miRTarBase - #MIRT051334 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAPK6   
Synonyms ERK3, HsT17250, PRKM6, p97MAPK
Description mitogen-activated protein kinase 6
Transcript NM_002748   
Expression
Putative miRNA Targets on MAPK6
3'UTR of MAPK6
(miRNA target sites are highlighted)
>MAPK6|NM_002748|3'UTR
   1 AACACTCAGCAGACATTTATCTTTGTATTCTTCATGAAATGTGTTTTGTCTTTTTTTATTACTAGTGTTTAAGTCATTTT
  81 TTACTTGAATCAGATGGTGTCATTTAGTAAGGATTTTATGAGTTCTTGTTTTTTAAAATCCAGACTTTCTTTTTCTACAT
 161 GTGAGATAGTTTTCATTTTAACTGGCATGTCATTTGCACACAAAAATAAAGACTAGAGCAAAATAATGCAACGCAGGAGG
 241 AGAAAAGAAATGCACTAAGACAAGAACATTCTCTCATAGAACATTGATCTGTTTTACAGGAAACAAACCTTGCCTTGAAA
 321 TTTACACAGTGAGACTGTACATAATTGCATGAAAATAGCTATTTTTTTCCTAAGACATTTTTCATTCATGAATATTTTCA
 401 AGTTTTTCATACTGTACACATTTCTTAAAACACATGATACCAGCAGCAACTGAAAATGAATGCCGAATTTGGTACACATG
 481 TGTTATCTACCTCAAGGTAACAAGAGTATGTGGCAAAACATATACCACCCATAGTGCTTCACAAAATGCACTTCTATTTA
 561 GCCAGCGTTTATTGTAGTAAACTATTCTTAATAAAACTCACTCACTGTTTATAAATGTTCTGGTATGCATTCTTTATAGT
 641 GAAGTGTTAATACATCACATCTTATTTATTTTAGCAAATCAGTATATTTTCTGTATTTAATTATAAAAAATTAACTTAGT
 721 TTTTAAAATTTATTTGCAAATATACTTTACTTTTTCCATTTGGCACTATGGTTTGTTGCCTACCTAGCTGCATCTATAAT
 801 GTCAGCTTATCCTAAGGCTGTCCACGTACTTAATTTACTTAAGTGTTCATTTTAAGTAACGTGCTCACTGTGTATAGGAA
 881 TTTGTATTTTGGAGGTGCTTGATCTATCTACAAAGAAAAATTAATTAGGAATTACTTTATTATAAAATGCTCCTAGAAGT
 961 CTTAATTGTGTTTATTTTTTAAAAAAACAAATGTTAGACTTGTGTGCATGGAAGTAATTAAGGTACATCATTATTGTAGT
1041 TTGAAAGTTGTACATGATAAGACATTTTGTTTTTACTGTATGTTTTTACTGAATGATCTATTCCCCATCCCAAGGCAAGC
1121 ATGAATAAAATTAGGTTAAACGTAGCATGTGGCATCGCAGTCTCTTAGAATTTGTTTCATCTATTTTATTTTATTGAATA
1201 CTGTCTGTATCTTTGGTTATCCTGTTTGAAGAAAAAGGACAAATAAAACATGGCCAGCAAATACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGau 5'
               ||:|| :| ||:|||  
Target 5' ttggcACTATGGTTTGTTGCct 3'
760 - 781 125.00 -8.50
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |::|| |  |||| || 
Target 5' actttATTATAAAATGCTCCTa 3'
934 - 955 121.00 -5.80
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :| |:|||||| ||: |:| 
Target 5' ggTACATCATTAT-TGTAGTTt 3'
1022 - 1042 107.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31601993 22 COSMIC
COSN30153206 51 COSMIC
COSN30144000 63 COSMIC
COSN31600375 169 COSMIC
COSN26575978 338 COSMIC
COSN31548453 352 COSMIC
COSN31488824 388 COSMIC
COSN31585151 577 COSMIC
COSN31480616 642 COSMIC
COSN20112067 750 COSMIC
COSN19168490 846 COSMIC
COSN20112072 989 COSMIC
COSN8174503 1109 COSMIC
COSN30539236 1151 COSMIC
COSN31553571 1158 COSMIC
COSN6275359 1258 COSMIC
COSN21875704 1337 COSMIC
COSN23124731 1509 COSMIC
COSN18834407 1734 COSMIC
COSN18752709 1736 COSMIC
COSN20380761 1763 COSMIC
COSN16169897 1795 COSMIC
COSN1177790 1922 COSMIC
COSN23306897 1933 COSMIC
COSN20969335 1947 COSMIC
COSN6275360 2277 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1433532440 7 dbSNP
rs747303169 8 dbSNP
rs776858835 11 dbSNP
rs762112281 14 dbSNP
rs750436527 16 dbSNP
rs780866438 16 dbSNP
rs1162307566 18 dbSNP
rs1475597197 20 dbSNP
rs1243639233 22 dbSNP
rs765602869 25 dbSNP
rs1348032740 28 dbSNP
rs150964739 31 dbSNP
rs1254694603 32 dbSNP
rs1214444460 37 dbSNP
rs763500374 38 dbSNP
rs766052988 41 dbSNP
rs953532096 43 dbSNP
rs1226818221 46 dbSNP
rs1272302171 46 dbSNP
rs1340409847 46 dbSNP
rs751119360 47 dbSNP
rs1365190365 48 dbSNP
rs755089719 48 dbSNP
rs754477873 49 dbSNP
rs373807466 51 dbSNP
rs748273542 51 dbSNP
rs756356623 51 dbSNP
rs781466558 51 dbSNP
rs1473118872 58 dbSNP
rs1421377223 62 dbSNP
rs1166557907 63 dbSNP
rs1395672578 68 dbSNP
rs568843424 68 dbSNP
rs1406345939 71 dbSNP
rs911167500 76 dbSNP
rs539555242 77 dbSNP
rs1245056682 84 dbSNP
rs1221033098 88 dbSNP
rs1438664415 102 dbSNP
rs1157689646 103 dbSNP
rs1203500145 104 dbSNP
rs1303335046 112 dbSNP
rs1341925617 116 dbSNP
rs1304756913 117 dbSNP
rs1349929222 119 dbSNP
rs557873234 121 dbSNP
rs1346263465 123 dbSNP
rs1273794905 124 dbSNP
rs1406297951 126 dbSNP
rs1300893081 129 dbSNP
rs1442480118 129 dbSNP
rs1344556518 134 dbSNP
rs941246783 143 dbSNP
rs531208072 145 dbSNP
rs769651405 146 dbSNP
rs530362329 148 dbSNP
rs1281085979 150 dbSNP
rs1423136878 152 dbSNP
rs1190750917 158 dbSNP
rs1470617149 160 dbSNP
rs1203319729 163 dbSNP
rs1491390728 163 dbSNP
rs1281511843 164 dbSNP
rs1491192578 164 dbSNP
rs1311028555 165 dbSNP
rs1277259819 167 dbSNP
rs56216817 168 dbSNP
rs1223906410 169 dbSNP
rs1351825830 170 dbSNP
rs929728133 174 dbSNP
rs577542797 183 dbSNP
rs1223113190 190 dbSNP
rs1045533208 191 dbSNP
rs1290564841 197 dbSNP
rs906940844 200 dbSNP
rs879338847 202 dbSNP
rs1175421778 204 dbSNP
rs565725930 204 dbSNP
rs1414285207 207 dbSNP
rs1483509959 207 dbSNP
rs1180216709 210 dbSNP
rs1258653826 214 dbSNP
rs1472421645 214 dbSNP
rs1001643279 218 dbSNP
rs1482552015 220 dbSNP
rs1184360367 228 dbSNP
rs191401127 233 dbSNP
rs893382467 234 dbSNP
rs1011797984 235 dbSNP
rs184104841 241 dbSNP
rs1227381504 246 dbSNP
rs967542398 250 dbSNP
rs767719939 251 dbSNP
rs575080376 253 dbSNP
rs775663369 256 dbSNP
rs1364507300 259 dbSNP
rs1430028115 260 dbSNP
rs542128701 261 dbSNP
rs953486030 262 dbSNP
rs187774960 264 dbSNP
rs779692504 265 dbSNP
rs1390910845 270 dbSNP
rs1157122326 272 dbSNP
rs760726234 278 dbSNP
rs909179341 280 dbSNP
rs1422397705 285 dbSNP
rs1255905395 295 dbSNP
rs1187551197 301 dbSNP
rs1441282658 301 dbSNP
rs1284704347 305 dbSNP
rs962958973 308 dbSNP
rs1207599056 310 dbSNP
rs1384907974 313 dbSNP
rs1243792643 319 dbSNP
rs1314484321 323 dbSNP
rs748726924 324 dbSNP
rs973960632 326 dbSNP
rs1343084043 328 dbSNP
rs1197748199 331 dbSNP
rs918490712 334 dbSNP
rs1362997538 335 dbSNP
rs1485569725 336 dbSNP
rs929826306 336 dbSNP
rs1271212584 350 dbSNP
rs1391588629 354 dbSNP
rs3542 356 dbSNP
rs541380271 357 dbSNP
rs1437600132 362 dbSNP
rs1368237555 367 dbSNP
rs1171638404 368 dbSNP
rs1211352639 369 dbSNP
rs1388913301 370 dbSNP
rs1188510594 372 dbSNP
rs1245438102 373 dbSNP
rs1268857904 379 dbSNP
rs768193869 381 dbSNP
rs575216815 388 dbSNP
rs928414288 388 dbSNP
rs1207098034 389 dbSNP
rs937068098 391 dbSNP
rs560295245 392 dbSNP
rs58936667 393 dbSNP
rs1234941781 398 dbSNP
rs1331690165 400 dbSNP
rs1303569142 402 dbSNP
rs1385301350 403 dbSNP
rs1390336858 403 dbSNP
rs761511932 403 dbSNP
rs1308991880 409 dbSNP
rs1431962204 410 dbSNP
rs1369129935 413 dbSNP
rs564239957 419 dbSNP
rs1168444112 421 dbSNP
rs1478676759 423 dbSNP
rs892774230 427 dbSNP
rs1475482855 431 dbSNP
rs1196183253 435 dbSNP
rs1432215490 442 dbSNP
rs1250736882 455 dbSNP
rs1183941655 464 dbSNP
rs1012261788 466 dbSNP
rs1393966328 476 dbSNP
rs1347117840 478 dbSNP
rs570947349 478 dbSNP
rs1409084563 479 dbSNP
rs1330619570 480 dbSNP
rs1289177812 481 dbSNP
rs1449869564 483 dbSNP
rs1411903573 487 dbSNP
rs1337159007 502 dbSNP
rs1307880901 504 dbSNP
rs903438117 506 dbSNP
rs997677908 508 dbSNP
rs1171356743 515 dbSNP
rs1030417442 524 dbSNP
rs1412067296 531 dbSNP
rs1336049481 535 dbSNP
rs1471441708 536 dbSNP
rs760694207 540 dbSNP
rs1365996179 541 dbSNP
rs1250798034 545 dbSNP
rs1188444031 550 dbSNP
rs953593128 554 dbSNP
rs1253937885 557 dbSNP
rs1199834616 561 dbSNP
rs528317738 567 dbSNP
rs753795229 568 dbSNP
rs574735983 575 dbSNP
rs1338987422 577 dbSNP
rs764088230 578 dbSNP
rs1288087714 582 dbSNP
rs1449145336 585 dbSNP
rs1342665812 586 dbSNP
rs1332689853 587 dbSNP
rs567228101 589 dbSNP
rs963432992 589 dbSNP
rs750098459 596 dbSNP
rs1491267015 605 dbSNP
rs1163506654 606 dbSNP
rs1473634171 606 dbSNP
rs542142107 606 dbSNP
rs1025603832 608 dbSNP
rs1186679955 611 dbSNP
rs1248688494 613 dbSNP
rs1249251303 618 dbSNP
rs1447074153 621 dbSNP
rs1463616184 622 dbSNP
rs1267696719 623 dbSNP
rs1229103155 628 dbSNP
rs1358835602 630 dbSNP
rs1244698667 633 dbSNP
rs951276233 633 dbSNP
rs1366615785 636 dbSNP
rs1321950045 638 dbSNP
rs765073462 639 dbSNP
rs750077928 643 dbSNP
rs1323734602 646 dbSNP
rs1406753667 648 dbSNP
rs1388304241 650 dbSNP
rs563614299 659 dbSNP
rs1391883825 662 dbSNP
rs937100328 662 dbSNP
rs991231128 662 dbSNP
rs1447659239 664 dbSNP
rs546785428 666 dbSNP
rs1222562339 669 dbSNP
rs914292660 679 dbSNP
rs947087586 680 dbSNP
rs1431111475 682 dbSNP
rs1300396299 685 dbSNP
rs1343348421 685 dbSNP
rs192442196 691 dbSNP
rs1175605375 694 dbSNP
rs1363755388 694 dbSNP
rs866226546 694 dbSNP
rs1438128670 695 dbSNP
rs1322498683 697 dbSNP
rs1329044053 697 dbSNP
rs1430120440 702 dbSNP
rs1372178629 705 dbSNP
rs1166572951 706 dbSNP
rs1418882370 709 dbSNP
rs747364871 709 dbSNP
rs1479118776 710 dbSNP
rs1041361374 711 dbSNP
rs1245157235 711 dbSNP
rs1277230567 711 dbSNP
rs903447858 711 dbSNP
rs1383932304 714 dbSNP
rs1307490907 715 dbSNP
rs1176676755 716 dbSNP
rs1220403667 716 dbSNP
rs1273808958 716 dbSNP
rs933538508 716 dbSNP
rs1410065658 720 dbSNP
rs1352078097 723 dbSNP
rs1306023002 728 dbSNP
rs1316332757 729 dbSNP
rs1326024935 737 dbSNP
rs1178172559 741 dbSNP
rs1437497829 741 dbSNP
rs201116439 742 dbSNP
rs113507272 743 dbSNP
rs61501443 743 dbSNP
rs760044903 743 dbSNP
rs889264293 746 dbSNP
rs112907912 747 dbSNP
rs113707949 748 dbSNP
rs1480523716 749 dbSNP
rs1238515048 756 dbSNP
rs1212864136 757 dbSNP
rs1223350695 767 dbSNP
rs550860005 771 dbSNP
rs879689734 779 dbSNP
rs1228612678 783 dbSNP
rs1330817686 784 dbSNP
rs1286206963 788 dbSNP
rs765683272 789 dbSNP
rs768233321 791 dbSNP
rs1379664633 799 dbSNP
rs1304452263 801 dbSNP
rs1357490774 806 dbSNP
rs1336237793 812 dbSNP
rs1457937906 815 dbSNP
rs1008120109 817 dbSNP
rs1016380340 819 dbSNP
rs1418794801 824 dbSNP
rs1259091247 826 dbSNP
rs568907820 827 dbSNP
rs1241949599 830 dbSNP
rs1208866270 839 dbSNP
rs1026281651 841 dbSNP
rs1465882712 841 dbSNP
rs1322040210 842 dbSNP
rs951286020 842 dbSNP
rs532937502 843 dbSNP
rs1028744720 844 dbSNP
rs1381998306 847 dbSNP
rs757984665 850 dbSNP
rs1175452554 861 dbSNP
rs958589438 862 dbSNP
rs1318718146 864 dbSNP
rs1453385640 865 dbSNP
rs76535650 869 dbSNP
rs1350826072 875 dbSNP
rs1167396579 878 dbSNP
rs1455303267 879 dbSNP
rs991723932 885 dbSNP
rs1189814103 887 dbSNP
rs1450723226 888 dbSNP
rs1245684308 890 dbSNP
rs1204174854 899 dbSNP
rs1488642489 901 dbSNP
rs1156854333 902 dbSNP
rs748220009 902 dbSNP
rs1384309425 907 dbSNP
rs1358503112 912 dbSNP
rs914367209 913 dbSNP
rs1425444101 919 dbSNP
rs182410403 923 dbSNP
rs1343877552 925 dbSNP
rs1404658067 930 dbSNP
rs1368630269 932 dbSNP
rs1381828799 932 dbSNP
rs545706562 932 dbSNP
rs977064449 936 dbSNP
rs779558013 938 dbSNP
rs1423091734 939 dbSNP
rs924249539 944 dbSNP
rs1169723473 955 dbSNP
rs1191899878 962 dbSNP
rs1308185360 962 dbSNP
rs1387779954 962 dbSNP
rs1432234518 962 dbSNP
rs1338006165 974 dbSNP
rs933590096 975 dbSNP
rs566580743 976 dbSNP
rs1490108066 980 dbSNP
rs1325734263 981 dbSNP
rs1340017637 981 dbSNP
rs1436288837 981 dbSNP
rs1052045025 982 dbSNP
rs533605151 983 dbSNP
rs564180814 986 dbSNP
rs1303599488 989 dbSNP
rs553552149 989 dbSNP
rs1489729983 992 dbSNP
rs1198362567 1003 dbSNP
rs1038275037 1014 dbSNP
rs899252863 1015 dbSNP
rs993548702 1015 dbSNP
rs1395029626 1019 dbSNP
rs528190698 1023 dbSNP
rs568524327 1024 dbSNP
rs1173795903 1027 dbSNP
rs770579066 1030 dbSNP
rs776262691 1030 dbSNP
rs1252230017 1031 dbSNP
rs1363221053 1034 dbSNP
rs1035645011 1035 dbSNP
rs1481961213 1036 dbSNP
rs1249688110 1047 dbSNP
rs1445242994 1054 dbSNP
rs1257897536 1065 dbSNP
rs1483587223 1065 dbSNP
rs1221907178 1066 dbSNP
rs953160888 1068 dbSNP
rs1012755527 1079 dbSNP
rs1165562110 1079 dbSNP
rs1021842741 1084 dbSNP
rs1334356681 1092 dbSNP
rs1328701569 1096 dbSNP
rs1363887763 1099 dbSNP
rs1397182415 1101 dbSNP
rs1403713679 1104 dbSNP
rs1424293676 1108 dbSNP
rs968450407 1111 dbSNP
rs1468943009 1112 dbSNP
rs1399051344 1116 dbSNP
rs1160963799 1117 dbSNP
rs56367619 1122 dbSNP
rs1468351160 1126 dbSNP
rs1390087841 1133 dbSNP
rs1188153169 1134 dbSNP
rs1444132856 1138 dbSNP
rs1258314013 1142 dbSNP
rs1201904882 1143 dbSNP
rs1306913988 1145 dbSNP
rs1384193854 1147 dbSNP
rs977115302 1149 dbSNP
rs924344577 1157 dbSNP
rs1015218242 1158 dbSNP
rs1356774907 1165 dbSNP
rs1220336964 1171 dbSNP
rs753293213 1178 dbSNP
rs1322073495 1182 dbSNP
rs536177606 1182 dbSNP
rs545362054 1182 dbSNP
rs1398654796 1184 dbSNP
rs1481489378 1193 dbSNP
rs1383972284 1195 dbSNP
rs1163667874 1201 dbSNP
rs1473724220 1201 dbSNP
rs987536675 1208 dbSNP
rs1182947930 1210 dbSNP
rs910845886 1214 dbSNP
rs1248784841 1217 dbSNP
rs943581061 1220 dbSNP
rs1445536652 1225 dbSNP
rs1249661121 1229 dbSNP
rs1037884043 1232 dbSNP
rs920732451 1235 dbSNP
rs557207872 1238 dbSNP
rs1358943103 1241 dbSNP
rs929394547 1248 dbSNP
rs1245907482 1262 dbSNP
rs1028424391 1263 dbSNP
rs546534995 1265 dbSNP
rs1299269189 1267 dbSNP
rs1428184451 1274 dbSNP
rs1325540789 1281 dbSNP
rs1323832871 1291 dbSNP
rs186756728 1299 dbSNP
rs1019823899 1305 dbSNP
rs764329792 1313 dbSNP
rs1171377165 1314 dbSNP
rs961561068 1316 dbSNP
rs1390831631 1321 dbSNP
rs1169773846 1332 dbSNP
rs17540338 1337 dbSNP
rs1027200040 1341 dbSNP
rs534434187 1343 dbSNP
rs1199853658 1345 dbSNP
rs1407421829 1350 dbSNP
rs193004110 1355 dbSNP
rs1013220565 1359 dbSNP
rs1335367466 1365 dbSNP
rs561935560 1366 dbSNP
rs1379914961 1369 dbSNP
rs1338218747 1377 dbSNP
rs1275008795 1379 dbSNP
rs1227301603 1380 dbSNP
rs1021430018 1383 dbSNP
rs1295760746 1386 dbSNP
rs926941580 1390 dbSNP
rs1308906598 1392 dbSNP
rs1372274435 1396 dbSNP
rs778191168 1400 dbSNP
rs749787208 1403 dbSNP
rs959808857 1406 dbSNP
rs529063224 1407 dbSNP
rs771206369 1411 dbSNP
rs544546806 1415 dbSNP
rs1481581523 1419 dbSNP
rs1427606907 1430 dbSNP
rs1199213230 1435 dbSNP
rs141901816 1435 dbSNP
rs879543078 1435 dbSNP
rs913093889 1437 dbSNP
rs1205456246 1440 dbSNP
rs1436667203 1440 dbSNP
rs1278793627 1442 dbSNP
rs1224932542 1446 dbSNP
rs1321032634 1448 dbSNP
rs1241259578 1456 dbSNP
rs562768545 1459 dbSNP
rs1228732930 1462 dbSNP
rs1187193301 1463 dbSNP
rs1264057516 1468 dbSNP
rs140689993 1474 dbSNP
rs150078684 1476 dbSNP
rs1354010041 1477 dbSNP
rs1334982806 1479 dbSNP
rs925864255 1480 dbSNP
rs1471068378 1490 dbSNP
rs1430383650 1493 dbSNP
rs184557755 1497 dbSNP
rs1471190085 1499 dbSNP
rs965005973 1502 dbSNP
rs1405996703 1506 dbSNP
rs936673524 1506 dbSNP
rs1175981816 1508 dbSNP
rs1470109508 1510 dbSNP
rs974041179 1511 dbSNP
rs1049780903 1516 dbSNP
rs138663784 1518 dbSNP
rs190272319 1519 dbSNP
rs1208977567 1523 dbSNP
rs147104026 1524 dbSNP
rs374369077 1524 dbSNP
rs1380133742 1525 dbSNP
rs1304689102 1528 dbSNP
rs1041133283 1530 dbSNP
rs1223117455 1533 dbSNP
rs1277229267 1535 dbSNP
rs1323970918 1538 dbSNP
rs897319160 1541 dbSNP
rs1454610726 1546 dbSNP
rs920829167 1549 dbSNP
rs1336259580 1560 dbSNP
rs1225183572 1562 dbSNP
rs1261107088 1564 dbSNP
rs994314748 1565 dbSNP
rs1311548951 1566 dbSNP
rs1400512731 1567 dbSNP
rs1415108011 1578 dbSNP
rs1185964524 1583 dbSNP
rs1442173970 1584 dbSNP
rs1188802720 1585 dbSNP
rs1242049306 1585 dbSNP
rs1027664638 1589 dbSNP
rs568663965 1595 dbSNP
rs1001726129 1598 dbSNP
rs929490888 1600 dbSNP
rs1034008502 1601 dbSNP
rs1243703694 1606 dbSNP
rs1293771766 1606 dbSNP
rs1262603674 1607 dbSNP
rs201021914 1607 dbSNP
rs1382966770 1608 dbSNP
rs549828106 1610 dbSNP
rs66526307 1610 dbSNP
rs755053801 1610 dbSNP
rs1287366951 1611 dbSNP
rs34235517 1611 dbSNP
rs1430368256 1612 dbSNP
rs75737026 1613 dbSNP
rs535648378 1614 dbSNP
rs1423368219 1616 dbSNP
rs1384045279 1622 dbSNP
rs992537672 1623 dbSNP
rs1168735159 1627 dbSNP
rs1429803420 1628 dbSNP
rs1481621938 1634 dbSNP
rs939397851 1637 dbSNP
rs912945389 1642 dbSNP
rs1055145498 1645 dbSNP
rs1250970677 1648 dbSNP
rs774721388 1654 dbSNP
rs1358701208 1655 dbSNP
rs978594332 1658 dbSNP
rs746116585 1662 dbSNP
rs1228193622 1672 dbSNP
rs925758533 1676 dbSNP
rs557274888 1680 dbSNP
rs1401827497 1681 dbSNP
rs1381918950 1682 dbSNP
rs904439632 1683 dbSNP
rs1161958236 1688 dbSNP
rs772379137 1691 dbSNP
rs931915463 1692 dbSNP
rs1403616073 1696 dbSNP
rs199892604 1697 dbSNP
rs569219790 1697 dbSNP
rs998686445 1697 dbSNP
rs1299277101 1700 dbSNP
rs1050326448 1702 dbSNP
rs1031428260 1709 dbSNP
rs1370858021 1712 dbSNP
rs1451066353 1717 dbSNP
rs1169296559 1720 dbSNP
rs911266212 1726 dbSNP
rs943982177 1728 dbSNP
rs1490133811 1729 dbSNP
rs1041536518 1731 dbSNP
rs1345760825 1735 dbSNP
rs1009036305 1740 dbSNP
rs1481649171 1751 dbSNP
rs1017289695 1752 dbSNP
rs143806443 1752 dbSNP
rs371569576 1752 dbSNP
rs550172013 1752 dbSNP
rs897212098 1753 dbSNP
rs1324603200 1758 dbSNP
rs1285456751 1759 dbSNP
rs994764659 1762 dbSNP
rs1416074030 1763 dbSNP
rs1202027995 1764 dbSNP
rs1241768251 1764 dbSNP
rs1280576625 1764 dbSNP
rs1306949480 1764 dbSNP
rs1334270290 1764 dbSNP
rs1334453591 1764 dbSNP
rs1358187822 1764 dbSNP
rs1384377197 1764 dbSNP
rs1435429541 1764 dbSNP
rs144696725 1764 dbSNP
rs3222636 1764 dbSNP
rs746917875 1764 dbSNP
rs776305326 1764 dbSNP
rs964756160 1764 dbSNP
rs973053169 1764 dbSNP
rs1469029207 1765 dbSNP
rs71875062 1766 dbSNP
rs1385362138 1767 dbSNP
rs1160132997 1771 dbSNP
rs1281173016 1775 dbSNP
rs1363121444 1776 dbSNP
rs1184138234 1777 dbSNP
rs1245108049 1778 dbSNP
rs1048582470 1779 dbSNP
rs1461073122 1779 dbSNP
rs1285368346 1780 dbSNP
rs1027943371 1781 dbSNP
rs1348984987 1783 dbSNP
rs888604940 1783 dbSNP
rs983626568 1783 dbSNP
rs1247415711 1785 dbSNP
rs1312327273 1785 dbSNP
rs1451430987 1785 dbSNP
rs764817136 1785 dbSNP
rs769470085 1785 dbSNP
rs928088879 1785 dbSNP
rs1326600533 1786 dbSNP
rs1380246541 1787 dbSNP
rs765999023 1787 dbSNP
rs916654204 1789 dbSNP
rs991333516 1789 dbSNP
rs1001778671 1791 dbSNP
rs1161808616 1791 dbSNP
rs1426550500 1791 dbSNP
rs946740138 1791 dbSNP
rs1043704165 1793 dbSNP
rs192838192 1793 dbSNP
rs904453348 1793 dbSNP
rs1404777915 1794 dbSNP
rs397760648 1794 dbSNP
rs62015201 1795 dbSNP
rs1013892293 1796 dbSNP
rs1474572492 1796 dbSNP
rs557755181 1797 dbSNP
rs1200534975 1798 dbSNP
rs1267305769 1799 dbSNP
rs573120912 1799 dbSNP
rs1315188663 1801 dbSNP
rs540755469 1801 dbSNP
rs1216071759 1802 dbSNP
rs1193688884 1803 dbSNP
rs1225044936 1804 dbSNP
rs1283555077 1804 dbSNP
rs200380389 1804 dbSNP
rs1442915918 1805 dbSNP
rs967177831 1807 dbSNP
rs184783192 1808 dbSNP
rs1331031294 1813 dbSNP
rs1408298227 1813 dbSNP
rs149412059 1819 dbSNP
rs1177427147 1821 dbSNP
rs1246457736 1829 dbSNP
rs1470743147 1835 dbSNP
rs1052899400 1836 dbSNP
rs1179445962 1836 dbSNP
rs1234097485 1838 dbSNP
rs1406506774 1839 dbSNP
rs1416723025 1842 dbSNP
rs1456956956 1844 dbSNP
rs1157544348 1845 dbSNP
rs1365763108 1850 dbSNP
rs531438521 1851 dbSNP
rs1321138246 1852 dbSNP
rs890264247 1852 dbSNP
rs1008714496 1854 dbSNP
rs953189441 1858 dbSNP
rs559138891 1859 dbSNP
rs775828656 1859 dbSNP
rs1281209758 1863 dbSNP
rs1376271587 1864 dbSNP
rs1371102674 1866 dbSNP
rs867996805 1870 dbSNP
rs1239452438 1877 dbSNP
rs1471117278 1881 dbSNP
rs1404326222 1882 dbSNP
rs900242883 1889 dbSNP
rs189437506 1892 dbSNP
rs1027289271 1893 dbSNP
rs944034668 1894 dbSNP
rs1459739606 1899 dbSNP
rs533287224 1899 dbSNP
rs950957707 1900 dbSNP
rs1216188059 1904 dbSNP
rs976757663 1906 dbSNP
rs201443692 1908 dbSNP
rs983679449 1908 dbSNP
rs565161846 1912 dbSNP
rs961186957 1912 dbSNP
rs144725916 1913 dbSNP
rs1377193815 1914 dbSNP
rs1302521661 1923 dbSNP
rs865773795 1924 dbSNP
rs552904038 1925 dbSNP
rs755988587 1930 dbSNP
rs1048951852 1932 dbSNP
rs934599062 1934 dbSNP
rs888615811 1940 dbSNP
rs890365931 1941 dbSNP
rs937474337 1945 dbSNP
rs1055983370 1948 dbSNP
rs527268513 1949 dbSNP
rs181830706 1952 dbSNP
rs1486718231 1961 dbSNP
rs1410260721 1967 dbSNP
rs1330660648 1973 dbSNP
rs1038864272 1980 dbSNP
rs900256550 1988 dbSNP
rs1490507686 1995 dbSNP
rs1293893072 2010 dbSNP
rs560809564 2012 dbSNP
rs1337365316 2013 dbSNP
rs1312259134 2015 dbSNP
rs1215444534 2016 dbSNP
rs1364480703 2017 dbSNP
rs761739810 2021 dbSNP
rs531267736 2025 dbSNP
rs1048777478 2026 dbSNP
rs886128971 2027 dbSNP
rs1019976976 2028 dbSNP
rs1004536215 2030 dbSNP
rs779826025 2036 dbSNP
rs902840511 2043 dbSNP
rs1192611281 2045 dbSNP
rs1270879389 2047 dbSNP
rs1220183732 2048 dbSNP
rs1340336343 2050 dbSNP
rs1264975871 2052 dbSNP
rs1487542263 2052 dbSNP
rs960983918 2056 dbSNP
rs1012830203 2057 dbSNP
rs1054704 2060 dbSNP
rs1216644267 2061 dbSNP
rs1023772401 2064 dbSNP
rs367905903 2065 dbSNP
rs1389351523 2067 dbSNP
rs569083871 2073 dbSNP
rs539763008 2074 dbSNP
rs953201510 2076 dbSNP
rs1294651661 2078 dbSNP
rs956733432 2087 dbSNP
rs985934912 2087 dbSNP
rs1245579648 2099 dbSNP
rs986810853 2101 dbSNP
rs1470074858 2105 dbSNP
rs911837782 2116 dbSNP
rs551772920 2117 dbSNP
rs868449463 2119 dbSNP
rs1432566288 2126 dbSNP
rs1251179450 2128 dbSNP
rs750165866 2128 dbSNP
rs1184787561 2129 dbSNP
rs1177810431 2130 dbSNP
rs1481661338 2131 dbSNP
rs944601146 2131 dbSNP
rs1393108986 2142 dbSNP
rs1039290781 2145 dbSNP
rs1198314902 2148 dbSNP
rs1324713614 2149 dbSNP
rs566886529 2152 dbSNP
rs758074588 2153 dbSNP
rs1231681591 2155 dbSNP
rs921762995 2164 dbSNP
rs930444784 2172 dbSNP
rs75079637 2173 dbSNP
rs141905184 2175 dbSNP
rs1464960636 2176 dbSNP
rs1004588697 2194 dbSNP
rs1408215351 2199 dbSNP
rs1465382946 2201 dbSNP
rs918632171 2203 dbSNP
rs1333620914 2204 dbSNP
rs929925458 2207 dbSNP
rs984228633 2208 dbSNP
rs909940285 2212 dbSNP
rs75093650 2222 dbSNP
rs1236503270 2223 dbSNP
rs751191260 2224 dbSNP
rs1433119452 2225 dbSNP
rs1178226236 2231 dbSNP
rs1268689042 2234 dbSNP
rs547326877 2238 dbSNP
rs896740064 2239 dbSNP
rs1245226907 2242 dbSNP
rs1199054076 2249 dbSNP
rs1344760267 2249 dbSNP
rs1055911674 2251 dbSNP
rs895974804 2255 dbSNP
rs1012473823 2262 dbSNP
rs1307955269 2266 dbSNP
rs1452754917 2266 dbSNP
rs1340289139 2272 dbSNP
rs1331794877 2276 dbSNP
rs1024244319 2291 dbSNP
rs1385475173 2297 dbSNP
rs1224583478 2301 dbSNP
rs1417830898 2308 dbSNP
rs1378527878 2310 dbSNP
rs1158075914 2312 dbSNP
rs1445351705 2318 dbSNP
rs1265475659 2321 dbSNP
rs1322054706 2331 dbSNP
rs538313710 2344 dbSNP
rs1042359733 2347 dbSNP
rs1277252833 2354 dbSNP
rs1487563880 2360 dbSNP
rs902851373 2361 dbSNP
rs114123009 2365 dbSNP
rs1360989375 2366 dbSNP
rs1282049652 2369 dbSNP
rs1243700117 2370 dbSNP
rs867726785 2371 dbSNP
rs1326772929 2372 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.679 5.0e-4 0.779 2.6e-5 20 Click to see details
GSE21032 Prostate cancer 0.305 2.5e-3 0.203 3.3e-2 83 Click to see details
GSE32688 Pancreatic cancer 0.389 1.4e-2 0.246 8.7e-2 32 Click to see details
GSE38226 Liver fibrosis 0.352 5.9e-2 0.419 2.9e-2 21 Click to see details
GSE21849 B cell lymphoma -0.288 6.5e-2 0.085 3.3e-1 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.296 7.5e-2 0.415 2.0e-2 25 Click to see details
GSE17498 Multiple myeloma -0.229 7.8e-2 -0.225 8.1e-2 40 Click to see details
GSE19536 Breast cancer -0.143 7.8e-2 -0.081 2.1e-1 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.276 1.2e-1 -0.122 3.0e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.287 1.8e-1 0.224 2.4e-1 12 Click to see details
GSE28544 Breast cancer -0.164 2.2e-1 -0.587 1.3e-3 24 Click to see details
GSE19783 ER- ER- breast cancer -0.073 2.6e-1 -0.090 2.2e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells -0.097 3.3e-1 -0.058 3.9e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.048 3.3e-1 0.031 3.9e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.107 3.5e-1 0.209 2.2e-1 16 Click to see details
GSE28260 Renal cortex and medulla 0.112 3.6e-1 -0.071 4.1e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.071 3.7e-1 -0.077 3.6e-1 25 Click to see details
GSE17306 Multiple myeloma 0.045 3.8e-1 0.070 3.2e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.034 3.9e-1 -0.043 3.7e-1 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.039 4.3e-1 -0.069 3.8e-1 23 Click to see details
GSE42095 Differentiated embryonic stem cells 0.039 4.3e-1 -0.069 3.8e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.59 0 0.590 0 32 Click to see details
KIRC 0.337 0 0.372 0 68 Click to see details
BLCA 0.531 0.01 0.492 0.02 18 Click to see details
HNSC 0.319 0.02 0.379 0.01 42 Click to see details
BRCA -0.122 0.13 -0.131 0.12 84 Click to see details
COAD -0.385 0.17 -0.667 0.04 8 Click to see details
CESC 0.836 0.18 0.500 0.33 3 Click to see details
UCEC 0.164 0.25 0.093 0.35 19 Click to see details
KIRP 0.115 0.27 0.022 0.45 32 Click to see details
THCA -0.08 0.27 -0.136 0.15 59 Click to see details
PAAD -0.387 0.31 -0.800 0.1 4 Click to see details
LUAD 0.144 0.33 0.196 0.27 12 Click to see details
CHOL -0.173 0.33 -0.033 0.47 9 Click to see details
LUSC -0.065 0.35 -0.173 0.15 38 Click to see details
KICH 0.074 0.36 0.077 0.36 25 Click to see details
ESCA 0.07 0.42 -0.091 0.4 11 Click to see details
PRAD 0.023 0.44 0.099 0.25 50 Click to see details
LIHC -0.023 0.44 -0.026 0.43 49 Click to see details
PCPG -0.108 0.47 0.500 0.33 3 Click to see details
PCPG -0.108 0.47 0.500 0.33 3 Click to see details
PCPG -0.108 0.47 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*