dbSNP
rs1302619052 3942 dbSNP
rs937158421 3948 dbSNP
rs1216631844 3951 dbSNP
rs1374099853 3952 dbSNP
rs1050850604 3953 dbSNP
rs535448873 3956 dbSNP
rs1048238855 3964 dbSNP
rs1359432821 3967 dbSNP
rs1036422530 3970 dbSNP
rs1287993743 3971 dbSNP
rs1436734025 3974 dbSNP
rs1227781796 3979 dbSNP
rs2836933 3983 dbSNP
rs1323273702 3989 dbSNP
rs200921557 3993 dbSNP
rs1258170761 3994 dbSNP
rs553107805 3996 dbSNP
rs1460888884 3997 dbSNP
rs112629458 3998 dbSNP
rs58041256 3998 dbSNP
rs757037637 3998 dbSNP
rs918515781 4002 dbSNP
rs539634246 4004 dbSNP
rs948300149 4012 dbSNP
rs531437829 4019 dbSNP
rs992219024 4021 dbSNP
rs1418508409 4028 dbSNP
rs1360415127 4037 dbSNP
rs960380942 4037 dbSNP
rs911304162 4038 dbSNP
rs1302264991 4039 dbSNP
rs1345419378 4041 dbSNP
rs977844345 4044 dbSNP
rs967835201 4055 dbSNP
rs1316253539 4057 dbSNP
rs1213633025 4063 dbSNP
rs1436136852 4066 dbSNP
rs1486244556 4068 dbSNP
rs1193193531 4077 dbSNP
rs1251410297 4089 dbSNP
rs1455779576 4094 dbSNP
rs1022135461 4100 dbSNP
rs1006758938 4106 dbSNP
rs376464102 4108 dbSNP
rs1161929283 4110 dbSNP
rs1346403860 4112 dbSNP
rs1453893442 4114 dbSNP
rs563953147 4119 dbSNP
rs1368302404 4123 dbSNP
rs1442721455 4138 dbSNP
rs1468438866 4153 dbSNP
rs550872039 4154 dbSNP
rs1032893720 4155 dbSNP
rs1372354515 4163 dbSNP
rs552025066 4166 dbSNP
rs1286290713 4174 dbSNP
rs901864513 4178 dbSNP
rs1271402511 4197 dbSNP
rs527582558 4202 dbSNP
rs1214626875 4217 dbSNP
rs1295279275 4219 dbSNP
rs1219487480 4223 dbSNP
rs1004924519 4229 dbSNP
rs1468943751 4232 dbSNP
rs887899751 4234 dbSNP
rs1025232996 4241 dbSNP
rs1475193636 4244 dbSNP
rs754160108 4256 dbSNP
rs1400951665 4258 dbSNP
rs536977840 4259 dbSNP
rs559677039 4260 dbSNP
rs948272696 4265 dbSNP
rs1299873261 4273 dbSNP
rs1034049509 4278 dbSNP
rs1460380517 4287 dbSNP
rs895367134 4295 dbSNP
rs1353744659 4300 dbSNP
rs1281115401 4303 dbSNP
rs1373939856 4303 dbSNP
rs1232663534 4314 dbSNP
rs373041595 4316 dbSNP
rs185738906 4324 dbSNP
rs1056732403 4325 dbSNP
rs557911463 4330 dbSNP
rs938966873 4331 dbSNP
rs888216077 4333 dbSNP
rs568357701 4359 dbSNP
rs1207038173 4365 dbSNP
rs977793494 4366 dbSNP
rs1485626921 4371 dbSNP
rs1453931002 4376 dbSNP
rs549077448 4380 dbSNP
rs1186426640 4388 dbSNP
rs1414949346 4389 dbSNP
rs1238852356 4413 dbSNP
rs878996526 4414 dbSNP
rs915026564 4424 dbSNP
rs929835946 4440 dbSNP
rs539898264 4441 dbSNP
rs1407908599 4451 dbSNP
rs1179515421 4457 dbSNP
rs1371010480 4461 dbSNP
rs193244055 4465 dbSNP
rs953921732 4467 dbSNP
rs757817320 4469 dbSNP
rs138340460 4470 dbSNP
rs1233942543 4472 dbSNP
rs1269725378 4476 dbSNP
rs749609154 4481 dbSNP
rs1271605933 4488 dbSNP
rs1337676610 4498 dbSNP
rs911253248 4516 dbSNP
rs1274069869 4519 dbSNP
rs144671566 4520 dbSNP
rs533347225 4525 dbSNP
rs936714465 4530 dbSNP
rs1260272003 4531 dbSNP
rs1486309898 4532 dbSNP
rs1187618603 4544 dbSNP
rs1241073916 4565 dbSNP
rs965976821 4566 dbSNP
rs1169290372 4569 dbSNP
rs1390498698 4582 dbSNP
rs1433899788 4590 dbSNP
rs1377054852 4591 dbSNP
rs1377172987 4592 dbSNP
rs1396594565 4594 dbSNP
rs376572533 4599 dbSNP
rs1324764702 4601 dbSNP
rs1433083797 4605 dbSNP
rs1308476441 4607 dbSNP
rs1014873348 4611 dbSNP
rs1372462714 4615 dbSNP
rs544874726 4616 dbSNP
rs541503448 4643 dbSNP
rs1282862288 4648 dbSNP
rs1373386879 4655 dbSNP
rs575816073 4663 dbSNP
rs1434318461 4667 dbSNP
rs1364501764 4683 dbSNP
rs1027759670 4687 dbSNP
rs1012802185 4693 dbSNP
rs1396725584 4695 dbSNP
rs529794501 4704 dbSNP
rs918145383 4705 dbSNP
rs992399962 4706 dbSNP
rs1417877684 4710 dbSNP
rs1402560068 4723 dbSNP
rs1250364432 4729 dbSNP
rs1370502861 4730 dbSNP
rs1439062118 4731 dbSNP
rs959630031 4737 dbSNP
rs752911242 4738 dbSNP
rs1306078869 4741 dbSNP
rs1332046407 4745 dbSNP
rs1238889895 4748 dbSNP
rs1278321227 4754 dbSNP
rs1353516830 4756 dbSNP
rs1206359127 4764 dbSNP
rs939581847 4766 dbSNP
rs73222852 4771 dbSNP
rs1001160546 4772 dbSNP
rs755038858 4790 dbSNP
rs1486898326 4791 dbSNP
rs1211437949 4799 dbSNP
rs1255818473 4799 dbSNP
rs1254581733 4813 dbSNP
rs1209756429 4814 dbSNP
rs1026767351 4816 dbSNP
rs751700234 4826 dbSNP
rs766417872 4836 dbSNP
rs1393923188 4840 dbSNP
rs1460012127 4840 dbSNP
rs572915892 4844 dbSNP
rs1261993984 4851 dbSNP
rs569269365 4861 dbSNP
rs946389044 4863 dbSNP
rs1040971091 4865 dbSNP
rs149339684 4868 dbSNP
rs1008120584 4869 dbSNP
rs544777353 4870 dbSNP
rs1416528921 4877 dbSNP
rs772865014 4878 dbSNP
rs1353384477 4879 dbSNP
rs1312015775 4881 dbSNP
rs1316689001 4888 dbSNP
rs1385882516 4889 dbSNP
rs1288350595 4898 dbSNP
rs1160388339 4916 dbSNP
rs1451643079 4917 dbSNP
rs114540030 4924 dbSNP
rs878855978 4925 dbSNP
rs925352544 4927 dbSNP
rs1248226358 4928 dbSNP
rs1042500267 4930 dbSNP
rs1439491685 4937 dbSNP
rs945522666 4938 dbSNP
rs556841396 4945 dbSNP
rs1182817265 4946 dbSNP
rs765036551 4953 dbSNP
rs1476453731 4954 dbSNP
rs1474280779 4955 dbSNP
rs992303593 4957 dbSNP
rs761545686 4959 dbSNP
rs1187616043 4961 dbSNP
rs1461724177 4963 dbSNP
rs926884260 4966 dbSNP
rs1166511906 4974 dbSNP
rs866294939 4975 dbSNP
rs1410912929 4978 dbSNP
rs138807544 4979 dbSNP
rs1354222482 4981 dbSNP
rs1263318878 4985 dbSNP
rs568213771 4990 dbSNP
rs1027134791 4996 dbSNP
rs371666837 5005 dbSNP
rs1321935740 5020 dbSNP
rs961434158 5021 dbSNP
rs369467232 5030 dbSNP
rs1008068037 5044 dbSNP
rs35830450 5044 dbSNP
rs1332541833 5055 dbSNP
rs62222987 5059 dbSNP
rs961267831 5061 dbSNP
rs1344063057 5062 dbSNP
rs1292472554 5064 dbSNP
rs889674670 5068 dbSNP
rs776200206 5073 dbSNP
rs1327257316 5080 dbSNP
rs550527621 5082 dbSNP
rs1320611676 5086 dbSNP
rs1428068968 5099 dbSNP
rs983395012 5102 dbSNP
rs768312635 5118 dbSNP
rs1430835151 5121 dbSNP
rs1028121463 5137 dbSNP
rs150211650 5138 dbSNP
rs1042794379 5139 dbSNP
rs1437188212 5146 dbSNP
rs1304075963 5152 dbSNP
rs1012337896 5156 dbSNP
rs1381249421 5161 dbSNP
rs1384396128 5164 dbSNP
rs1326611070 5169 dbSNP
rs1463491094 5174 dbSNP
rs945456699 5177 dbSNP
rs1345631883 5178 dbSNP
rs896564733 5196 dbSNP
rs1392841779 5200 dbSNP
rs1256599565 5204 dbSNP
rs1485597527 5206 dbSNP
rs959761727 5211 dbSNP
rs1164664808 5214 dbSNP
rs1475983891 5221 dbSNP
rs533286851 5223 dbSNP
rs938214125 5236 dbSNP
rs1427526082 5238 dbSNP
rs1253118392 5242 dbSNP
rs746510684 5243 dbSNP
rs1359189575 5245 dbSNP
rs1467094569 5255 dbSNP
rs1286655201 5256 dbSNP
rs1272403293 5260 dbSNP
rs1390363555 5261 dbSNP
rs577482857 5270 dbSNP
rs1042678635 5276 dbSNP
rs368186556 5277 dbSNP
rs1220827412 5285 dbSNP
rs879067811 5290 dbSNP
rs985034162 5291 dbSNP
rs1341287904 5299 dbSNP
rs1213703132 5306 dbSNP
rs1270160773 5306 dbSNP
rs930963601 5310 dbSNP
rs564256583 5319 dbSNP
rs1465512458 5326 dbSNP
rs932413734 5328 dbSNP
rs1251462747 5331 dbSNP
rs1268177628 5334 dbSNP
rs919574981 5335 dbSNP
rs1479224590 5339 dbSNP
rs922378336 5345 dbSNP
rs972829881 5346 dbSNP
rs1417907610 5356 dbSNP
rs1156307883 5358 dbSNP
rs1225556387 5361 dbSNP
rs1413532640 5369 dbSNP
rs1457387590 5371 dbSNP
rs1324824920 5372 dbSNP
rs1040841373 5376 dbSNP
rs1438309006 5378 dbSNP
rs961115802 5397 dbSNP
rs908440406 5398 dbSNP
rs939877840 5398 dbSNP
rs984013528 5406 dbSNP
rs1329948691 5413 dbSNP
rs550868951 5421 dbSNP
rs774991758 5430 dbSNP
rs986625246 5435 dbSNP
rs920605298 5448 dbSNP
rs113060682 5455 dbSNP
rs565218601 5455 dbSNP
rs1443106708 5460 dbSNP
rs1479904794 5468 dbSNP
rs867251719 5475 dbSNP
rs1325891153 5477 dbSNP
rs1472650734 5484 dbSNP
rs1028231240 5492 dbSNP
rs1035127939 5493 dbSNP
rs1399129659 5494 dbSNP
rs1165213553 5495 dbSNP
rs1353713483 5495 dbSNP
rs374805531 5508 dbSNP
rs1000760570 5509 dbSNP
rs1309799169 5512 dbSNP
rs1003689340 5515 dbSNP
rs966879473 5520 dbSNP
rs775046174 5525 dbSNP
rs1291570881 5531 dbSNP
rs1021183610 5538 dbSNP
rs1229104217 5539 dbSNP
rs1020914271 5545 dbSNP
rs562204298 5548 dbSNP
rs1306146099 5549 dbSNP
rs1461192949 5550 dbSNP
rs1395252245 5552 dbSNP
rs1009989185 5553 dbSNP
rs896565904 5556 dbSNP
rs1485658813 5557 dbSNP
rs1056510457 5562 dbSNP
rs1235308659 5567 dbSNP
rs542555873 5584 dbSNP
rs528070235 5585 dbSNP
rs1473537566 5598 dbSNP
rs1182101560 5603 dbSNP
rs1418470087 5604 dbSNP
rs1049395717 5605 dbSNP
rs1170302892 5606 dbSNP
rs996943777 5607 dbSNP
rs1434093896 5608 dbSNP
rs1332197467 5613 dbSNP
rs1342355496 5620 dbSNP
rs1448964409 5623 dbSNP
rs1269859019 5629 dbSNP
rs900900592 5640 dbSNP
rs1231043241 5641 dbSNP
rs1275868733 5643 dbSNP
rs1347784020 5648 dbSNP
rs938161306 5652 dbSNP
rs1040787200 5655 dbSNP
rs905400834 5658 dbSNP
rs1439447040 5659 dbSNP
rs771310398 5662 dbSNP
rs930888884 5665 dbSNP
rs919506898 5668 dbSNP
rs972394892 5670 dbSNP
rs749850408 5687 dbSNP
rs572948929 5698 dbSNP
rs912313208 5704 dbSNP
rs1281396047 5707 dbSNP
rs986571604 5727 dbSNP
rs953788943 5740 dbSNP
rs931238615 5741 dbSNP
rs1028136442 5749 dbSNP
rs1415074896 5749 dbSNP
rs979676269 5763 dbSNP
rs186926054 5765 dbSNP
rs1437627350 5778 dbSNP
rs1298707487 5780 dbSNP
rs1302724115 5788 dbSNP
rs374096616 5789 dbSNP
rs1232681452 5796 dbSNP
rs928005339 5800 dbSNP
rs545827660 5809 dbSNP
rs982199277 5813 dbSNP
rs1327287561 5829 dbSNP
rs1248357739 5831 dbSNP
rs1463267906 5831 dbSNP
rs576982864 5833 dbSNP
rs1467890057 5836 dbSNP
rs1391116144 5843 dbSNP
rs1376442496 5844 dbSNP
rs966828699 5845 dbSNP
rs1158062166 5846 dbSNP
rs778164652 5849 dbSNP
rs1458966483 5855 dbSNP
rs1321496267 5860 dbSNP
rs1394154378 5863 dbSNP
rs1385423584 5871 dbSNP
rs896512425 5881 dbSNP
rs1332170325 5885 dbSNP
rs182192777 5890 dbSNP
rs1002218366 5891 dbSNP
rs1229804862 5905 dbSNP
rs958299875 5910 dbSNP
rs905306160 5915 dbSNP
rs1049191404 5919 dbSNP
rs1485908868 5936 dbSNP
rs995422804 5943 dbSNP
rs1181015758 5948 dbSNP
rs1249651954 5950 dbSNP
rs1473632774 5955 dbSNP
rs769697305 5961 dbSNP
rs1160052225 5963 dbSNP
rs996498422 5964 dbSNP
rs1345943436 5965 dbSNP
rs1165362087 5966 dbSNP
rs900857107 5969 dbSNP
rs1391268352 5970 dbSNP
rs78604625 5972 dbSNP
rs748523217 5985 dbSNP
rs886893608 5987 dbSNP
rs1224354279 6000 dbSNP
rs1288493222 6002 dbSNP
rs1320739044 6003 dbSNP
rs1242165459 6004 dbSNP
rs1353476292 6006 dbSNP
rs1356815611 6007 dbSNP
rs912202938 6019 dbSNP
rs201239669 6020 dbSNP
rs2297257 6020 dbSNP
rs397755720 6021 dbSNP
rs71330349 6021 dbSNP
rs1256990973 6022 dbSNP
rs1356560632 6023 dbSNP
rs758942914 6024 dbSNP
rs879349904 6025 dbSNP
rs932349221 6026 dbSNP
rs1167152493 6027 dbSNP
rs921020551 6028 dbSNP
rs1372931336 6029 dbSNP
rs756635827 6029 dbSNP
rs1374406285 6030 dbSNP
rs1377825522 6030 dbSNP
rs937991959 6031 dbSNP
rs979279736 6032 dbSNP
rs190336446 6040 dbSNP
rs1227370375 6043 dbSNP
rs2225425 6055 dbSNP
rs1344225197 6058 dbSNP
rs1402003629 6063 dbSNP
rs377393437 6076 dbSNP
rs1205796727 6077 dbSNP
rs1405144877 6079 dbSNP
rs913799169 6080 dbSNP
rs755306564 6093 dbSNP
rs187048231 6096 dbSNP
rs777872978 6096 dbSNP
rs1482333879 6100 dbSNP
rs1202285438 6108 dbSNP
rs1475476606 6110 dbSNP
rs1428198471 6115 dbSNP
rs1187060119 6120 dbSNP
rs1392419665 6123 dbSNP
rs1450575620 6127 dbSNP
rs1173586475 6130 dbSNP
rs1165195226 6131 dbSNP
rs36069854 6133 dbSNP
rs1358032433 6140 dbSNP
rs960628112 6145 dbSNP
rs1304129195 6147 dbSNP
rs1419797593 6148 dbSNP
rs989644286 6150 dbSNP
rs1318223523 6151 dbSNP
rs1034962460 6161 dbSNP
rs552914975 6165 dbSNP
rs1228997446 6166 dbSNP
rs971061160 6170 dbSNP
rs1484821569 6178 dbSNP
rs772025979 6181 dbSNP
rs1300462453 6184 dbSNP
rs1002164717 6186 dbSNP
rs958465002 6206 dbSNP