miRTarBase - #MIRT051351 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BTRC   
Synonyms BETA-TRCP, FBW1A, FBXW1, FBXW1A, FWD1, bTrCP, bTrCP1, betaTrCP
Description beta-transducin repeat containing E3 ubiquitin protein ligase
Transcript NM_003939   
Other Transcripts NM_033637   
Expression
Putative miRNA Targets on BTRC
3'UTR of BTRC
(miRNA target sites are highlighted)
>BTRC|NM_003939|3'UTR
   1 ATAACCATACACTGACCTCATACTTGCCCAGGACCCATTAAAGTTGCGGTATTTAACGTATCTGCCAATACCAGGATGAG
  81 CAACAACAGTAACAATCAAACTACTGCCCAGTTTCCCTGGACTAGCCGAGGAGCAGGGCTTTGAGACTCCTGTTGGGACA
 161 CAGTTGGTCTGCAGTCGGCCCAGGACGGTCTACTCAGCACAACTGACTGCTTCAGTGCTGCTATCAGAAGATGTCTTCTA
 241 TCTTTTGTGAATGATTGGAACTTTTAAACCTCCCCTCCTCTCCTCCTTTCACCTCTGCACCTAGTTTTTTCCCATTGGTT
 321 CCAGACAAAGGTGACTTATAAATATATTTAGTGTTTTGCCAGAATCTCTCTTGCTTTGCCATTAAGCAGAAGAACTAGTT
 401 TCCCTGTATAGCCTGCTGGGAGAGACCCACTTCTAGGGTATGGGGGATGCAGCTTCAAGCCCAGTGCCCAGTGTCTCCCT
 481 GTTAACTGCAGGAATGCCAAGCACCTGGCCAGAGCAGCCCAGCCCCAATATGCTTAGGAGGAGACAGAGTTCCCTCTGTA
 561 TAGCCTCTGGGACAAGAAAAAGAAAACACAAGAATGTATACACTGGAAGATTTGGGCCTCCTGCCTGCCTTCTCTTTGTT
 641 TCTGTTCCTCTTCCCATCTACTCCCCTACGCCCCTTCAACCTTTTTTCTCTGTCTGCTTCACCTGAGAAGAAAGTGTACG
 721 AAGAGAGTGTCCTCCTCTCACATGAGCCAGATCAGCCAGAAAATGCAACACTTGGAAGAGTTAAATGCTGTTCAGTGAAG
 801 ATTTCAGCCCCAGGCCTTTGCTGCAAGTGACCCTGTGGCAACAGTGGATTCTCAGACATGATACTCTCATCATATTTGCA
 881 ACTCTTCTCTCTCTTTCTTCCCCACACCCAAGAGGAGGATTGGTGGTAGGGGGCAGGCAGAGGGGGTGGGGAGAAGTTTC
 961 CTGGGCTCCATCAATGGCTGCATCTTTTCTGGACTCAGCAGTCTCCTTGATTCCATGTAGAGTGTGGAAAGGAGTTGCTG
1041 ATTGCATTTCCTCTCATTAACAATTGGGTGTGTAATAAAAAGCATTGTACTTCATCTTAAATCACTGGTAAGGCTCAGCC
1121 TACAGAAAGATTTGAAATGGCCAGAGCCAATCGCTTGGTGCATTCTGCGTAATGGTTTCCATCTCCGATTTCCTCATCAG
1201 GGCCTGTGAATACCCAGGTGCCTGTATCTTTGCCAAGACCGTGATCAAGGTAGCTTAAGAGAGATGGTCAGGAGAAAACA
1281 CTGTTTTTGTTTTTTTTGTTGTTTTGTTTTGTTTTGGCCAGTTAAATATCATCTCTCAAATATTGATCTCACCGTGTCAA
1361 CCTTGCACTGCACAACCTTCCTTCTGCTTCTCCCACACCCAGTATTTGCAGAAGGGCAAAGCTGCTTAAGAGAGAGGATC
1441 AGGGTGAAGTTTGGCACACAGGGTTTATTAATGGGGCAAAAACTGCCTTTTCTTCCTCCTCCTGACCTTATTTTGCTCTT
1521 CACTCTCCCCAGCCAATAAAGCGTCTGTGGCGATTGGTGAACAGCATAAACAGCTGGACCTCAGCAAGGGTCAGGCAAAC
1601 CCAGTCACTCGGAAGGCAGCTGTGTGAGCTGCCAAGCTAGTGGGCTTCAGGTGCAAGGGTACCTGTGCCACACCAACCTG
1681 GGAGCACACAGAATACTATTAATGTGCACCCAGCTGGTCTCCCCAGGCAAGAAGGTATCCTCTTCCCAAGGTGTACCCAC
1761 TGAATGTTGTTACTACATATTGAGAGTCATTTTATGCATATGCATTCTACCTTTCCTGCTTTATGAGTATTTTTAAGCTT
1841 TTAGTTCAAGGTTATATTCAGAAAATATTTCCCAGTATAATGATACATCGTAGCCTAAGAAATATTTTCTCAATGTAATT
1921 CCCTTCCCAGCTACCCAAATGCTACAGAGAAATGTTTTCTACTTGGCCACTATCAGGGTTCGTCATCTATTGTGTTGACT
2001 ATTAATGGCTTTTTGATTGGGTAAGGATTTTGCTATAGATGAAGGTAGAGGGCTGTCAGCCCTGAAAAACACACAGGTCA
2081 GACATTTAAAAGGCATGGGTTTCGAGCTGTCTCAAAATATTGCCCAATAGCCATAATTTTACCAGCCTTTCTGTCATATG
2161 CTGCTATTACAAAGTGGAAGCTGTTGAATGTTTATTGGTGCCCAGGGTTTTGCTCTCCAATCTAGGTTCAGTTGAAGGAA
2241 TATTGTTTCTAAGACTGTTTTGAGACATGTCCAGTACATCACAAAGGAGATCGGGGCGACCCCTGCAGATGTGGAGCCAT
2321 TAGCCCAGTTGAGGATATTCTCCAAGTTGTCCTCTCTCCTGCTGATGGAAATGGGAATGAAGTTAAGTGGTCTGAAAAAC
2401 TTGAATCGTTCACATTTCTCAGCTCTGGGGGTCATTTACCAGTTTGTTGTAGAAGAAATAATCAGGTAAGTTAAAAGTTC
2481 ATTTCCAGAGAAGGTAAACCCCACTTACCATCTCTGCATGATTTCAGTGGGAATTGATTATCACTAATCCCCAACTGGGC
2561 TAGAATAAATGTAAAGTTTGACCTTTTTAAAACGAAAAGAGAGACAAAGTCTCAGCACATTCCAAGGAGTGGTAGAAACA
2641 GAGCTGAAGGTGTCCCCATTGTAGATTAGTCTCTTCTCACTAAAATTTACTTTCCAACGTAGGGCCTAAAGGAAACCTTT
2721 CTTAAAGACAGGCTGAAACCCCTTCAAAGGCAGATGAGGAGGTACAGACACGTGACCTTTTGGTGCACACTGGAGCTACT
2801 TGGACAAGACCAGCATGCCTTGCTGCACGTGTGTGTATTTCACTGCTGAGAACATCCTTTAACTTGGTGTGCAATTTGAA
2881 AGGATGTGAATCATGGATGGAAGGCCATTTGTACATGTCCCTTGGCAAAATTCTTTCTGGTGTCTCCTAACTTCAGAGAC
2961 AGGGACTCTTTTTGGATCTCTATTGACAAGTAATAAAAGTCTGGCCCTCATAACTTGTTTCCGAACTAGAAAAGTCTGTG
3041 AGACCCCTACATCATTCTGGTTTTTTTGCTTGAGTAAGAACAATCCTTTTTTATTTTTCTTCTGTACAGTCTAAAGCTAC
3121 AGAGAAAAAAAAATGCACTCTTCCCTTGCCGGCTCCTGGTACCATTGGTCTGAACAGCTGTAGTTGGTCTACTCCTTACT
3201 TAGCACTTGATTGTGTGGGGAAACAAAGGTGGGAGGGGTGGGGAATACTGGAAATAATCAGGGCAATTTTTTTCTTTCCC
3281 ATAATTGGACTAGATACCTTGGTACTGTTGACCTTCTCAGCATCTCCCTTTTGCCTTAGATGGCAACACCCTCCAGTCTG
3361 TAGCAGAGCAGTCCAACCCAGATTAGTGCAGCCCGGAGGCTTAGGGTGCAGCCTCCCTGGTCTTCCTCCACACAGTTGTT
3441 CACCAACAGACCAGACCTCCTTTAACCACAGTGTCAACATAGTATCGGAAAGAGAGCCATTTCTTAGGGGAATAAAACAG
3521 TTTCGCTTCTTTAGCTCATCTGTGGTGTCAGAATCCTTGGAGCTGAAGAGAGAAATCAAAAGAGCATGATGATGGCTGCC
3601 TGGTTTCAGGTGGAACTTAATGCATTGATCTTTAGAAGCTCCTTCTGTTGGAAGTTGAGTACCTGTGATCTAAAATGTCC
3681 TGGAGGCAGATGACATCTAAAATATGTGCTTTCCAACCAGCACAGCTGGCGCTCTTAGCTCCTGATTGGTTGTGTGTTTT
3761 ATTAAGGATCAGTGCAGTTAAGTCGTATTTTAAAGTGTTACCTCCCCTCCTAACCCTTCCCCTTCTTGGACACTGAAGGA
3841 AAAGGCCAACTAGGGTGTTAGCCCTCTGGGCACCAAGGAAACTAACAGCTTTCTCAAAGCGGTGACCACTCAGGCCAGCC
3921 CAGACAAATCTGAGGGATGGCCAGTGCACTCCAATGATGGGACAGGCCTAACAACACATGTAAGCTTCCCCGAGAGCTTT
4001 CAGCTGGTTCACCTCTTTGTTCTCTAGACTCTTAAGTACTGACTGCTTTGACTTTTGTGATTATGTTATGGTGATGTGTA
4081 GTCAGTGTACCAATATGTTCACAACCTAGGATCATGATAATGGAGTGTGTTTTGGGTTTTTTTTAACTGTTCAGAAAAAA
4161 AGTAAATTACAAATATAAGATTAAAGTGAATTTTCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU-AAUACACGACGAu 5'
            | :||:: ||  |||||||| 
Target 5' aaCTGACTGCTTCAGTGCTGCTa 3'
201 - 223 156.00 -15.50
2
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |::| || ||||||| 
Target 5' gcctttCTGTCATATGCTGCTa 3'
2145 - 2166 156.00 -11.20
3
miRNA  3' guGUU-UGGUAAUAC---ACGACGau 5'
            ||| ||||  |||   ||||||  
Target 5' gaCAAGACCAGCATGCCTTGCTGCac 3'
2803 - 2828 144.00 -14.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28891424 6 COSMIC
COSN32074229 10 COSMIC
COSN30145635 20 COSMIC
COSN30463209 30 COSMIC
COSN30507312 31 COSMIC
COSN15303487 37 COSMIC
COSN20054491 38 COSMIC
COSN30589242 44 COSMIC
COSN5246205 54 COSMIC
COSN28856344 64 COSMIC
COSN20733008 159 COSMIC
COSN20424095 943 COSMIC
COSN16857344 1048 COSMIC
COSN23450403 1421 COSMIC
COSN19362291 2421 COSMIC
COSN24097333 2701 COSMIC
COSN15662146 2783 COSMIC
COSN30157988 2796 COSMIC
COSN8147756 2851 COSMIC
COSN26640406 2938 COSMIC
COSN6053297 3087 COSMIC
COSN1111222 3104 COSMIC
COSN6053298 3505 COSMIC
COSN31514895 3561 COSMIC
COSN31960534 3565 COSMIC
COSN31555730 3579 COSMIC
COSN26649592 3717 COSMIC
COSN31601207 3875 COSMIC
COSN17075804 4025 COSMIC
COSN31960535 4154 COSMIC
COSN27326021 4391 COSMIC
COSN26552780 4461 COSMIC
COSN31524471 4537 COSMIC
COSN29856965 4551 COSMIC
COSN31555319 4570 COSMIC
COSN30542602 4816 COSMIC
COSN17182929 4818 COSMIC
COSN23056054 5036 COSMIC
COSN15774487 5252 COSMIC
COSN4710598 5368 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750626654 10 dbSNP
rs1477507948 12 dbSNP
rs1313219996 20 dbSNP
rs1177304066 25 dbSNP
rs1431313088 27 dbSNP
rs756294012 37 dbSNP
rs780632847 38 dbSNP
rs749657472 40 dbSNP
rs1432648163 41 dbSNP
rs746154458 43 dbSNP
rs1360867522 44 dbSNP
rs576384573 49 dbSNP
rs372787240 51 dbSNP
rs1008585387 53 dbSNP
rs1369391084 65 dbSNP
rs772050784 69 dbSNP
rs1427222935 72 dbSNP
rs555823525 74 dbSNP
rs565246249 75 dbSNP
rs1266911185 78 dbSNP
rs1032888964 80 dbSNP
rs951060082 87 dbSNP
rs559798260 98 dbSNP
rs35617097 106 dbSNP
rs983792209 114 dbSNP
rs1265768200 116 dbSNP
rs369869740 120 dbSNP
rs1226425125 123 dbSNP
rs1413233130 129 dbSNP
rs1424582237 131 dbSNP
rs988597844 133 dbSNP
rs1167255359 135 dbSNP
rs1361838841 136 dbSNP
rs1024383885 149 dbSNP
rs1300801849 150 dbSNP
rs1452714233 154 dbSNP
rs1388104416 156 dbSNP
rs1391045773 158 dbSNP
rs1298612098 159 dbSNP
rs909767119 163 dbSNP
rs1362326210 185 dbSNP
rs964319052 190 dbSNP
rs1412910253 198 dbSNP
rs1311709624 208 dbSNP
rs1297901148 230 dbSNP
rs971436019 232 dbSNP
rs980157945 250 dbSNP
rs1229659595 279 dbSNP
rs780139307 282 dbSNP
rs1427226505 283 dbSNP
rs1480423337 283 dbSNP
rs1201722295 286 dbSNP
rs1452332844 287 dbSNP
rs922453663 288 dbSNP
rs1304338807 309 dbSNP
rs113484245 317 dbSNP
rs1239827900 320 dbSNP
rs1287219734 329 dbSNP
rs1194353321 341 dbSNP
rs749345356 343 dbSNP
rs927301601 345 dbSNP
rs923943537 350 dbSNP
rs1209407239 351 dbSNP
rs962720397 355 dbSNP
rs1322762975 362 dbSNP
rs1280766489 369 dbSNP
rs1236975745 374 dbSNP
rs1483655165 381 dbSNP
rs974734173 387 dbSNP
rs1183688634 390 dbSNP
rs935292709 393 dbSNP
rs1248607549 400 dbSNP
rs371311444 400 dbSNP
rs1332487809 401 dbSNP
rs541721076 404 dbSNP
rs1469700881 407 dbSNP
rs1404539959 416 dbSNP
rs1053720763 418 dbSNP
rs1439339481 419 dbSNP
rs571833488 420 dbSNP
rs894026337 422 dbSNP
rs768653797 429 dbSNP
rs1012929481 438 dbSNP
rs578207121 440 dbSNP
rs1179921638 441 dbSNP
rs1421166294 443 dbSNP
rs144776202 450 dbSNP
rs1199039616 457 dbSNP
rs1460782944 460 dbSNP
rs1432775159 463 dbSNP
rs563394451 464 dbSNP
rs1202151501 473 dbSNP
rs911670527 487 dbSNP
rs1259696106 510 dbSNP
rs944467276 514 dbSNP
rs530464929 516 dbSNP
rs774434326 518 dbSNP
rs1359685426 529 dbSNP
rs1025437215 534 dbSNP
rs1452400913 538 dbSNP
rs1449499615 543 dbSNP
rs1381106190 551 dbSNP
rs900168238 555 dbSNP
rs1415609596 559 dbSNP
rs1384328755 564 dbSNP
rs777726932 569 dbSNP
rs999829239 572 dbSNP
rs951120412 575 dbSNP
rs1381181485 577 dbSNP
rs1054335993 580 dbSNP
rs1447127885 584 dbSNP
rs891712190 586 dbSNP
rs746972098 588 dbSNP
rs1189521337 593 dbSNP
rs1442950128 595 dbSNP
rs1282863806 607 dbSNP
rs747952717 617 dbSNP
rs767982710 618 dbSNP
rs1379667465 621 dbSNP
rs1286258683 623 dbSNP
rs530950535 625 dbSNP
rs1286383867 632 dbSNP
rs1278470310 641 dbSNP
rs1326361803 641 dbSNP
rs1313303148 644 dbSNP
rs1316260716 647 dbSNP
rs963977610 657 dbSNP
rs1024079685 658 dbSNP
rs1361300632 661 dbSNP
rs544471206 664 dbSNP
rs188813705 666 dbSNP
rs560674810 669 dbSNP
rs1179564092 670 dbSNP
rs1411292737 674 dbSNP
rs1164790459 676 dbSNP
rs1239759462 692 dbSNP
rs1473063666 697 dbSNP
rs955249113 700 dbSNP
rs1191482702 704 dbSNP
rs1488967487 710 dbSNP
rs1034400091 711 dbSNP
rs868244584 714 dbSNP
rs1425735894 715 dbSNP
rs1449529238 731 dbSNP
rs1416128015 732 dbSNP
rs1167677441 735 dbSNP
rs528391756 752 dbSNP
rs1339244413 761 dbSNP
rs192136983 763 dbSNP
rs12241249 764 dbSNP
rs1341201965 773 dbSNP
rs951593715 785 dbSNP
rs571141279 800 dbSNP
rs776382905 801 dbSNP
rs532152279 805 dbSNP
rs915250827 806 dbSNP
rs563202877 807 dbSNP
rs7897749 819 dbSNP
rs752122516 820 dbSNP
rs1039200864 826 dbSNP
rs1045761484 827 dbSNP
rs921695245 835 dbSNP
rs184269663 842 dbSNP
rs906699014 844 dbSNP
rs1293513433 847 dbSNP
rs939467147 854 dbSNP
rs537107330 855 dbSNP
rs1047273752 857 dbSNP
rs886835563 858 dbSNP
rs555755631 862 dbSNP
rs1256629539 868 dbSNP
rs567632814 873 dbSNP
rs1319221969 874 dbSNP
rs1282683213 877 dbSNP
rs1221791488 879 dbSNP
rs1369883363 882 dbSNP
rs3127239 897 dbSNP
rs767912034 900 dbSNP
rs371762627 903 dbSNP
rs1220491625 909 dbSNP
rs899531930 914 dbSNP
rs1400978447 919 dbSNP
rs1478951800 920 dbSNP
rs145416337 925 dbSNP
rs1029956894 927 dbSNP
rs1010124961 928 dbSNP
rs545515115 944 dbSNP
rs1045602472 950 dbSNP
rs1191403305 951 dbSNP
rs1477831465 954 dbSNP
rs977193788 955 dbSNP
rs1031482294 962 dbSNP
rs956768289 966 dbSNP
rs907034837 976 dbSNP
rs557233259 979 dbSNP
rs1208694974 981 dbSNP
rs1172201700 988 dbSNP
rs915235896 994 dbSNP
rs1374961258 1000 dbSNP
rs575300623 1004 dbSNP
rs1001343981 1005 dbSNP
rs4244346 1012 dbSNP
rs1335963677 1013 dbSNP
rs980798460 1018 dbSNP
rs962807286 1023 dbSNP
rs7084859 1025 dbSNP
rs1025661276 1027 dbSNP
rs939603157 1028 dbSNP
rs1047244510 1035 dbSNP
rs188604484 1037 dbSNP
rs1440670046 1043 dbSNP
rs1242994507 1047 dbSNP
rs887304940 1050 dbSNP
rs1484533631 1054 dbSNP
rs1238056883 1058 dbSNP
rs1350895083 1060 dbSNP
rs941082236 1061 dbSNP
rs1439199790 1063 dbSNP
rs987052913 1072 dbSNP
rs1019829554 1080 dbSNP
rs1241196768 1087 dbSNP
rs78290424 1090 dbSNP
rs1478776383 1091 dbSNP
rs1280195435 1102 dbSNP
rs899586389 1110 dbSNP
rs996879245 1113 dbSNP
rs76569850 1114 dbSNP
rs564833713 1123 dbSNP
rs1302871035 1134 dbSNP
rs1280342119 1151 dbSNP
rs921702676 1153 dbSNP
rs1358122387 1157 dbSNP
rs998750345 1160 dbSNP
rs778981071 1163 dbSNP
rs563703587 1168 dbSNP
rs11597334 1180 dbSNP
rs1163126262 1180 dbSNP
rs1426032404 1187 dbSNP
rs879500732 1194 dbSNP
rs535065033 1196 dbSNP
rs1010989067 1197 dbSNP
rs1022762602 1198 dbSNP
rs912919650 1199 dbSNP
rs531052349 1200 dbSNP
rs1242374906 1204 dbSNP
rs549196004 1210 dbSNP
rs1323337038 1216 dbSNP
rs771959765 1217 dbSNP
rs750890787 1221 dbSNP
rs568465099 1229 dbSNP
rs927976023 1230 dbSNP
rs1337758476 1246 dbSNP
rs1415521122 1250 dbSNP
rs1400160899 1251 dbSNP
rs1389606314 1254 dbSNP
rs960936064 1255 dbSNP
rs1045633053 1256 dbSNP
rs1323541653 1257 dbSNP
rs983067291 1261 dbSNP
rs908709071 1264 dbSNP
rs1170350267 1267 dbSNP
rs181172665 1273 dbSNP
rs535014825 1275 dbSNP
rs937194091 1276 dbSNP
rs1480206791 1291 dbSNP
rs56203044 1294 dbSNP
rs1055617418 1295 dbSNP
rs1447332293 1295 dbSNP
rs1401195654 1304 dbSNP
rs898292347 1314 dbSNP
rs1197871533 1319 dbSNP
rs1218732311 1319 dbSNP
rs1279494502 1319 dbSNP
rs184498899 1319 dbSNP
rs920982873 1324 dbSNP
rs571979627 1325 dbSNP
rs932434876 1329 dbSNP
rs1388216348 1331 dbSNP
rs1050698982 1334 dbSNP
rs1284946610 1344 dbSNP
rs1391888101 1347 dbSNP
rs1191423137 1355 dbSNP
rs1331111556 1367 dbSNP
rs890818774 1371 dbSNP
rs998720663 1376 dbSNP
rs1053004069 1392 dbSNP
rs1403118221 1400 dbSNP
rs1172082412 1410 dbSNP
rs1285073326 1417 dbSNP
rs538916613 1425 dbSNP
rs1218783962 1429 dbSNP
rs1201267538 1444 dbSNP
rs1433998971 1449 dbSNP
rs1254753452 1450 dbSNP
rs761237744 1456 dbSNP
rs887113937 1461 dbSNP
rs893057977 1462 dbSNP
rs3127240 1463 dbSNP
rs1022816848 1464 dbSNP
rs1253795249 1466 dbSNP
rs1157206956 1469 dbSNP
rs969860071 1470 dbSNP
rs1331328264 1473 dbSNP
rs1308931941 1474 dbSNP
rs575714929 1476 dbSNP
rs976015520 1478 dbSNP
rs542740227 1486 dbSNP
rs1332630568 1489 dbSNP
rs1161037037 1495 dbSNP
rs1400086705 1495 dbSNP
rs1174396912 1497 dbSNP
rs1179160823 1498 dbSNP
rs1390767309 1498 dbSNP
rs33974447 1498 dbSNP
rs376339990 1498 dbSNP
rs398046211 1498 dbSNP
rs559481571 1498 dbSNP
rs958179284 1500 dbSNP
rs1201704458 1510 dbSNP
rs1253375099 1510 dbSNP
rs1169146852 1515 dbSNP
rs1413917407 1516 dbSNP
rs1334972911 1517 dbSNP
rs1342441387 1521 dbSNP
rs1237601954 1522 dbSNP
rs1356283896 1523 dbSNP
rs1310467286 1525 dbSNP
rs1447857767 1539 dbSNP
rs989863866 1552 dbSNP
rs1444908602 1553 dbSNP
rs960737930 1554 dbSNP
rs982785920 1575 dbSNP
rs1296577100 1577 dbSNP
rs912950801 1581 dbSNP
rs1381869108 1602 dbSNP
rs1158930603 1610 dbSNP
rs868657727 1617 dbSNP
rs963004063 1621 dbSNP
rs1366665540 1623 dbSNP
rs1485712813 1624 dbSNP
rs974621301 1625 dbSNP
rs1213935894 1626 dbSNP
rs981054241 1630 dbSNP
rs1242062947 1631 dbSNP
rs1254100627 1643 dbSNP
rs1286435032 1644 dbSNP
rs1344258599 1646 dbSNP
rs1246255207 1654 dbSNP
rs1339919268 1658 dbSNP
rs746795359 1679 dbSNP
rs554220903 1682 dbSNP
rs1361442356 1684 dbSNP
rs78083225 1689 dbSNP
rs1404521689 1696 dbSNP
rs1388395963 1697 dbSNP
rs1164919960 1700 dbSNP
rs1050834607 1709 dbSNP
rs776214939 1716 dbSNP
rs912225551 1727 dbSNP
rs1056091562 1728 dbSNP
rs1190915152 1740 dbSNP
rs539831542 1749 dbSNP
rs1177698558 1755 dbSNP
rs934288595 1760 dbSNP
rs759036999 1761 dbSNP
rs1220424015 1767 dbSNP
rs1450230937 1768 dbSNP
rs754250623 1771 dbSNP
rs1235344429 1783 dbSNP
rs1047210746 1788 dbSNP
rs564497406 1795 dbSNP
rs1317842942 1803 dbSNP
rs887187581 1812 dbSNP
rs577067747 1816 dbSNP
rs530823386 1821 dbSNP
rs1341258620 1822 dbSNP
rs189020976 1822 dbSNP
rs1274485211 1824 dbSNP
rs1434660049 1828 dbSNP
rs893020709 1830 dbSNP
rs1329083792 1832 dbSNP
rs1325286091 1836 dbSNP
rs1011516635 1843 dbSNP
rs1180905860 1844 dbSNP
rs1019600163 1845 dbSNP
rs1419691837 1851 dbSNP
rs1376392608 1867 dbSNP
rs1478002479 1872 dbSNP
rs1190257819 1874 dbSNP
rs755449854 1880 dbSNP
rs74316924 1881 dbSNP
rs546914612 1911 dbSNP
rs1194683580 1915 dbSNP
rs1457671050 1920 dbSNP
rs1002288182 1925 dbSNP
rs960669542 1925 dbSNP
rs1404520037 1928 dbSNP
rs1464248873 1931 dbSNP
rs958210493 1932 dbSNP
rs1035064310 1933 dbSNP
rs1009684832 1934 dbSNP
rs1276345556 1940 dbSNP
rs562741028 1942 dbSNP
rs967086965 1944 dbSNP
rs1401304225 1947 dbSNP
rs1004189813 1953 dbSNP
rs981567291 1960 dbSNP
rs1448668143 1963 dbSNP
rs1308933318 1973 dbSNP
rs34235930 1973 dbSNP
rs868608752 1978 dbSNP
rs1360649531 1979 dbSNP
rs963267487 1988 dbSNP
rs529830317 1991 dbSNP
rs958575532 1993 dbSNP
rs974378960 1994 dbSNP
rs774811168 1996 dbSNP
rs34293123 2000 dbSNP
rs762264873 2016 dbSNP
rs1046913625 2022 dbSNP
rs112193452 2024 dbSNP
rs561360415 2025 dbSNP
rs1236936089 2035 dbSNP
rs1208138954 2038 dbSNP
rs1314071878 2047 dbSNP
rs1281271769 2051 dbSNP
rs1239777735 2055 dbSNP
rs899836397 2056 dbSNP
rs1466178375 2058 dbSNP
rs1265771670 2060 dbSNP
rs934423971 2074 dbSNP
rs988419189 2075 dbSNP
rs1225328947 2079 dbSNP
rs1374001625 2085 dbSNP
rs1301697128 2105 dbSNP
rs750737701 2111 dbSNP
rs914272563 2117 dbSNP
rs1200265573 2127 dbSNP
rs1360427379 2127 dbSNP
rs536832305 2133 dbSNP
rs1054078040 2142 dbSNP
rs1160859410 2145 dbSNP
rs894060229 2153 dbSNP
rs1044361344 2155 dbSNP
rs1170096449 2168 dbSNP
rs1484275812 2169 dbSNP
rs1205596746 2181 dbSNP
rs1424542802 2183 dbSNP
rs1467423974 2187 dbSNP
rs1487432922 2196 dbSNP
rs187176155 2211 dbSNP
rs1217698401 2214 dbSNP
rs1317344375 2218 dbSNP
rs1311877541 2219 dbSNP
rs754171011 2222 dbSNP
rs3127241 2232 dbSNP
rs970843118 2238 dbSNP
rs1325381628 2248 dbSNP
rs1338342065 2252 dbSNP
rs190612023 2254 dbSNP
rs752846882 2255 dbSNP
rs1319534124 2256 dbSNP
rs1299707760 2259 dbSNP
rs1035813471 2261 dbSNP
rs1349734897 2261 dbSNP
rs1242213364 2266 dbSNP
rs958432386 2270 dbSNP
rs539334797 2274 dbSNP
rs1210809344 2275 dbSNP
rs181486652 2292 dbSNP
rs996157251 2296 dbSNP
rs1487606464 2306 dbSNP
rs147673601 2307 dbSNP
rs200882711 2309 dbSNP
rs952595367 2310 dbSNP
rs1264656361 2311 dbSNP
rs531216064 2312 dbSNP
rs986900793 2313 dbSNP
rs943830461 2318 dbSNP
rs1368130412 2321 dbSNP
rs1337829312 2322 dbSNP
rs1297272742 2324 dbSNP
rs1382495141 2328 dbSNP
rs1367270445 2342 dbSNP
rs1292150927 2349 dbSNP
rs1019764922 2350 dbSNP
rs955777774 2351 dbSNP
rs932709755 2354 dbSNP
rs1425951783 2356 dbSNP
rs1464099440 2356 dbSNP
rs988555444 2358 dbSNP
rs1164814581 2359 dbSNP
rs914220743 2362 dbSNP
rs1399385670 2370 dbSNP
rs1298243783 2373 dbSNP
rs1469693164 2374 dbSNP
rs1341910408 2375 dbSNP
rs747135778 2375 dbSNP
rs1253515070 2379 dbSNP
rs1393802996 2379 dbSNP
rs893777921 2383 dbSNP
rs1009790663 2385 dbSNP
rs947035410 2391 dbSNP
rs1311281943 2392 dbSNP
rs1042577181 2398 dbSNP
rs1443531659 2411 dbSNP
rs1372227504 2416 dbSNP
rs980185419 2417 dbSNP
rs1445288742 2420 dbSNP
rs906718211 2432 dbSNP
rs1168603328 2435 dbSNP
rs927205613 2440 dbSNP
rs1245919737 2441 dbSNP
rs1035483300 2445 dbSNP
rs938601405 2450 dbSNP
rs1056965991 2451 dbSNP
rs886300456 2452 dbSNP
rs940076897 2459 dbSNP
rs1352108196 2463 dbSNP
rs894196878 2466 dbSNP
rs1195896092 2469 dbSNP
rs1216602458 2473 dbSNP
rs1037157620 2475 dbSNP
rs1482671318 2477 dbSNP
rs1253848293 2484 dbSNP
rs1236121531 2488 dbSNP
rs1012613761 2490 dbSNP
rs1309003365 2491 dbSNP
rs1238562032 2494 dbSNP
rs1026665688 2503 dbSNP
rs1330205348 2504 dbSNP
rs1045316 2507 dbSNP
rs898575623 2522 dbSNP
rs1395495490 2528 dbSNP
rs1400248816 2529 dbSNP
rs1314993788 2537 dbSNP
rs1435589309 2538 dbSNP
rs1157857476 2539 dbSNP
rs995485836 2539 dbSNP
rs1468491084 2541 dbSNP
rs1486857202 2552 dbSNP
rs185730288 2563 dbSNP
rs1422724300 2588 dbSNP
rs190190120 2592 dbSNP
rs1212502699 2607 dbSNP
rs1485813886 2621 dbSNP
rs539197605 2621 dbSNP
rs1015488124 2626 dbSNP
rs1185180192 2630 dbSNP
rs796779216 2638 dbSNP
rs965277630 2661 dbSNP
rs976990185 2665 dbSNP
rs879649117 2680 dbSNP
rs890012776 2686 dbSNP
rs1008463055 2692 dbSNP
rs1360154959 2698 dbSNP
rs1159115180 2702 dbSNP
rs1398704871 2707 dbSNP
rs1362379913 2708 dbSNP
rs1019733800 2715 dbSNP
rs142225715 2716 dbSNP
rs754280354 2719 dbSNP
rs1397457297 2735 dbSNP
rs1317607188 2738 dbSNP
rs1375220553 2760 dbSNP
rs1239895723 2764 dbSNP
rs1287286760 2766 dbSNP
rs989498316 2768 dbSNP
rs915242936 2774 dbSNP
rs1190663404 2786 dbSNP
rs945343390 2792 dbSNP
rs1042652645 2799 dbSNP
rs533594086 2800 dbSNP
rs1285413628 2805 dbSNP
rs1209700665 2809 dbSNP
rs182783796 2811 dbSNP
rs573494512 2812 dbSNP
rs558420786 2830 dbSNP
rs1233948366 2848 dbSNP
rs1339986648 2853 dbSNP
rs576750722 2867 dbSNP
rs1276536465 2882 dbSNP
rs1255538862 2884 dbSNP
rs1433224250 2891 dbSNP
rs544525412 2894 dbSNP
rs1404649417 2896 dbSNP
rs939558612 2896 dbSNP
rs1392175177 2898 dbSNP
rs1055687956 2899 dbSNP
rs1236125234 2914 dbSNP
rs968888255 2922 dbSNP
rs895287630 2926 dbSNP
rs550003241 2929 dbSNP
rs4919551 2930 dbSNP
rs559097368 2933 dbSNP
rs1410006437 2934 dbSNP
rs1467452056 2936 dbSNP
rs1255404725 2937 dbSNP
rs1214927969 2938 dbSNP
rs959931060 2944 dbSNP
rs1256251001 2952 dbSNP
rs1216478957 2954 dbSNP
rs888121805 2957 dbSNP
rs1003875775 2979 dbSNP
rs1015560140 2980 dbSNP
rs3127242 2983 dbSNP
rs1470744293 2984 dbSNP
rs1328795397 2986 dbSNP
rs1399101121 2987 dbSNP
rs187898090 2990 dbSNP
rs1326320556 2996 dbSNP
rs528619228 3001 dbSNP
rs1045324 3004 dbSNP
rs1419759266 3006 dbSNP
rs573991030 3013 dbSNP
rs1452953172 3016 dbSNP
rs1376141183 3017 dbSNP
rs1218026045 3021 dbSNP
rs1397335047 3030 dbSNP
rs1300676828 3035 dbSNP
rs1231206080 3038 dbSNP
rs1312912229 3039 dbSNP
rs1438507094 3047 dbSNP
rs1278183823 3051 dbSNP
rs953861646 3053 dbSNP
rs1345403866 3056 dbSNP
rs1256346181 3057 dbSNP
rs989530567 3063 dbSNP
rs1305367270 3076 dbSNP
rs915318609 3078 dbSNP
rs1457498982 3079 dbSNP
rs1296429390 3086 dbSNP
rs879361087 3087 dbSNP
rs1234433150 3090 dbSNP
rs1333075047 3096 dbSNP
rs1487461147 3101 dbSNP
rs1190603456 3102 dbSNP
rs16405 3103 dbSNP
rs772171108 3103 dbSNP
rs1174691950 3106 dbSNP
rs113362410 3107 dbSNP
rs1481094981 3109 dbSNP
rs79177816 3112 dbSNP
rs532379991 3123 dbSNP
rs1167956700 3128 dbSNP
rs940465014 3130 dbSNP
rs1236991324 3132 dbSNP
rs1208921462 3133 dbSNP
rs939613149 3136 dbSNP
rs1329930950 3138 dbSNP
rs1282138059 3143 dbSNP
rs1211307789 3148 dbSNP
rs1225447447 3149 dbSNP
rs1373352190 3149 dbSNP
rs551303099 3149 dbSNP
rs1292137354 3155 dbSNP
rs1434933850 3164 dbSNP
rs151232683 3165 dbSNP
rs919993558 3170 dbSNP
rs1419479599 3172 dbSNP
rs1293401169 3173 dbSNP
rs931407418 3185 dbSNP
rs1368949870 3187 dbSNP
rs1225371883 3191 dbSNP
rs1161842437 3194 dbSNP
rs1276436581 3195 dbSNP
rs1413121364 3197 dbSNP
rs1185929872 3205 dbSNP
rs1049738190 3207 dbSNP
rs1258447347 3210 dbSNP
rs930765503 3212 dbSNP
rs1485411946 3213 dbSNP
rs773968074 3214 dbSNP
rs373141707 3221 dbSNP
rs761480891 3229 dbSNP
rs889818450 3233 dbSNP
rs1008432513 3234 dbSNP
rs1048208645 3253 dbSNP
rs1041243180 3261 dbSNP
rs1319639941 3268 dbSNP
rs1220562599 3269 dbSNP
rs766977871 3270 dbSNP
rs1381315148 3295 dbSNP
rs1360228512 3315 dbSNP
rs892056096 3319 dbSNP
rs1349790156 3325 dbSNP
rs1163457854 3326 dbSNP
rs1463071058 3330 dbSNP
rs1418736538 3334 dbSNP
rs992384175 3334 dbSNP
rs1426963296 3340 dbSNP
rs35875591 3340 dbSNP
rs1010377229 3342 dbSNP
rs900810833 3348 dbSNP
rs1247174737 3349 dbSNP
rs1486099301 3357 dbSNP
rs1252294615 3358 dbSNP
rs1211807391 3364 dbSNP
rs1490826699 3365 dbSNP
rs746031296 3369 dbSNP
rs868010913 3374 dbSNP
rs998510984 3377 dbSNP
rs761654945 3388 dbSNP
rs1022231680 3392 dbSNP
rs1297339508 3396 dbSNP
rs1010690729 3403 dbSNP
rs561882112 3408 dbSNP
rs968482055 3414 dbSNP
rs190739486 3417 dbSNP
rs1443762212 3421 dbSNP
rs1395220611 3429 dbSNP
rs978117838 3432 dbSNP
rs1034005714 3433 dbSNP
rs959731722 3439 dbSNP
rs566693525 3451 dbSNP
rs368430225 3452 dbSNP
rs11191046 3454 dbSNP
rs1428884328 3456 dbSNP
rs961967383 3471 dbSNP
rs1191597374 3476 dbSNP
rs41291482 3482 dbSNP
rs556085435 3486 dbSNP
rs773656050 3498 dbSNP
rs1296413992 3503 dbSNP
rs920447121 3505 dbSNP
rs931407165 3508 dbSNP
rs761087342 3510 dbSNP
rs1049242124 3515 dbSNP
rs150357192 3518 dbSNP
rs184229997 3522 dbSNP
rs1272078375 3532 dbSNP
rs766702083 3534 dbSNP
rs369604790 3536 dbSNP
rs944009126 3539 dbSNP
rs544235866 3541 dbSNP
rs1298906049 3545 dbSNP
rs1389711010 3545 dbSNP
rs796686393 3545 dbSNP
rs1041038729 3552 dbSNP
rs1374583333 3552 dbSNP
rs1361466737 3553 dbSNP
rs1455463102 3553 dbSNP
rs367835216 3553 dbSNP
rs900840543 3554 dbSNP
rs892025509 3556 dbSNP
rs1181086063 3559 dbSNP
rs540534687 3562 dbSNP
rs747500700 3562 dbSNP
rs1284672974 3563 dbSNP
rs1050146319 3567 dbSNP
rs1195947969 3568 dbSNP
rs1485156686 3569 dbSNP
rs563265193 3570 dbSNP
rs1043215452 3578 dbSNP
rs1349100555 3584 dbSNP
rs1472287300 3595 dbSNP
rs1237541578 3596 dbSNP
rs1181604995 3607 dbSNP
rs572253961 3610 dbSNP
rs1414347199 3614 dbSNP
rs540757021 3617 dbSNP
rs565230730 3618 dbSNP
rs1315060326 3619 dbSNP
rs966493625 3620 dbSNP
rs999568850 3624 dbSNP
rs1157864350 3625 dbSNP
rs1001286954 3631 dbSNP
rs1364985665 3634 dbSNP
rs1034059834 3636 dbSNP
rs895575709 3641 dbSNP
rs1320394346 3645 dbSNP
rs532577797 3663 dbSNP
rs1189710200 3665 dbSNP
rs1486170745 3674 dbSNP
rs1338904045 3678 dbSNP
rs990835255 3686 dbSNP
rs1315467175 3692 dbSNP
rs916842605 3692 dbSNP
rs1013898120 3693 dbSNP
rs1261879068 3712 dbSNP
rs1232720666 3719 dbSNP
rs1332860746 3725 dbSNP
rs544287658 3726 dbSNP
rs1415637765 3735 dbSNP
rs961969267 3738 dbSNP
rs908041589 3740 dbSNP
rs1380405462 3741 dbSNP
rs1387017553 3751 dbSNP
rs1159866409 3756 dbSNP
rs1460462207 3766 dbSNP
rs1415097265 3770 dbSNP
rs973761721 3772 dbSNP
rs1351355768 3786 dbSNP
rs1241845296 3788 dbSNP
rs972927158 3790 dbSNP
rs1449140724 3796 dbSNP
rs922372309 3799 dbSNP
rs1206357375 3800 dbSNP
rs1275940052 3806 dbSNP
rs765571190 3807 dbSNP
rs953295216 3810 dbSNP
rs1049391087 3816 dbSNP
rs985935930 3818 dbSNP
rs946653495 3820 dbSNP
rs1224925940 3821 dbSNP
rs752760677 3836 dbSNP
rs1321123976 3839 dbSNP
rs1440089562 3843 dbSNP
rs1437365471 3844 dbSNP
rs112951928 3846 dbSNP
rs976704812 3862 dbSNP
rs1405496737 3864 dbSNP
rs530346677 3869 dbSNP
rs1160343738 3874 dbSNP
rs1165863054 3874 dbSNP
rs946308866 3875 dbSNP
rs896552630 3886 dbSNP
rs1337574817 3897 dbSNP
rs1453144567 3909 dbSNP
rs1408585220 3910 dbSNP
rs1222365911 3911 dbSNP
rs1437355323 3918 dbSNP
rs1012692011 3926 dbSNP
rs1197837720 3940 dbSNP
rs1341140667 3953 dbSNP
rs548459881 3957 dbSNP
rs1043739969 3966 dbSNP
rs1298105211 3968 dbSNP
rs904773977 3977 dbSNP
rs1444263819 3978 dbSNP
rs1436571399 3981 dbSNP
rs764080042 3986 dbSNP
rs1326384902 3991 dbSNP
rs751505095 3998 dbSNP
rs1371511381 4002 dbSNP
rs1173425524 4011 dbSNP
rs1336243911 4028 dbSNP
rs1023656758 4029 dbSNP
rs1241175190 4037 dbSNP
rs868250655 4041 dbSNP
rs937470596 4044 dbSNP
rs952004183 4045 dbSNP
rs1184202687 4052 dbSNP
rs1483517835 4056 dbSNP
rs1279944364 4058 dbSNP
rs1272556401 4068 dbSNP
rs1055984632 4085 dbSNP
rs1219757639 4088 dbSNP
rs1371907375 4094 dbSNP
rs1277294291 4118 dbSNP
rs985047387 4130 dbSNP
rs895544229 4131 dbSNP
rs1014036539 4136 dbSNP
rs1311933499 4137 dbSNP
rs1264573238 4148 dbSNP
rs1433241030 4148 dbSNP
rs750728501 4149 dbSNP
rs1014586113 4153 dbSNP
rs1456186741 4154 dbSNP
rs962242087 4158 dbSNP
rs757049326 4162 dbSNP
rs976256975 4176 dbSNP
rs1160350559 4180 dbSNP
rs780813080 4185 dbSNP
rs922372064 4186 dbSNP
rs1237996383 4187 dbSNP
rs933768808 4193 dbSNP
rs985589186 4194 dbSNP
rs897524442 4200 dbSNP
rs745681559 4202 dbSNP
rs946350951 4216 dbSNP
rs1027951070 4225 dbSNP
rs755703526 4236 dbSNP
rs1477702890 4238 dbSNP
rs1177288173 4241 dbSNP
rs985901199 4245 dbSNP
rs902436248 4246 dbSNP
rs1292278396 4253 dbSNP
rs1412552392 4255 dbSNP
rs1381712176 4261 dbSNP
rs1018755613 4269 dbSNP
rs1056289020 4270 dbSNP
rs566754327 4273 dbSNP
rs1162000314 4279 dbSNP
rs1012352904 4281 dbSNP
rs1417269930 4283 dbSNP
rs1162977073 4284 dbSNP
rs1023689370 4290 dbSNP
rs36117325 4291 dbSNP
rs1397017023 4292 dbSNP
rs779681361 4295 dbSNP
rs887809152 4299 dbSNP
rs748787959 4300 dbSNP
rs1485443178 4310 dbSNP
rs965418323 4312 dbSNP
rs1210576614 4313 dbSNP
rs1464909629 4319 dbSNP
rs1330482094 4321 dbSNP
rs1015206670 4322 dbSNP
rs1323122032 4332 dbSNP
rs1313039649 4333 dbSNP
rs753156078 4352 dbSNP
rs768107765 4356 dbSNP
rs962306532 4361 dbSNP
rs758517825 4367 dbSNP
rs1315651106 4368 dbSNP
rs1217711644 4373 dbSNP
rs1393783042 4389 dbSNP
rs527878251 4397 dbSNP
rs1463119540 4405 dbSNP
rs953632504 4409 dbSNP
rs913231672 4410 dbSNP
rs946001090 4416 dbSNP
rs551896192 4421 dbSNP
rs1417143661 4423 dbSNP
rs1340427547 4429 dbSNP
rs978795360 4430 dbSNP
rs529076612 4439 dbSNP
rs910964061 4444 dbSNP
rs1197935289 4446 dbSNP
rs570463632 4462 dbSNP
rs1211243307 4471 dbSNP
rs1265841086 4476 dbSNP
rs1265651799 4478 dbSNP
rs537901117 4484 dbSNP
rs773746530 4491 dbSNP
rs1300307365 4493 dbSNP
rs1229733586 4494 dbSNP
rs937595844 4495 dbSNP
rs1370871921 4502 dbSNP
rs1301929849 4505 dbSNP
rs1055955077 4506 dbSNP
rs555908668 4507 dbSNP
rs917451932 4515 dbSNP
rs1490337441 4517 dbSNP
rs967727554 4518 dbSNP
rs1200190391 4521 dbSNP
rs138007808 4524 dbSNP
rs1271219039 4533 dbSNP
rs547646425 4541 dbSNP
rs949778746 4542 dbSNP
rs535782033 4556 dbSNP
rs979049557 4561 dbSNP
rs4919552 4562 dbSNP
rs1191733529 4570 dbSNP
rs1434341554 4572 dbSNP
rs1267447634 4580 dbSNP
rs867321679 4591 dbSNP
rs994881439 4592 dbSNP
rs935276889 4598 dbSNP
rs771499076 4607 dbSNP
rs1056762889 4628 dbSNP
rs889011083 4629 dbSNP
rs187799352 4631 dbSNP
rs1347694774 4633 dbSNP
rs546009804 4653 dbSNP
rs1278793382 4665 dbSNP
rs1161266202 4667 dbSNP
rs34329137 4667 dbSNP
rs1236083477 4671 dbSNP
rs551812768 4672 dbSNP
rs557892646 4675 dbSNP
rs34171532 4678 dbSNP
rs1306425685 4682 dbSNP
rs965891759 4684 dbSNP
rs887841985 4685 dbSNP
rs1006253707 4686 dbSNP
rs1170676390 4689 dbSNP
rs1036376115 4690 dbSNP
rs1009360819 4694 dbSNP
rs1416828970 4695 dbSNP
rs1020755308 4712 dbSNP
rs759986126 4717 dbSNP
rs1182528141 4720 dbSNP
rs1485517904 4740 dbSNP
rs979148464 4750 dbSNP
rs765552550 4758 dbSNP
rs1255854985 4760 dbSNP
rs751629385 4764 dbSNP
rs997780658 4774 dbSNP
rs1030966388 4777 dbSNP
rs775912852 4781 dbSNP
rs370545555 4782 dbSNP
rs1018003849 4789 dbSNP
rs991774998 4790 dbSNP
rs967760123 4791 dbSNP
rs1354539092 4793 dbSNP
rs979124602 4801 dbSNP
rs917507758 4810 dbSNP
rs923650992 4818 dbSNP
rs1359338636 4833 dbSNP
rs1223956854 4840 dbSNP
rs1294599111 4842 dbSNP
rs950162946 4848 dbSNP
rs1159359200 4853 dbSNP
rs1036544388 4857 dbSNP
rs140919649 4858 dbSNP
rs1186035712 4861 dbSNP
rs930432899 4867 dbSNP
rs1443395024 4868 dbSNP
rs947934530 4871 dbSNP
rs1203911002 4877 dbSNP
rs1466256207 4879 dbSNP
rs562753646 4881 dbSNP
rs1430570049 4907 dbSNP
rs1232846548 4908 dbSNP
rs530016511 4913 dbSNP
rs757346376 4915 dbSNP
rs764122418 4918 dbSNP
rs1036407454 4920 dbSNP
rs1340907252 4922 dbSNP
rs1294701718 4931 dbSNP
rs1432820478 4934 dbSNP
rs1390154022 4937 dbSNP
rs1040231370 4958 dbSNP
rs1460511544 4960 dbSNP
rs375176118 4962 dbSNP
rs901777916 4963 dbSNP
rs889349507 4964 dbSNP
rs1372871633 4992 dbSNP
rs1009328181 4996 dbSNP
rs1451902311 5004 dbSNP
rs781043254 5006 dbSNP
rs1213108684 5017 dbSNP
rs1418520623 5022 dbSNP
rs1020806243 5033 dbSNP
rs967849420 5035 dbSNP
rs1386660168 5036 dbSNP
rs562283367 5041 dbSNP
rs1033419188 5051 dbSNP
rs796727785 5053 dbSNP
rs1382414348 5054 dbSNP
rs958655344 5055 dbSNP
rs991494676 5056 dbSNP
rs1024533063 5059 dbSNP
rs971656557 5070 dbSNP
rs866358497 5071 dbSNP
rs1352177161 5078 dbSNP
rs1031137125 5082 dbSNP
rs1215129318 5087 dbSNP
rs367810554 5093 dbSNP
rs1325037325 5097 dbSNP
rs930378518 5112 dbSNP
rs560406614 5114 dbSNP
rs1167072136 5115 dbSNP
rs1486970156 5118 dbSNP
rs1432056874 5120 dbSNP
rs1199008405 5125 dbSNP
rs956436155 5127 dbSNP
rs527940717 5138 dbSNP
rs992214121 5153 dbSNP
rs1242776326 5155 dbSNP
rs1444946109 5168 dbSNP
rs1045232 5185 dbSNP
rs1437489705 5186 dbSNP
rs1272816384 5193 dbSNP
rs1202723693 5194 dbSNP
rs1378356108 5200 dbSNP
rs1418485593 5204 dbSNP
rs943007427 5206 dbSNP
rs1040032123 5212 dbSNP
rs1233478127 5217 dbSNP
rs1159161122 5218 dbSNP
rs1342208147 5224 dbSNP
rs969305254 5232 dbSNP
rs570997693 5246 dbSNP
rs980659977 5253 dbSNP
rs772010668 5258 dbSNP
rs901746741 5265 dbSNP
rs767451764 5274 dbSNP
rs945338734 5277 dbSNP
rs941809191 5278 dbSNP
rs144643304 5286 dbSNP
rs1173493293 5287 dbSNP
rs1042602250 5292 dbSNP
rs1301844239 5300 dbSNP
rs1406391485 5313 dbSNP
rs1469729952 5314 dbSNP
rs566159018 5315 dbSNP
rs549832147 5318 dbSNP
rs1185076204 5323 dbSNP
rs568089072 5324 dbSNP
rs1252311956 5325 dbSNP
rs1209274770 5333 dbSNP
rs1440605078 5336 dbSNP
rs1280698224 5345 dbSNP
rs1339151847 5348 dbSNP
rs1327928543 5350 dbSNP
rs919334134 5357 dbSNP
rs1223772910 5363 dbSNP
rs933361229 5366 dbSNP
rs1351447137 5372 dbSNP
rs1052187608 5382 dbSNP
rs889095552 5383 dbSNP
rs745736103 5387 dbSNP
rs1043251936 5388 dbSNP
rs1335530211 5388 dbSNP
rs943643990 5388 dbSNP
rs535440187 5401 dbSNP
rs1473053222 5413 dbSNP
rs1417472437 5414 dbSNP
rs1000686762 5431 dbSNP
rs1318739706 5439 dbSNP
rs1181034289 5442 dbSNP
rs1482190333 5479 dbSNP
rs1239112939 5481 dbSNP
rs1210741254 5484 dbSNP
rs1231176859 5487 dbSNP
rs1463998830 5511 dbSNP
rs904710405 5515 dbSNP
rs1210155533 5521 dbSNP
rs750147596 5524 dbSNP
rs1329398762 5530 dbSNP
rs1311622042 5532 dbSNP
rs1033064775 5539 dbSNP
rs1262691616 5540 dbSNP
rs1285242718 5545 dbSNP
rs1461960077 5547 dbSNP
rs894576653 5549 dbSNP
rs1012897599 5550 dbSNP
rs1322613308 5554 dbSNP
rs192286360 5564 dbSNP
rs1394018323 5565 dbSNP
rs1163014618 5566 dbSNP
rs892194452 5576 dbSNP
rs184582849 5578 dbSNP
rs187374707 5579 dbSNP
rs1448817797 5602 dbSNP
rs1246171544 5605 dbSNP
rs1189905472 5608 dbSNP
rs557688417 5614 dbSNP
rs1013305877 5615 dbSNP
rs1264480647 5619 dbSNP
rs779664856 5634 dbSNP
rs576149968 5635 dbSNP
rs1323838172 5642 dbSNP
rs1291064380 5643 dbSNP
rs1300528326 5648 dbSNP
rs377191200 5648 dbSNP
rs1025078823 5650 dbSNP
rs1367008746 5653 dbSNP
rs1291933535 5654 dbSNP
rs1459672493 5656 dbSNP
rs969002133 5658 dbSNP
rs972375485 5659 dbSNP
rs1428920810 5664 dbSNP
rs556617897 5666 dbSNP
rs1190499894 5668 dbSNP
rs1449481221 5670 dbSNP
rs1026894257 5681 dbSNP
rs1016181652 5684 dbSNP
rs1489245040 5690 dbSNP
rs1246964828 5702 dbSNP
rs963246623 5719 dbSNP
rs754478528 5721 dbSNP
rs1429518520 5730 dbSNP
rs972291083 5731 dbSNP
rs1179014893 5732 dbSNP
rs1311642096 5733 dbSNP
rs1299315292 5735 dbSNP
rs952205290 5742 dbSNP
rs779688740 5743 dbSNP
rs1307732139 5744 dbSNP
rs749143989 5750 dbSNP
rs1408978864 5755 dbSNP
rs574535767 5756 dbSNP
rs975703502 5757 dbSNP
rs1376191526 5776 dbSNP
rs1385109818 5783 dbSNP
rs910556877 5787 dbSNP
rs541832861 5788 dbSNP
rs1173301806 5789 dbSNP
rs1225639638 5792 dbSNP
rs1256408375 5799 dbSNP
rs943341451 5802 dbSNP
rs1181021394 5809 dbSNP
rs867581009 5820 dbSNP
rs1482237661 5829 dbSNP
rs1254454280 5836 dbSNP
rs560068930 5841 dbSNP
rs1204990190 5851 dbSNP
rs572426885 5864 dbSNP
rs138528205 5877 dbSNP
rs903776110 5880 dbSNP
rs1235513542 5887 dbSNP
rs149233586 5888 dbSNP
rs1287903113 5895 dbSNP
rs1226800212 5897 dbSNP
rs1198041856 5900 dbSNP
rs1309596722 5905 dbSNP
rs1054982479 5923 dbSNP
rs1391798983 5933 dbSNP
rs1401403220 5940 dbSNP
rs1301076101 5943 dbSNP
rs1269048323 5946 dbSNP
rs1157901534 5947 dbSNP
rs1053707314 5954 dbSNP
rs191823724 5956 dbSNP
rs1413786071 5966 dbSNP
rs1183316052 5969 dbSNP
rs895960968 5970 dbSNP
rs1254669922 5977 dbSNP
rs184722257 5979 dbSNP
rs1483582071 5986 dbSNP
rs1013754739 5987 dbSNP
rs549655575 5994 dbSNP
rs561756291 5995 dbSNP
rs528955450 5998 dbSNP
rs1331445375 6005 dbSNP
rs1289293698 6008 dbSNP
rs547416858 6009 dbSNP
rs1024692234 6014 dbSNP
rs1339666168 6022 dbSNP
rs993905421 6030 dbSNP
rs11595968 6035 dbSNP
rs1397745119 6036 dbSNP
rs372344159 6046 dbSNP
rs1001867637 6048 dbSNP
rs746223485 6049 dbSNP
rs200952428 6051 dbSNP
rs1006367237 6055 dbSNP
rs1158847175 6059 dbSNP
rs14249 6063 dbSNP
rs1457669738 6065 dbSNP
rs963279100 6067 dbSNP
rs547294463 6073 dbSNP
rs551636044 6084 dbSNP
rs569799336 6085 dbSNP
rs1423346790 6090 dbSNP
rs1247992617 6102 dbSNP
rs1302610320 6103 dbSNP
rs954531607 6107 dbSNP
rs987970972 6116 dbSNP
rs1268937600 6118 dbSNP
rs1276488967 6119 dbSNP
rs1355324361 6121 dbSNP
rs1263476768 6135 dbSNP
rs975839637 6137 dbSNP
rs1296877319 6143 dbSNP
rs1383402958 6143 dbSNP
rs1432251772 6145 dbSNP
rs910630503 6164 dbSNP
rs922938322 6165 dbSNP
rs1404431493 6166 dbSNP
rs1388965166 6177 dbSNP
rs1165330318 6179 dbSNP
rs964702979 6182 dbSNP
rs1274916758 6183 dbSNP
rs1167278559 6186 dbSNP
rs966364369 6201 dbSNP
rs2019 6202 dbSNP
rs763048606 6208 dbSNP
rs11596007 6218 dbSNP
rs1269790734 6222 dbSNP
rs1224442249 6230 dbSNP
rs1273756896 6231 dbSNP
rs774234466 6234 dbSNP
rs1343629750 6236 dbSNP
rs936607138 6238 dbSNP
rs1435192805 6243 dbSNP
rs1053351986 6255 dbSNP
rs759939844 6256 dbSNP
rs1292415072 6270 dbSNP
rs1490680578 6272 dbSNP
rs376063016 6275 dbSNP
rs1432190530 6284 dbSNP
rs1420907525 6290 dbSNP
rs559087241 6290 dbSNP
rs575858415 6297 dbSNP
rs1475558931 6302 dbSNP
rs1187445814 6304 dbSNP
rs1379580604 6316 dbSNP
rs1200438537 6324 dbSNP
rs950233141 6333 dbSNP
rs767435335 6337 dbSNP
rs1046203331 6338 dbSNP
rs1439469441 6342 dbSNP
rs765813943 6343 dbSNP
rs904940150 6347 dbSNP
rs1001903603 6357 dbSNP
rs1342277380 6358 dbSNP
rs1276184657 6362 dbSNP
rs35171143 6365 dbSNP
rs1223778204 6371 dbSNP
rs568016857 6372 dbSNP
rs916449903 6378 dbSNP
rs1286822670 6379 dbSNP
rs1412106780 6381 dbSNP
rs1443317218 6386 dbSNP
rs948778704 6397 dbSNP
rs1045804287 6398 dbSNP
rs750415340 6399 dbSNP
rs1404452748 6400 dbSNP
rs1410098435 6400 dbSNP
rs1472399883 6400 dbSNP
rs557983228 6400 dbSNP
rs560598778 6400 dbSNP
rs796706306 6400 dbSNP
rs993486091 6401 dbSNP
rs1048212836 6402 dbSNP
rs993838342 6404 dbSNP
rs1233327479 6408 dbSNP
rs888019504 6425 dbSNP
rs1366763871 6430 dbSNP
rs1440157450 6440 dbSNP
rs1026199936 6444 dbSNP
rs954729427 6445 dbSNP
rs535528055 6447 dbSNP
rs1225820799 6451 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||:|| ||||||||||| 
Target 5' gcCAAATCACTATGTGCTGCTg 3'
9 - 30
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.443 2.0e-6 0.388 3.3e-5 100 Click to see details
GSE19783 ER- ER- breast cancer 0.42 5.8e-5 0.406 1.0e-4 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.525 3.5e-3 -0.638 3.0e-4 25 Click to see details
GSE14794 Lymphoblastoid cells -0.268 5.3e-3 -0.210 2.3e-2 90 Click to see details
GSE32688 Pancreatic cancer -0.42 8.4e-3 -0.167 1.8e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.614 1.3e-2 -0.846 1.3e-4 13 Click to see details
GSE28544 Breast cancer -0.393 2.9e-2 -0.654 2.6e-4 24 Click to see details
GSE38226 Liver fibrosis 0.37 4.9e-2 0.115 3.1e-1 21 Click to see details
GSE21032 Prostate cancer 0.177 5.5e-2 0.155 8.1e-2 83 Click to see details
GSE17498 Multiple myeloma 0.21 9.7e-2 0.152 1.7e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells -0.25 1.2e-1 -0.104 3.2e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.202 2.0e-1 0.394 4.3e-2 20 Click to see details
GSE21849 B cell lymphoma 0.146 2.2e-1 0.250 9.5e-2 29 Click to see details
GSE19350 CNS germ cell tumors 0.202 2.6e-1 -0.042 4.5e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.144 2.7e-1 0.092 3.5e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.074 2.8e-1 -0.014 4.6e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.031 4.4e-1 -0.111 3.0e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.04 4.4e-1 -0.124 3.2e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.022 4.6e-1 -0.027 4.5e-1 24 Click to see details
GSE17306 Multiple myeloma 0.013 4.6e-1 -0.046 3.8e-1 49 Click to see details
GSE17306 Multiple myeloma 0.013 4.6e-1 -0.046 3.8e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.531 0 -0.492 0 32 Click to see details
CHOL -0.576 0.05 -0.467 0.1 9 Click to see details
BLCA -0.361 0.07 -0.230 0.18 18 Click to see details
KICH -0.274 0.09 -0.270 0.1 25 Click to see details
BRCA -0.137 0.11 -0.173 0.06 84 Click to see details
ESCA -0.406 0.11 -0.436 0.09 11 Click to see details
THCA -0.142 0.14 -0.167 0.1 59 Click to see details
LUSC -0.17 0.15 -0.165 0.16 38 Click to see details
HNSC 0.153 0.17 0.117 0.23 42 Click to see details
PCPG -0.761 0.22 -0.500 0.33 3 Click to see details
KIRP -0.126 0.25 -0.149 0.21 32 Click to see details
COAD -0.233 0.29 -0.333 0.21 8 Click to see details
LUAD 0.074 0.41 0.196 0.27 12 Click to see details
LIHC -0.025 0.43 -0.064 0.33 49 Click to see details
PRAD -0.018 0.45 -0.006 0.48 50 Click to see details
UCEC -0.016 0.47 -0.005 0.49 19 Click to see details
CESC 0.076 0.48 0.500 0.33 3 Click to see details
KIRC 0.003 0.49 0.017 0.45 68 Click to see details
PAAD 0.007 0.5 0.600 0.2 4 Click to see details
PAAD 0.007 0.5 0.600 0.2 4 Click to see details
PAAD 0.007 0.5 0.600 0.2 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6