miRTarBase - #MIRT051345 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FOXO1   
Synonyms FKH1, FKHR, FOXO1A
Description forkhead box O1
Transcript NM_002015   
Expression
Putative miRNA Targets on FOXO1
3'UTR of FOXO1
(miRNA target sites are highlighted)
>FOXO1|NM_002015|3'UTR
   1 GGGTTAGTGAGCAGGTTACACTTAAAAGTACTTCAGATTGTCTGACAGCAGGAACTGAGAGAAGCAGTCCAAAGATGTCT
  81 TTCACCAACTCCCTTTTAGTTTTCTTGGTTAAAAAAAAAAACAAAAAAAAAAACCCTCCTTTTTTCCTTTCGTCAGACTT
 161 GGCAGCAAAGACATTTTTCCTGTACAGGATGTTTGCCCAATGTGTGCAGGTTATGTGCTGCTGTAGATAAGGACTGTGCC
 241 ATTGGAAATTTCATTACAATGAAGTGCCAAACTCACTACACCATATAATTGCAGAAAAGATTTTCAGATCCTGGTGTGCT
 321 TTCAAGTTTTGTATATAAGCAGTAGATACAGATTGTATTTGTGTGTGTTTTTGGTTTTTCTAAATATCCAATTGGTCCAA
 401 GGAAAGTTTATACTCTTTTTGTAATACTGTGATGGGCCTCATGTCTTGATAAGTTAAACTTTTGTTTGTACTACCTGTTT
 481 TCTGCGGAACTGACGGATCACAAAGAACTGAATCTCCATTCTGCATCTCCATTGAACAGCCTTGGACCTGTTCACGTTGC
 561 CACAGAATTCACATGAGAACCAAGTAGCCTGTTATCAATCTGCTAAATTAATGGACTTGTTAAACTTTTGGAAAAAAAAA
 641 GATTAAATGCCAGCTTTGTACAGGTCTTTTCTATTTTTTTTTGTTTATTTTGTTATTTGCAAATTTGTACAAACATTTAA
 721 ATGGTTCTAATTTCCAGATAAATGATTTTTGATGTTATTGTTGGGACTTAAGAACATTTTTGGAATAGATATTGAACTGT
 801 AATAATGTTTTCTTAAAACTAGAGTCTACTTTGTTACATAGTCAGCTTGTAAATTTTGTGGAACCACAGGTATTTGGGGC
 881 AGCATTCATAATTTTCATTTTGTATTCTAACTGGATTAGTACTAATTTTATACATGCTTAACTGGTTTGTACACTTTGGG
 961 ATGCTACTTAGTGATGTTTCTGACTAATCTTAAATCATTGTAATTAGTACTTGCATATTCAACGTTTCAGGCCCTGGTTG
1041 GGCAGGAAAGTGATGTATAGTTATGGACACTTTGCGTTTCTTATTTAGGATAACTTAATATGTTTTTATGTATGTATTTT
1121 AAAGAAATTTCATCTGCTTCTACTGAACTATGCGTACTGCATAGCATCAAGTCTTCTCTAGAGACCTCTGTAGTCCTGGG
1201 AGGCCTCATAATGTTTGTAGATCAGAAAAGGGAGATCTGCATCTAAAGCAATGGTCCTTTGTCAAACGAGGGATTTTGAT
1281 CCACTTCACCATTTTGAGTTGAGCTTTAGCAAAAGTTTCCCCTCATAATTCTTTGCTCTTGTTTCAGTCCAGGTGGAGGT
1361 TGGTTTTGTAGTTCTGCCTTGAGGAATTATGTCAACACTCATACTTCATCTCATTCTCCCTTCTGCCCTGCAGATTAGAT
1441 TACTTAGCACACTGTGGAAGTTTAAGTGGAAGGAGGGAATTTAAAAATGGGACTTGAGTGGTTTGTAGAATTTGTGTTCA
1521 TAAGTTCAGATGGGTAGCAAATGGAATAGAACTTACTTAAAAATTGGGGAGATTTATTTGAAAACCAGCTGTAAGTTGTG
1601 CATTGAGATTATGTTAAAAGCCTTGGCTTAAGAATTTGAAAATTTCTTTAGCCTGTAGCAACCTAAACTGTAATTCCTAT
1681 CATTATGTTTTATTACTTTCCAATTACCTGTAACTGACAGACCAAATTAATTGGCTTTGTGTCCTATTTAGTCCATCAGT
1761 ATTTTCAAGTCATGTGGAAAGCCCAAAGTCATCACAATGAAGAGAACAGGTGCACAGCACTGTTCCTCTTGTGTTCTTGA
1841 GAAGGATCTAATTTTTCTGTATATAGCCCACATCACACTTGCTTTGTCTTGTATGTTAATTGCATCTTCATTGGCTTGGT
1921 ATTTCCTAAATGTTTAACAAGAACACAAGTGTTCCTGATAAGATTTCCTACAGTAAGCCAGCTCTATTGTAAGCTTCCCA
2001 CTGTGATGATCATTTTTTTGAAGATTCATTGAACAGCCACCACTCTATCATCCTCATTTTGGGGCAGTCCAAGACATAGC
2081 TGGTTTTAGAAACCCAAGTTCCTCTAAGCACAGCCTCCCGGGTATGTAACTGAACTTGGTGCCAAAGTACTTGTGTACTA
2161 ATTTCTATTACTACGTACTGTCACTTTCCTCCCGTGCCATTACTGCATCATAATACAAGGAACCTCAGAGCCCCCATTTG
2241 TTCATTAAAGAGGCAACTACAGCCAAAATCACTGTTAAAATCTTACTACTTCATGGAGTAGCTCTTAGGAAAATATATCT
2321 TCCTCCTGAGTCTGGGTAATTATACCTCTCCCAAGCCCCCATTGTGTGTTGAAATCCTGTCATGAATCCTTGGTAGCTCT
2401 CTGAGAACAGTGAAGTCCAGGGAAAGGCATCTGGTCTGTCTGGAAAGCAAACATTATGTGGCCTCTGGTAGTTTTTTTCC
2481 TGTAAGAATACTGACTTTCTGGAGTAATGAGTATATATCAGTTATTGTACATGATTGCTTTGTGAAATGTGCAAATGATA
2561 TCACCTATGCAGCCTTGTTTGATTTATTTTCTCTGGTTTGTACTGTTATTAAAAGCATATTGTATTATAGAGCTATTCAG
2641 ATATTTTAAATATAAAGATGTATTGTTTCCGTAATATAGACGTATGGAATATATTTAGGTAATAGATGTATTACTTGGAA
2721 AGTTCTGCTTTGACAAACTGACAAAGTCTAAATGAGCACATGTATCCCAGTGAGCAGTAAATCAATGGAACATCCCAAGA
2801 AGAGGATAAGGATGCTTAAAATGGAAATCATTCTCCAACGATATACAAATTGGACTTGTTCAACTGCTGGATATATGCTA
2881 CCAATAACCCCAGCCCCAACTTAAAATTCTTACATTCAAGCTCCTAAGAGTTCTTAATTTATAACTAATTTTAAAAGAGA
2961 AGTTTCTTTTCTGGTTTTAGTTTGGGAATAATCATTCATTAAAAAAAATGTATTGTGGTTTATGCGAACAGACCAACCTG
3041 GCATTACAGTTGGCCTCTCCTTGAGGTGGGCACAGCCTGGCAGTGTGGCCAGGGGTGGCCATGTAAGTCCCATCAGGACG
3121 TAGTCATGCCTCCTGCATTTCGCTACCCGAGTTTAGTAACAGTGCAGATTCCACGTTCTTGTTCCGATACTCTGAGAAGT
3201 GCCTGATGTTGATGTACTTACAGACACAAGAACAATCTTTGCTATAATTGTATAAAGCCATAAATGTACATAAATTATGT
3281 TTAAATGGCTTGGTGTCTTTCTTTTCTAATTATGCAGAATAAGCTCTTTATTAGGAATTTTTTGTGAAGCTATTAAATAC
3361 TTGAGTTAAGTCTTGTCAGCCACAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  :|||||||||||| 
Target 5' gtgtgcagGTTATGTGCTGCTg 3'
202 - 223 166.00 -19.40
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||:: | || |||| || 
Target 5' aagAAATT-TCATCTGCTTCTa 3'
1122 - 1142 126.00 -7.70
3
miRNA  3' guGUUU---GGUAAUACACGACgau 5'
            |||:   |||||:||||:||   
Target 5' ccCAAGCCCCCATTGTGTGTTGaaa 3'
2350 - 2374 124.00 -18.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20217081 376 COSMIC
COSN31769750 455 COSMIC
COSN26507089 469 COSMIC
COSN30176241 526 COSMIC
COSN20110644 584 COSMIC
COSN6410318 584 COSMIC
COSN22286442 595 COSMIC
COSN27388934 596 COSMIC
COSN30918998 597 COSMIC
COSN31597224 598 COSMIC
COSN17794089 599 COSMIC
COSN31769749 644 COSMIC
COSN26562101 746 COSMIC
COSN1158423 1104 COSMIC
COSN20110642 1106 COSMIC
COSN31603264 1147 COSMIC
COSN26505348 1157 COSMIC
COSN26504784 1161 COSMIC
COSN31596364 1302 COSMIC
COSN15671184 1308 COSMIC
COSN31534736 1364 COSMIC
COSN21469583 1410 COSMIC
COSN21468658 1411 COSMIC
COSN28637105 1470 COSMIC
COSN31959615 1487 COSMIC
COSN24031972 2054 COSMIC
COSN17038074 2120 COSMIC
COSN31769748 2393 COSMIC
COSN9746536 2407 COSMIC
COSN8592063 2565 COSMIC
COSN8129497 2665 COSMIC
COSN27199453 2711 COSMIC
COSN24608100 2934 COSMIC
COSN31479567 2960 COSMIC
COSN26566346 3012 COSMIC
COSN15662334 3104 COSMIC
COSN23525455 3145 COSMIC
COSN8587576 3153 COSMIC
COSN31541282 3286 COSMIC
COSN19018068 3365 COSMIC
COSN8587575 3557 COSMIC
COSN31566846 3800 COSMIC
rs3841231 1114 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs745343501 8 dbSNP
rs1461720726 12 dbSNP
rs954719653 13 dbSNP
rs749877266 14 dbSNP
rs1430919534 15 dbSNP
rs374930087 17 dbSNP
rs1020662472 19 dbSNP
rs1193545322 21 dbSNP
rs1455138489 24 dbSNP
rs770526416 29 dbSNP
rs747509005 30 dbSNP
rs1457620341 35 dbSNP
rs778492835 38 dbSNP
rs1187160712 41 dbSNP
rs1009738135 53 dbSNP
rs957725137 60 dbSNP
rs562138604 64 dbSNP
rs781392626 65 dbSNP
rs976584585 66 dbSNP
rs555894254 71 dbSNP
rs1018227132 74 dbSNP
rs759124635 75 dbSNP
rs186583526 85 dbSNP
rs1312114299 86 dbSNP
rs1412543723 88 dbSNP
rs539369700 94 dbSNP
rs1347444893 97 dbSNP
rs571100538 113 dbSNP
rs1044648857 123 dbSNP
rs1168371159 132 dbSNP
rs1461067767 134 dbSNP
rs958087335 136 dbSNP
rs769157838 140 dbSNP
rs1032322935 143 dbSNP
rs181811457 144 dbSNP
rs1323938195 147 dbSNP
rs1047802662 148 dbSNP
rs112585563 149 dbSNP
rs548764406 151 dbSNP
rs115476993 155 dbSNP
rs568695333 164 dbSNP
rs1013744652 173 dbSNP
rs1479582337 175 dbSNP
rs1201811804 181 dbSNP
rs895295212 181 dbSNP
rs1472498775 192 dbSNP
rs757675738 211 dbSNP
rs1387863058 212 dbSNP
rs1055405303 229 dbSNP
rs1318418077 231 dbSNP
rs943362288 233 dbSNP
rs942295271 236 dbSNP
rs1304528005 237 dbSNP
rs1274350109 242 dbSNP
rs751966396 243 dbSNP
rs1238112318 246 dbSNP
rs1277551395 250 dbSNP
rs548765994 272 dbSNP
rs1224205308 276 dbSNP
rs1337981718 278 dbSNP
rs987388012 282 dbSNP
rs954534953 283 dbSNP
rs929590980 288 dbSNP
rs918380701 293 dbSNP
rs533899019 308 dbSNP
rs976491402 310 dbSNP
rs571218689 317 dbSNP
rs1365846966 319 dbSNP
rs1470799516 328 dbSNP
rs1355139950 335 dbSNP
rs1163142319 339 dbSNP
rs1384092813 345 dbSNP
rs1422264391 352 dbSNP
rs764605004 361 dbSNP
rs1164902453 363 dbSNP
rs1291599237 368 dbSNP
rs913758131 379 dbSNP
rs987891238 380 dbSNP
rs911026637 388 dbSNP
rs372533319 392 dbSNP
rs1442866441 395 dbSNP
rs762959559 401 dbSNP
rs1001803135 412 dbSNP
rs1357155052 420 dbSNP
rs752776640 422 dbSNP
rs1398005728 423 dbSNP
rs1341734771 424 dbSNP
rs1279633473 426 dbSNP
rs144231048 429 dbSNP
rs367970399 430 dbSNP
rs569288354 436 dbSNP
rs1187252082 443 dbSNP
rs895980829 448 dbSNP
rs1241875192 454 dbSNP
rs1446970282 455 dbSNP
rs759663800 456 dbSNP
rs1416730208 457 dbSNP
rs1025048039 459 dbSNP
rs993582467 461 dbSNP
rs777291566 466 dbSNP
rs899214413 466 dbSNP
rs374809079 467 dbSNP
rs1380571262 470 dbSNP
rs73463242 471 dbSNP
rs1233859054 473 dbSNP
rs1454459479 479 dbSNP
rs564072154 484 dbSNP
rs1325886056 492 dbSNP
rs1225543620 509 dbSNP
rs1181509603 514 dbSNP
rs1034277821 530 dbSNP
rs189789024 543 dbSNP
rs1255439910 552 dbSNP
rs1261645712 553 dbSNP
rs888031507 557 dbSNP
rs527551438 560 dbSNP
rs1243244025 568 dbSNP
rs929664248 572 dbSNP
rs933257722 572 dbSNP
rs1334178226 573 dbSNP
rs3751437 580 dbSNP
rs1225646044 584 dbSNP
rs1351641415 589 dbSNP
rs1403538718 590 dbSNP
rs1040838594 592 dbSNP
rs1441199018 593 dbSNP
rs943801669 593 dbSNP
rs910942618 594 dbSNP
rs1297813164 595 dbSNP
rs1327308458 596 dbSNP
rs200144910 596 dbSNP
rs73173152 596 dbSNP
rs1204685822 597 dbSNP
rs1389643935 597 dbSNP
rs1374574697 598 dbSNP
rs988352472 598 dbSNP
rs1202908530 599 dbSNP
rs541965979 599 dbSNP
rs957916800 600 dbSNP
rs1393047165 601 dbSNP
rs1320977225 605 dbSNP
rs576057357 607 dbSNP
rs1451527515 608 dbSNP
rs768846140 608 dbSNP
rs1290725539 609 dbSNP
rs61963698 610 dbSNP
rs924995701 614 dbSNP
rs1408249052 619 dbSNP
rs1158422356 620 dbSNP
rs1438151160 622 dbSNP
rs980498705 625 dbSNP
rs969020810 626 dbSNP
rs925241928 634 dbSNP
rs1315670925 635 dbSNP
rs562596600 636 dbSNP
rs1262013590 644 dbSNP
rs9532558 645 dbSNP
rs960594747 646 dbSNP
rs1026579207 647 dbSNP
rs1266383901 660 dbSNP
rs774099661 664 dbSNP
rs576754289 665 dbSNP
rs1191618788 673 dbSNP
rs1490737750 673 dbSNP
rs1249487761 678 dbSNP
rs1447863717 683 dbSNP
rs1283742304 687 dbSNP
rs1161138160 689 dbSNP
rs1364287477 692 dbSNP
rs553776902 694 dbSNP
rs1239172990 697 dbSNP
rs1351169829 698 dbSNP
rs1161739424 709 dbSNP
rs1367749457 713 dbSNP
rs1024951493 716 dbSNP
rs1297966635 718 dbSNP
rs1371574970 727 dbSNP
rs1159643329 729 dbSNP
rs1308400820 733 dbSNP
rs1305576879 749 dbSNP
rs992144733 750 dbSNP
rs534513928 754 dbSNP
rs768721318 755 dbSNP
rs959728934 759 dbSNP
rs1221762941 772 dbSNP
rs1016321477 773 dbSNP
rs530277142 779 dbSNP
rs749308261 784 dbSNP
rs1234978281 788 dbSNP
rs575145761 798 dbSNP
rs1007680937 799 dbSNP
rs1006842623 805 dbSNP
rs1443914494 809 dbSNP
rs1366792896 813 dbSNP
rs889118107 821 dbSNP
rs1026597182 825 dbSNP
rs1052228146 826 dbSNP
rs1352961719 834 dbSNP
rs1041119894 837 dbSNP
rs370137322 842 dbSNP
rs1382776691 844 dbSNP
rs1007857453 847 dbSNP
rs143915100 856 dbSNP
rs569291864 861 dbSNP
rs377399089 865 dbSNP
rs1271900211 873 dbSNP
rs925103729 875 dbSNP
rs139933205 879 dbSNP
rs1454265212 881 dbSNP
rs925154335 889 dbSNP
rs566549109 890 dbSNP
rs980488815 891 dbSNP
rs780924281 895 dbSNP
rs1473197500 902 dbSNP
rs183906523 922 dbSNP
rs527788428 923 dbSNP
rs147514273 925 dbSNP
rs561601058 936 dbSNP
rs1026943245 940 dbSNP
rs1282261799 944 dbSNP
rs1339212381 945 dbSNP
rs1407438885 947 dbSNP
rs1211317201 959 dbSNP
rs1269062324 960 dbSNP
rs1215889789 961 dbSNP
rs1359442930 961 dbSNP
rs1311601866 963 dbSNP
rs1278637935 968 dbSNP
rs548128955 969 dbSNP
rs1221446433 981 dbSNP
rs1215830966 985 dbSNP
rs993635184 991 dbSNP
rs564906736 992 dbSNP
rs1240372550 995 dbSNP
rs1486976078 999 dbSNP
rs1277219060 1005 dbSNP
rs1194607244 1008 dbSNP
rs562474119 1008 dbSNP
rs1429055162 1009 dbSNP
rs1479683653 1017 dbSNP
rs778591760 1029 dbSNP
rs1007636466 1030 dbSNP
rs889176998 1038 dbSNP
rs1030435180 1049 dbSNP
rs1342885290 1050 dbSNP
rs1401482481 1051 dbSNP
rs1298480131 1062 dbSNP
rs1344447394 1069 dbSNP
rs1221534795 1074 dbSNP
rs997887775 1081 dbSNP
rs545908490 1096 dbSNP
rs1345651156 1097 dbSNP
rs889450308 1099 dbSNP
rs1282285230 1102 dbSNP
rs200586791 1106 dbSNP
rs201477809 1106 dbSNP
rs1217405258 1113 dbSNP
rs1202057010 1115 dbSNP
rs1268533777 1115 dbSNP
rs3841231 1115 dbSNP
rs397686405 1115 dbSNP
rs1357940007 1117 dbSNP
rs1173101615 1121 dbSNP
rs903585018 1123 dbSNP
rs1421034899 1124 dbSNP
rs1410633741 1125 dbSNP
rs1364639044 1127 dbSNP
rs1402654941 1137 dbSNP
rs1325286379 1138 dbSNP
rs1331435488 1139 dbSNP
rs1441419418 1143 dbSNP
rs1277754365 1147 dbSNP
rs1379018918 1148 dbSNP
rs34885278 1148 dbSNP
rs1357557142 1157 dbSNP
rs3841230 1157 dbSNP
rs765881230 1157 dbSNP
rs796726025 1157 dbSNP
rs1224953702 1161 dbSNP
rs1418944156 1161 dbSNP
rs575914593 1166 dbSNP
rs1476343205 1174 dbSNP
rs1258482759 1176 dbSNP
rs113962714 1179 dbSNP
rs1188398684 1181 dbSNP
rs1482773701 1185 dbSNP
rs1052775186 1188 dbSNP
rs917866770 1191 dbSNP
rs936633637 1195 dbSNP
rs758904031 1197 dbSNP
rs903679846 1203 dbSNP
rs375012737 1213 dbSNP
rs1056379440 1223 dbSNP
rs1164593653 1230 dbSNP
rs947901267 1231 dbSNP
rs1390976569 1234 dbSNP
rs753262908 1241 dbSNP
rs1326591605 1245 dbSNP
rs1336493468 1249 dbSNP
rs563772841 1249 dbSNP
rs1447336916 1261 dbSNP
rs1314493583 1264 dbSNP
rs1380609878 1266 dbSNP
rs938041483 1274 dbSNP
rs1293462744 1278 dbSNP
rs926628342 1280 dbSNP
rs991924247 1296 dbSNP
rs929596770 1298 dbSNP
rs952120518 1302 dbSNP
rs1458612283 1303 dbSNP
rs1203546667 1312 dbSNP
rs1242014565 1317 dbSNP
rs1442291536 1320 dbSNP
rs919306195 1329 dbSNP
rs1377377198 1330 dbSNP
rs1300230444 1335 dbSNP
rs1443622153 1350 dbSNP
rs1368741309 1367 dbSNP
rs765278912 1371 dbSNP
rs371216432 1394 dbSNP
rs1165942677 1402 dbSNP
rs966196127 1403 dbSNP
rs1019648449 1404 dbSNP
rs543892684 1412 dbSNP
rs1168702357 1420 dbSNP
rs963648436 1431 dbSNP
rs1403770901 1432 dbSNP
rs1007796819 1434 dbSNP
rs35766455 1435 dbSNP
rs1463020305 1448 dbSNP
rs1307837726 1459 dbSNP
rs1326092815 1462 dbSNP
rs953867356 1467 dbSNP
rs909477745 1468 dbSNP
rs1280528195 1472 dbSNP
rs986275692 1474 dbSNP
rs1223260420 1483 dbSNP
rs1418865953 1489 dbSNP
rs1000454969 1492 dbSNP
rs953529559 1497 dbSNP
rs1030799429 1498 dbSNP
rs1423062255 1506 dbSNP
rs1253870482 1507 dbSNP
rs9577066 1511 dbSNP
rs180977442 1512 dbSNP
rs1237418113 1530 dbSNP
rs1196220830 1538 dbSNP
rs555236093 1545 dbSNP
rs1020658088 1547 dbSNP
rs1175432750 1548 dbSNP
rs562468567 1549 dbSNP
rs1000722058 1550 dbSNP
rs538088730 1555 dbSNP
rs1246301532 1571 dbSNP
rs77243787 1581 dbSNP
rs1384300132 1583 dbSNP
rs1243663179 1584 dbSNP
rs1009391927 1589 dbSNP
rs1319529636 1594 dbSNP
rs896309245 1595 dbSNP
rs903748676 1597 dbSNP
rs772796739 1601 dbSNP
rs58134582 1603 dbSNP
rs564457403 1605 dbSNP
rs558856511 1612 dbSNP
rs1384458923 1614 dbSNP
rs748084836 1618 dbSNP
rs1256098455 1620 dbSNP
rs1349388542 1622 dbSNP
rs539136949 1623 dbSNP
rs1049097689 1627 dbSNP
rs1011994143 1628 dbSNP
rs1443227562 1631 dbSNP
rs774130709 1634 dbSNP
rs919378294 1635 dbSNP
rs542801498 1637 dbSNP
rs1395262396 1641 dbSNP
rs566583313 1644 dbSNP
rs896327156 1649 dbSNP
rs972135607 1651 dbSNP
rs1434874229 1652 dbSNP
rs45450701 1653 dbSNP
rs912045420 1657 dbSNP
rs1451772263 1659 dbSNP
rs1160530443 1703 dbSNP
rs552951317 1708 dbSNP
rs953663025 1712 dbSNP
rs918228789 1716 dbSNP
rs536241100 1717 dbSNP
rs1387685440 1718 dbSNP
rs761445954 1720 dbSNP
rs553938705 1725 dbSNP
rs17592236 1728 dbSNP
rs1176655976 1730 dbSNP
rs781310710 1731 dbSNP
rs1009254741 1733 dbSNP
rs1263483416 1739 dbSNP
rs1489369583 1741 dbSNP
rs188025180 1742 dbSNP
rs1469738409 1745 dbSNP
rs1191524736 1748 dbSNP
rs896201864 1754 dbSNP
rs986390007 1768 dbSNP
rs1034874523 1775 dbSNP
rs1180591699 1782 dbSNP
rs1253138949 1794 dbSNP
rs531480991 1805 dbSNP
rs1487339870 1808 dbSNP
rs1161955798 1809 dbSNP
rs905109437 1810 dbSNP
rs143178473 1821 dbSNP
rs1297948821 1831 dbSNP
rs1394982028 1833 dbSNP
rs930662446 1837 dbSNP
rs1310858012 1841 dbSNP
rs1376936404 1842 dbSNP
rs1244577238 1847 dbSNP
rs552046477 1852 dbSNP
rs1323140439 1856 dbSNP
rs1222107865 1858 dbSNP
rs956843062 1868 dbSNP
rs1456409371 1869 dbSNP
rs1200403576 1870 dbSNP
rs766859605 1882 dbSNP
rs1238690085 1884 dbSNP
rs897816203 1885 dbSNP
rs1180184461 1895 dbSNP
rs1416297854 1906 dbSNP
rs757530498 1909 dbSNP
rs1424554466 1917 dbSNP
rs1170199626 1919 dbSNP
rs138884600 1922 dbSNP
rs1467668418 1926 dbSNP
rs764035605 1931 dbSNP
rs1405956519 1932 dbSNP
rs1307757322 1942 dbSNP
rs1237200014 1946 dbSNP
rs1300555375 1962 dbSNP
rs1380910493 1971 dbSNP
rs1372340126 1975 dbSNP
rs1036471592 1982 dbSNP
rs560288256 1990 dbSNP
rs1300750529 1992 dbSNP
rs747013894 1994 dbSNP
rs1220205241 2005 dbSNP
rs1258703072 2007 dbSNP
rs1385079651 2008 dbSNP
rs369839147 2010 dbSNP
rs1387428126 2023 dbSNP
rs73463239 2025 dbSNP
rs1420109643 2030 dbSNP
rs1483721132 2039 dbSNP
rs911934418 2042 dbSNP
rs529697028 2048 dbSNP
rs1261281866 2050 dbSNP
rs1000796094 2054 dbSNP
rs968022703 2063 dbSNP
rs986319182 2069 dbSNP
rs1023472327 2074 dbSNP
rs1429275376 2076 dbSNP
rs1413208942 2085 dbSNP
rs778014375 2088 dbSNP
rs1156587401 2095 dbSNP
rs1455576060 2096 dbSNP
rs1360341630 2098 dbSNP
rs1378129951 2106 dbSNP
rs1197556590 2111 dbSNP
rs1448094317 2112 dbSNP
rs1337954577 2117 dbSNP
rs561450017 2117 dbSNP
rs1401673113 2126 dbSNP
rs544911766 2127 dbSNP
rs575814105 2131 dbSNP
rs1217369502 2135 dbSNP
rs34578001 2137 dbSNP
rs1280858434 2143 dbSNP
rs896306993 2147 dbSNP
rs1056323089 2150 dbSNP
rs1261386395 2151 dbSNP
rs1489386929 2156 dbSNP
rs1194865584 2157 dbSNP
rs1487741550 2160 dbSNP
rs559112253 2167 dbSNP
rs1268545801 2168 dbSNP
rs994309082 2170 dbSNP
rs967714345 2175 dbSNP
rs1426448311 2177 dbSNP
rs1414608840 2179 dbSNP
rs762958746 2182 dbSNP
rs1349326459 2189 dbSNP
rs1157510660 2191 dbSNP
rs1020597369 2217 dbSNP
rs1358242090 2217 dbSNP
rs1421067725 2222 dbSNP
rs987739665 2228 dbSNP
rs1434005066 2229 dbSNP
rs1231185852 2246 dbSNP
rs1328230595 2248 dbSNP
rs1296347531 2257 dbSNP
rs896880070 2278 dbSNP
rs960493943 2287 dbSNP
rs1223347940 2299 dbSNP
rs1035141893 2300 dbSNP
rs545148544 2305 dbSNP
rs775604226 2306 dbSNP
rs573046023 2307 dbSNP
rs1454146912 2313 dbSNP
rs910925657 2316 dbSNP
rs969617815 2318 dbSNP
rs1027601257 2324 dbSNP
rs1402839365 2325 dbSNP
rs1050665372 2333 dbSNP
rs932277882 2335 dbSNP
rs41286979 2341 dbSNP
rs1036376237 2344 dbSNP
rs1441182637 2348 dbSNP
rs1009275021 2350 dbSNP
rs557773361 2357 dbSNP
rs553039287 2358 dbSNP
rs1325264628 2365 dbSNP
rs1350413191 2369 dbSNP
rs1445873396 2373 dbSNP
rs932197914 2378 dbSNP
rs745409179 2383 dbSNP
rs1240924680 2385 dbSNP
rs1283891949 2390 dbSNP
rs1477297087 2393 dbSNP
rs1354490970 2394 dbSNP
rs758967137 2416 dbSNP
rs1212014580 2419 dbSNP
rs1290949280 2422 dbSNP
rs536276967 2425 dbSNP
rs1437789332 2437 dbSNP
rs976245477 2441 dbSNP
rs935514653 2445 dbSNP
rs573026612 2447 dbSNP
rs567347205 2460 dbSNP
rs557041510 2461 dbSNP
rs1043185540 2466 dbSNP
rs923986345 2467 dbSNP
rs1367594837 2469 dbSNP
rs538154981 2475 dbSNP
rs1471573045 2494 dbSNP
rs1164787465 2501 dbSNP
rs913454725 2502 dbSNP
rs1465062203 2511 dbSNP
rs569009842 2513 dbSNP
rs1256122032 2516 dbSNP
rs1199277552 2521 dbSNP
rs1402365009 2521 dbSNP
rs1447685016 2529 dbSNP
rs968014778 2540 dbSNP
rs1338928070 2541 dbSNP
rs1247207131 2545 dbSNP
rs1285178701 2557 dbSNP
rs1023632444 2571 dbSNP
rs1251981273 2572 dbSNP
rs1217152921 2583 dbSNP
rs534331180 2583 dbSNP
rs34972103 2587 dbSNP
rs776092275 2589 dbSNP
rs1885269 2593 dbSNP
rs770624254 2594 dbSNP
rs150281661 2598 dbSNP
rs1254784305 2616 dbSNP
rs1440368235 2619 dbSNP
rs927766738 2629 dbSNP
rs980914891 2636 dbSNP
rs746707668 2641 dbSNP
rs896987374 2645 dbSNP
rs1425706074 2647 dbSNP
rs566607004 2648 dbSNP
rs1416441211 2649 dbSNP
rs994642742 2651 dbSNP
rs1016684792 2662 dbSNP
rs1397833785 2664 dbSNP
rs1333213757 2665 dbSNP
rs376370715 2667 dbSNP
rs112254821 2668 dbSNP
rs560953489 2670 dbSNP
rs1014848329 2673 dbSNP
rs889435116 2681 dbSNP
rs543820398 2684 dbSNP
rs1254926425 2703 dbSNP
rs1464640970 2704 dbSNP
rs375498935 2712 dbSNP
rs1280669843 2714 dbSNP
rs1487724437 2722 dbSNP
rs1191243361 2730 dbSNP
rs192298668 2733 dbSNP
rs902073080 2736 dbSNP
rs565434661 2739 dbSNP
rs545236302 2760 dbSNP
rs1467709225 2761 dbSNP
rs1173222889 2762 dbSNP
rs188690273 2763 dbSNP
rs1358722734 2765 dbSNP
rs115786369 2769 dbSNP
rs979484751 2788 dbSNP
rs946177498 2789 dbSNP
rs913523719 2790 dbSNP
rs1198154664 2792 dbSNP
rs1333318454 2793 dbSNP
rs537869894 2796 dbSNP
rs1234795904 2808 dbSNP
rs1303408141 2809 dbSNP
rs1352568853 2809 dbSNP
rs1213945249 2813 dbSNP
rs570360377 2820 dbSNP
rs916568358 2822 dbSNP
rs1209019120 2825 dbSNP
rs1265255526 2826 dbSNP
rs939057767 2832 dbSNP
rs990807455 2835 dbSNP
rs1199680129 2836 dbSNP
rs1234164049 2840 dbSNP
rs748624043 2846 dbSNP
rs1355844980 2856 dbSNP
rs1034910154 2857 dbSNP
rs927600691 2863 dbSNP
rs1361379940 2871 dbSNP
rs1337532917 2878 dbSNP
rs1457767145 2880 dbSNP
rs1331936505 2885 dbSNP
rs1393517321 2887 dbSNP
rs973093803 2899 dbSNP
rs779419041 2900 dbSNP
rs542731461 2901 dbSNP
rs1237283361 2902 dbSNP
rs116617950 2903 dbSNP
rs1327275406 2914 dbSNP
rs867040788 2917 dbSNP
rs765674269 2928 dbSNP
rs754954529 2930 dbSNP
rs920307932 2932 dbSNP
rs1263388802 2936 dbSNP
rs973272849 2944 dbSNP
rs148195072 2948 dbSNP
rs1237474732 2953 dbSNP
rs1456535655 2953 dbSNP
rs889509461 2955 dbSNP
rs1412538788 2956 dbSNP
rs1180569938 2958 dbSNP
rs1408999012 2973 dbSNP
rs117958521 2987 dbSNP
rs1423391942 2989 dbSNP
rs185321939 2992 dbSNP
rs1028097243 3001 dbSNP
rs961866881 3003 dbSNP
rs1163153791 3004 dbSNP
rs1370513044 3005 dbSNP
rs1458713363 3008 dbSNP
rs537048188 3011 dbSNP
rs1014872161 3016 dbSNP
rs568537590 3028 dbSNP
rs900845354 3031 dbSNP
rs1444014409 3034 dbSNP
rs1040622948 3036 dbSNP
rs1332727320 3039 dbSNP
rs372851785 3040 dbSNP
rs902672447 3041 dbSNP
rs1310345824 3043 dbSNP
rs1043901510 3047 dbSNP
rs1178533481 3053 dbSNP
rs1233645692 3057 dbSNP
rs550249101 3058 dbSNP
rs916625312 3059 dbSNP
rs1315924110 3082 dbSNP
rs1200604432 3092 dbSNP
rs1233482581 3094 dbSNP
rs193132822 3096 dbSNP
rs1254986047 3102 dbSNP
rs35569244 3115 dbSNP
rs904620236 3118 dbSNP
rs1055626399 3131 dbSNP
rs939358895 3132 dbSNP
rs927993267 3143 dbSNP
rs891948868 3144 dbSNP
rs188090269 3145 dbSNP
rs1207898214 3146 dbSNP
rs1355551543 3155 dbSNP
rs961311930 3156 dbSNP
rs796812663 3158 dbSNP
rs1045135853 3160 dbSNP
rs1277258753 3168 dbSNP
rs1338369123 3179 dbSNP
rs1220332393 3181 dbSNP
rs1273604005 3182 dbSNP
rs566694615 3196 dbSNP
rs1374499307 3202 dbSNP
rs1304998282 3210 dbSNP
rs947661784 3214 dbSNP
rs920377434 3215 dbSNP
rs1258044914 3216 dbSNP
rs973138152 3220 dbSNP
rs1193402296 3224 dbSNP
rs1349003642 3234 dbSNP
rs940528830 3238 dbSNP
rs907720873 3243 dbSNP
rs1187672031 3245 dbSNP
rs536960434 3252 dbSNP
rs987294749 3253 dbSNP
rs983929628 3259 dbSNP
rs1413480933 3276 dbSNP
rs1402847976 3284 dbSNP
rs1173331599 3286 dbSNP
rs953865158 3291 dbSNP
rs1376898246 3303 dbSNP
rs1361608585 3311 dbSNP
rs1297374559 3312 dbSNP
rs546782697 3313 dbSNP
rs998379920 3314 dbSNP
rs1418421186 3317 dbSNP
rs766433687 3318 dbSNP
rs1191910282 3322 dbSNP
rs1021690969 3324 dbSNP
rs1348910129 3337 dbSNP
rs1031778671 3338 dbSNP
rs1216102682 3340 dbSNP
rs1284120567 3343 dbSNP
rs1489500681 3347 dbSNP
rs999770958 3349 dbSNP
rs1477729896 3353 dbSNP
rs1180321767 3358 dbSNP
rs1477286648 3368 dbSNP
rs536362400 3372 dbSNP
rs1396307846 3374 dbSNP
rs1454313745 3380 dbSNP
rs1157718626 3393 dbSNP
rs1378092863 3394 dbSNP
rs1402288199 3399 dbSNP
rs1318656455 3402 dbSNP
rs1010256872 3405 dbSNP
rs1245247278 3414 dbSNP
rs1328032056 3415 dbSNP
rs1371880696 3424 dbSNP
rs756343090 3431 dbSNP
rs1307438152 3432 dbSNP
rs902745873 3433 dbSNP
rs1356109522 3435 dbSNP
rs567201093 3440 dbSNP
rs1450413418 3441 dbSNP
rs1036280547 3444 dbSNP
rs1254137404 3448 dbSNP
rs1043974474 3452 dbSNP
rs1010996325 3453 dbSNP
rs895352138 3458 dbSNP
rs1378111297 3472 dbSNP
rs1055211631 3475 dbSNP
rs1158964044 3483 dbSNP
rs1351506821 3483 dbSNP
rs1412743034 3483 dbSNP
rs1167067380 3491 dbSNP
rs1395125385 3493 dbSNP
rs763945786 3499 dbSNP
rs1219357139 3502 dbSNP
rs1366251126 3507 dbSNP
rs550595286 3529 dbSNP
rs898815194 3534 dbSNP
rs1283791722 3540 dbSNP
rs927972457 3544 dbSNP
rs1037348084 3545 dbSNP
rs1037409398 3546 dbSNP
rs940019537 3549 dbSNP
rs940436969 3551 dbSNP
rs1197462552 3557 dbSNP
rs907585055 3558 dbSNP
rs369371669 3559 dbSNP
rs909759110 3564 dbSNP
rs530412976 3569 dbSNP
rs1439219135 3571 dbSNP
rs754257786 3574 dbSNP
rs1418245516 3576 dbSNP
rs1471728436 3577 dbSNP
rs1189788501 3579 dbSNP
rs565604388 3582 dbSNP
rs1377853539 3583 dbSNP
rs984048530 3585 dbSNP
rs1168647359 3589 dbSNP
rs551681464 3592 dbSNP
rs182616961 3593 dbSNP
rs953853381 3594 dbSNP
rs1169670603 3596 dbSNP
rs1417025023 3597 dbSNP
rs1294216766 3602 dbSNP
rs189937695 3603 dbSNP
rs1262739245 3604 dbSNP
rs144573709 3615 dbSNP
rs1253575806 3616 dbSNP
rs1340914078 3619 dbSNP
rs186612860 3621 dbSNP
rs1440288289 3622 dbSNP
rs1239177642 3623 dbSNP
rs1257903328 3629 dbSNP
rs1191462475 3632 dbSNP
rs965532131 3634 dbSNP
rs968712792 3635 dbSNP
rs1172011910 3637 dbSNP
rs1400339536 3648 dbSNP
rs574124830 3649 dbSNP
rs1313895710 3650 dbSNP
rs1360349446 3653 dbSNP
rs1311484335 3656 dbSNP
rs1031434039 3659 dbSNP
rs113132653 3660 dbSNP
rs998454080 3663 dbSNP
rs765236963 3676 dbSNP
rs956326554 3680 dbSNP
rs368311253 3683 dbSNP
rs544581528 3683 dbSNP
rs1212634285 3690 dbSNP
rs1318234842 3694 dbSNP
rs758906657 3695 dbSNP
rs970238566 3699 dbSNP
rs1203143957 3701 dbSNP
rs183408269 3710 dbSNP
rs1011151888 3725 dbSNP
rs1023246105 3726 dbSNP
rs34241243 3736 dbSNP
rs1381752638 3740 dbSNP
rs1455626418 3742 dbSNP
rs1303744624 3743 dbSNP
rs1174540723 3750 dbSNP
rs1379915623 3751 dbSNP
rs1447966533 3761 dbSNP
rs1055728829 3762 dbSNP
rs1003725755 3767 dbSNP
rs1331053083 3768 dbSNP
rs906584959 3775 dbSNP
rs754877502 3779 dbSNP
rs1322334994 3785 dbSNP
rs760551502 3790 dbSNP
rs1235842492 3792 dbSNP
rs1303763387 3801 dbSNP
rs760386405 3804 dbSNP
rs1037119958 3807 dbSNP
rs1352452754 3807 dbSNP
rs1423244167 3809 dbSNP
rs1168756266 3811 dbSNP
rs1476286807 3818 dbSNP
rs776203754 3824 dbSNP
rs1209217574 3826 dbSNP
rs577937893 3828 dbSNP
rs1251027834 3833 dbSNP
rs553212862 3839 dbSNP
rs1469932611 3842 dbSNP
rs1182170384 3843 dbSNP
rs1482888038 3844 dbSNP
rs558154157 3846 dbSNP
rs567705777 3852 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293A and HEK293T
Disease adipogenesis
Location of target site 3'UTR
Tools used in this research miRanda , miRBase Target Database , PITA , RNA22 , TargetScan
Original Description (Extracted from the article) ... miR-15a/b are conserved among mammals and highly expressed during the early stage of adipogenesis We searched the matured sequences of miR-15a/b in mammals by miRBase (Release 20). Down-regulation of FoxO1 through over-expression of miR-15a/b To identify the target gene of miR-15a/b, we performed a bioinformatics analysis using TargetScan, RNA22, PITA, and miRanda. Over thousands of potential target genes were predicted. ...

- Dong P; Mai Y; Zhang Z; Mi L; Wu G; Chu G; et al., 2014, Acta biochimica et biophysica Sinica.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' --------------TGCTGCT- 3'
1 - 7
Article - Dong P; Mai Y; Zhang Z; Mi L; Wu G; Chu G; et al.
- Acta biochimica et biophysica Sinica, 2014
Diabetes and many other metabolism syndromes are closely related to obesity. To reveal the underlying mechanism of fat deposition, an increasing number of studies are focusing on the functions of miRNAs during adipocytes development. Previous studies have proved that miR-15a/b play important roles in multiple physiological processes; however, their functions during adipogenesis remain unclear. To reveal this, we detected the expression profiles of miR-15a/b during adipogenesis in porcine pre-adipocyte, and found that their expression levels increased in the early stage of adipocyte differentiation and dropped after day 4. Moreover, over-expression of miR-15a/b in porcine pre-adipocytes promoted adipocyte differentiation and lipid accumulation. Target genes of miR-15a/b were predicted and examined, which revealed that Forkhead box protein O1 (FoxO1) is the target gene of miR-15a/b. The inhibition of FoxO1 expression level caused by miR-15a/b over-expression had a positive effect on adipogenesis. Thus, we conclude that miR-15a/b promote adipogenesis in porcine pre-adipocyte via repressing FoxO1.
LinkOut: [PMID: 24862853]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.545 3.6e-3 0.491 8.7e-3 23 Click to see details
GSE17306 Multiple myeloma -0.35 6.8e-3 -0.364 5.1e-3 49 Click to see details
GSE38226 Liver fibrosis -0.491 1.2e-2 -0.432 2.5e-2 21 Click to see details
GSE19536 Breast cancer -0.203 2.1e-2 -0.180 3.7e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.227 2.2e-2 -0.197 4.1e-2 79 Click to see details
GSE21032 Prostate cancer -0.216 2.5e-2 -0.176 5.6e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.281 8.7e-2 0.278 8.9e-2 25 Click to see details
GSE19350 CNS germ cell tumors 0.378 1.1e-1 0.497 5.0e-2 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.243 1.3e-1 0.165 2.2e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.248 1.8e-1 0.253 1.7e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer 0.217 1.8e-1 0.114 3.2e-1 20 Click to see details
GSE28260 Renal cortex and medulla 0.236 2.2e-1 0.396 9.0e-2 13 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.133 2.6e-1 0.152 2.3e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.077 2.7e-1 -0.053 3.4e-1 64 Click to see details
GSE21849 B cell lymphoma 0.103 3.0e-1 -0.027 4.4e-1 29 Click to see details
GSE14794 Lymphoblastoid cells -0.047 3.3e-1 -0.022 4.2e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.077 3.7e-1 0.054 4.1e-1 20 Click to see details
GSE28544 Breast cancer 0.049 4.1e-1 0.446 1.4e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.03 4.4e-1 0.093 3.1e-1 32 Click to see details
GSE17498 Multiple myeloma 0.016 4.6e-1 0.085 3.0e-1 40 Click to see details
GSE17498 Multiple myeloma 0.016 4.6e-1 0.085 3.0e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.447 0.01 -0.518 0 32 Click to see details
COAD 0.641 0.04 0.452 0.13 8 Click to see details
BRCA 0.14 0.1 0.139 0.1 84 Click to see details
LUSC 0.208 0.11 0.182 0.14 38 Click to see details
BLCA 0.266 0.14 0.329 0.09 18 Click to see details
PRAD -0.15 0.15 -0.096 0.25 50 Click to see details
THCA -0.12 0.18 -0.187 0.08 59 Click to see details
HNSC 0.143 0.18 0.103 0.26 42 Click to see details
LIHC -0.098 0.25 -0.166 0.13 49 Click to see details
LUAD -0.206 0.26 -0.273 0.2 12 Click to see details
PCPG 0.542 0.32 0.500 0.33 3 Click to see details
CHOL 0.159 0.34 0.217 0.29 9 Click to see details
CESC 0.476 0.34 0.500 0.33 3 Click to see details
ESCA 0.12 0.36 0.291 0.19 11 Click to see details
UCEC 0.07 0.39 0.053 0.41 19 Click to see details
KICH 0.046 0.41 0.043 0.42 25 Click to see details
KIRP -0.04 0.41 -0.065 0.36 32 Click to see details
PAAD -0.142 0.43 0.000 0.5 4 Click to see details
KIRC 0.009 0.47 -0.011 0.46 68 Click to see details
KIRC 0.009 0.47 -0.011 0.46 68 Click to see details
KIRC 0.009 0.47 -0.011 0.46 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20