miRTarBase - #MIRT061005 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C1orf21   
Synonyms PIG13
Description chromosome 1 open reading frame 21
Transcript NM_030806   
Expression
Putative miRNA Targets on C1orf21
3'UTR of C1orf21
(miRNA target sites are highlighted)
>C1orf21|NM_030806|3'UTR
   1 CACCAATTTTACCACTCAAACCAGGAGCTACTACTGTGTAAATAGGTTACACCCCAGTTGAAATCTTTGCAAAGGTCGGT
  81 TCTATTCAGCGAACAGCACTATAGCAAAAGAAGATCGTTCCATATTGTACGCCCCATTAAATTACAGTGTTTCTTAATGA
 161 ACTTGCAAAGGAATATTGCTAAAAACAAACAAAAAAAACTGTTATCGAACTTTCTTTGTTGCTGCTAGTTAAAACTTGTT
 241 GCAACTTTTCACTTCTCTTGTGTCCAGGTATGCAGCAAAATTCTGCAATTTCACCTTAAAGATACTGTTGGTTTTACAGA
 321 TGCTCTCCAACCTATTTTCTATAAGATGAGGTAGTGGTGAACTCAGATAACAAACTTCTCTTCTAAACTGGTTCTGCTTC
 401 TAAGACAAGCATCTCCTGCCCTCTCTCCTTCCTCCCCATCTCTCGCACGCAGTCTAGAGATGGACTGAGCCTTGCTTCTC
 481 ACTGGCAGTGTTGAGCTTTGGAGATGGGATGGTTGCTATGCCAAGCCTTGTTTCTCTGCTCAGAAGAAGTAGAGAAGCTA
 561 TTATCAATTAAAAGCATGCTGTGATGTGACTCCTGGAAGTGACGTAGGAGTGAGTGGCAGGTTGTTTGATTTAATAGGTA
 641 TCTTAATCAAGAATTAAGCTTGCAACATTGGCTTTGCTCAGATGCAGATGGAAGTGTGATCACAATCATTTTGAATCCCT
 721 CTTCCTCACTTTTTTTTCTAAGAAAATAAACATTTTACTGTTTTTATGGATCCTTGTCTTCTCCCATTCATCCAGCTCAG
 801 TGTTTTAAGATGATCCTGGGTGCAGAAGTTGAGCCCTCCTTTGCATTGACACTGATAATTAGCCTATAGGGCTCCCTACC
 881 CTTCCATTAAGAATCTACCAAGCATTAGCAAGGCTGAAAGTGGTCTAAGAGGTGAGGGGACATCCTATGACTTTTTAGGA
 961 AGGCCTGAAACCACCTTGTTACCTTTCATTTTGTTAGCAAATAAACCATCCTATTTTGTAACTCTCCCCCTTCAAAATGC
1041 TACATGAGCCTTGCCACTTCCTTTTTCTCTTACTTCCAGCACACTAGACATAGCAAAAGTGTTTGCCTACTCAAAAACAT
1121 AATACTTTTATGCTGATGATGGTATTTGGAGATGTGAAAGCCAAAAGCCCCTGGCAGTGGTGGGGAATGTTGACTGAGTG
1201 TTCAGCAGAGTTTATTTTTCCATACTATATGAAGAGAATGATCTCTTCTCAAAGACAGAAGTGATATTTTTAACAAATAT
1281 TGTCACAAGTAAATAGCAATCAAAAGGAGAAAATAACTTTTGTATTTTTTTAATGTGTTTGATAGCTTTGACGAGGGTTC
1361 TCTTTGTTACTTTCAGGGGAGGGCATCCTATTAAATGCCACGCCAGCAGTCCGGGTCTGGGTTTGTCCCACAAAATCACA
1441 GGAGCACTGTATGTTCCTCTCTTTTGGAGTTGTGACTTTGAAGGGCCTCAATATTAGCCACACTGCCGCCTGCAGAAGGT
1521 GGAGAGTTAAGATGTTCTATGTCAATTTGCTCTTGCCGAAAAGATGAGCCTCGATTTTAAAATCTATCCACATCCAACTG
1601 ATGGCACCATTGATGTGCAAATAATGAGATTCCCTATCTCCTTTTAGACCTGGGACGGCAAAAGGGAAGGGAAGGAAACT
1681 TAGCAGAGTGCTATTGACTATAGATTCACATATTAGCAACAAAATCCCGTAATTCTTTTGGCCAACAGCAGCTATTTTGG
1761 GGAGCAGCTGTGGCTGTTACATAAATAGAGATGCAGCCAAAATTTTAGGCCTTTTATCCTGCTTCTAGCAGAAAAATGCA
1841 GGGAGAGTCAAGTAGTCTAGGGTTTCAGGTTGCCTCCCCTCATATGGTTTTTGGCCAAGTGACTAAAACAGTTTTCCACA
1921 ACTGTAAACAAACTGCTAAGCCCCACCTCAAACTTGTTCACTGGGGACTTTGCTTACCGTTCTGTGGGTGACCTTTTCCG
2001 GGATTTCTTGTTCTTATCAAGCAAGAATTAAGCACATGCTAAACGTCTTCCATTTGACTTCTCTACTCGGTGTCTCAGAC
2081 AGTGTCTTCCCAGAAAACCACCACCCTCTACCCAAAGATGAAACATGCTCATGTCATTTTTCTCATGGTCACATTTAACA
2161 GTTTTGACATGTTATACTTGCGCATAGATCCAAGCGTTTCTTGGGAACCTGACTTTTGAGTGTTTAATAAAGCCGGAAGT
2241 GGTGTTGCCCTGAACCAGCAGATTTTCACCTGGGTTCTGGCTCCGGTGTTTAACACTGGATACATCTTTGATGTGCGAAA
2321 GTGAGTTCATCTTCAGACACATTTGGTACATCCAGAAATAGATCCAAGAAATGGGGTGGTTGAGTGGGTCCGCACGAAAT
2401 GCTTGATTATGTCAGCAACACCCAACACTGTCTGTTTTCCATTTGTTGGTTTTAATCATAAAATTGTCAAGTGATTCGTG
2481 TTTGTACTTTATTTTTTTGTGCCTTCTGAAAGGATCTAAAACAAAAATATTTTGCCTTTTTTTCCCCACGTGTATCTGAA
2561 CATTAAGCAGATTGGCTCAGACACAATGAAAAGGATAATCCAATGTACGTGCTGGTGCACTCTGCTAGTTGTTATCTCTG
2641 TAGGGCTCAGGAAGCTGGAAGGAGGAAGGGAGGGTAAGTGGCCTGGTGAGTGGAGGTAGAAAAATGATGAGAAATGAACT
2721 GAGAGCATTAAGCAGAGAGGGTTGATAGGCTGGCCGTGTCCGGGGTGAAATTGGAAATCCAGCTGCCTAGTGGCCAGTGG
2801 GTGGGGCAAGACTGTCAACGAGATTTACAGCTGGCTTACACATGCCTTATGTCCTCTGAGTTGTAGAGTTGTAAAAGTTC
2881 AGCAGTGTGTGCACAGCTTTCTTTTGGTTGGCAGAGATTCAGGATCATGGAGTACTGCTCTCATAATTGAAGACGTGTTT
2961 GTTATTGGCAGAGAACCTTAAAAAAGGCCTTTACCTCAGCGATGCTTCCTAGCCCCAGGCTTGCAGAGAACACAGAGTGG
3041 TGTTGTGGTCTATTTAGGGACAAAGAAGGTATAAAGTCCAGAGATGAGAAAACTGGGTCAGCCCTCAGAAACTGCAGCAG
3121 CCACGCACACAGAAGCCTGCTGGAAGACAGGTCTCTCTCCGTCCACAGTGCCCATCATCTGAGCCTGGGCTGGGATGACT
3201 CAACTTAGCAAAGACGGACCCAGGAGGAGTGCTGGTTCTTCAGTCTTTGTACTGGCCCCATCCTCTCCTCACTGTAATGT
3281 GAGGAAGCACCTCTGTGTCAGGGCTCACCTGGGCATCCAAAGCGGCCACGCCCACAATCCGACAGCCCCCAGGAGCAGGT
3361 CCAGGGATGATGCAGCCCCCTTCTTGGTCCCATGTGATGTCATCCTGCTTTGTTATCTTCTTATAACTTTATCCTGCTAT
3441 AACTTTATCCTCTTCCCAGCCTCATCCCTGTTTTTCTGTTAGGGCAAGACTCTTCCATAAGCCTGCTAAAAAACAGAGAT
3521 GATACCTCTTACAAACTTTACCTCATAGCCTGTGAAGCAGGTTGGCATGTGGATTACAAGTCCTGCTTTGACACTGGGCA
3601 AGAATTTAAGATTGTTCTATCTCTACTAGTCATAGAAAAGAAACATTGTTAAACATGTTGAGTTTTAAAGGAAGAAATAT
3681 TTTCAAATTCTTAATCCAAGAAAATACTGAGTTGGAATCTTAGACTTCGGGACTCTGACACGTTCTTTATGAAAGGCAAA
3761 ATAATTGGTATCTAAAGTTCTCTCCTTCCTGCCTCCCCTAAAGAAAAAGGATATTAGATTGCACACTATAATTTTACATA
3841 AGATCTGCCTTCCACACTTCCCTGCTGGAAGGCATTCTCAGAGCTTTATGTCTTCGTACCTCTCAGAGATTGGACTTTTT
3921 CTTGTTTAAAACCCCAACCAAAAAAAATAATAAGGCATGATTGGTGGGGAGGGAATGTGTATTTAGGGGCATAATAAAAA
4001 GGTGGCTCGAAGCAGGAACTTTGGCCTCATGGTGTCATGGGTGGATGCCTGGACTCCAGTGTGCCTGTGAGGGGCTGGGT
4081 TAGGCAGTCGGCTGTCACACTCACATGTGCCTGCAATAAACCTTTTGGAATTTCATGAACGAGGTCTATGAATTGCCTTT
4161 TGCCAATGAATGGATGTATTTTTCCAAGGGGGGAATAGTATCCTTGACTTTGGCAGTCACCTTTTTGTATGTCTCTAGAA
4241 AGGGGTCAAAAAACTATGGTAAAGATGAGGCTTATGAGTGAATACCTCTGGGACAAACCTTAGGACTCACAAGCTATGCC
4321 ATGTTTTTCAGGAGACTCTTGTACCTTATCTGGAATCTAATCTTGGGAGAAGAGGAAAAAGGAGCTAATATTTGTCATTT
4401 ATACTCACTCTGTGCCAGATACTGTGCTAGGCATTTTATAATTGTTTTGTGTCATCCTCATGATAATCCTGTGAAGTAGA
4481 TCTATTACCCCCGTGTTCTAAATAATAGATCTTAAGTGTGGAATGCATCTATCCAACATAAATGCCCATGTTGAAAGAAG
4561 GAAAGATGTCATTCAAGTATTTTTCAAATTCTTTTTATTATGACTATGCCCTTCGCAACACTGTGAAAACAACCCCTGGG
4641 GGCATCTGCCTTCCAGAATCTCTCTCTGGCTTCTCACCAGCTTGGTTTCCTCATGGGGAGTGTTTTATTTGGCCTCCCCT
4721 ATCTGAGCTGCACACACACCAGGGGAGGCCACTGGCTAACAGTAGGACTTCAGTGCCCTGAGGAAAAGGCTTTGGGAATT
4801 TAGGCACACGTTTCTCTCCTTGGAATCCTTCTAGCATCTGGAAAAGGAACCTGGTATTTCTGCAGTTAGATACCAGATGC
4881 AACCAGAACAGGCTTTCGAGTGCTGTGATTTCTTTCCTGGGTTCCCAAGTCTTGTTGTTTCATCACAAACTGTATCTTTT
4961 TAAGGTTAAAAGTCTTGACCTTCATGGGGGTCTGGGACAATCCGATCTCCAAGCATGGAGGAAAGGCAATGCCTGGACCA
5041 CTGACTTGCATTGAAATCCTTTCTTGTGGGCTAGGGTTTGATGTCTCTTTTTCATCTTTGGACTGGGGATCTGCATCTTC
5121 CAGGTCCATTTAAGCACTGAAACTAGATGCAAATCTCTTTCGAGACCTTACATGTTTTAGATAGTCATGTAATGACTTGG
5201 ATAGACATTTAAATAACTTGTTCCAAGGTCGGAAGAGCCCAAGAACTCCTCAGAGTTCCTCTTCTTGCTTCTTGAATCAC
5281 ATCCTCTAAAGATGACTCATGTCTCCATAGCAACTGTTAAAGGTGCTGCCTAGACGGGACCCGCTCCCACCTTTACTTAC
5361 TTTGCTCGAAGGAACCAAAACAATGTCCTTGTGTAAAGGGGCTGTCATATCCAGTTTTCCTTTGAAATCTGGCCCCCAAG
5441 ATCCTGCTTCTTTCTAACCTGGCAGCTGTCATGTCCCTTCAAGATGATGTGGGAAATGGCCCTTACAACTTGGGAACCAC
5521 AGAAATTGCTGTATTTCGGGAAGATTCACCTCTAAACTGAAGGCTTCATTCTGATAGTGTCTGCCCTCTCTACCCTGATT
5601 TCGCCCTTCTTTGCTTCCATTTTTAGCCCAAGGCTTTGAATTTGATTGAGTAAGACTTAGAGGCAGTATAAAGAACACCA
5681 TAAACTTAGGCAGAGGTCCCTTAGGGTCTCTAGAGTTGAAAATAATTCTACAGCCTTAGGGGGACCTCTTGGCATTGACT
5761 CTAAAGGGAGAGAATAGCCCCTGTGTCCTGGCATTTCAGTCTAGACCTTCAAGGACTGTTCTCTCTTGACAGGCAAGCAA
5841 GCAAAGAAAGTTTTGCAATAGATTTCAAGCCAGTTTTTCCATTCAAACCAAGATGCAAATTCATAAAATTACTCTTTTCC
5921 TGGAATAGATCCAGGCAGCTGCCTTATTAGAACTTTAGATTCGGATCTATTTTCTTAACACACATACACATACACGCGCA
6001 TACATACATATACAGAGAGATACGTGGAGAAAGGAAATTTACTCTATCATTGCAATACTTCAAGAAAGAGCTGTATTTTG
6081 CCTTTCTGTAATCTCCAAGATAGTGTCTAGGAAAGTAATAGTATAACTATAGGGATACCGAAACAGGAAAAACCAGCCAT
6161 CACTCTTGAGAAAGTTTGAGTTCGACTCACATGGGAGAATCGAGGTCTGCTACTCGTCTTGCTTTGTGCCCCATCTGTGC
6241 CTGGATGCCCTACTACATCTGCTTGACTCGTCTGGGCTGCTAGCCGGGGTGTTGTGGCTGACATCCTTTCCTGGCCTTAC
6321 ACACATAATAGACACATCCCTAACGGCGTGTGCCTGGTCCAGCCACATACAGCCACCACATGTGTCACACACTGTCCCCC
6401 TCATCCATGTGGACTTGACTGGCATTTCAGCAGCTCCACTGGGATGCTCTAACCCCAGTGTGTGGAGTTGGGGTCCCTTC
6481 ATCTAGGTTGACCCAGGTATAGCATTTTTAGCATTGCCTTTCCAGTCTTGATGATTCATTCATTGAACTCATTTATTTCT
6561 GGAGCCCCTGGTACACTCCAGGCACTGCGCTAATTGCCAGCAAAGCACAACTGAACTAAATCCACCTTCAAGGAACCTAG
6641 CCATAACGAGGGAGGCAGCATGGAAGTACCCTACAGGGGAAAGTCCTGAGTGCTGTGGGAGCATCTCACCGTGGCAGCCA
6721 GCCCAGTTTTGGCAATCAGGGGCTTCCTGAAAGAGGTGACATCAAAGCCCGGATGTGTCAGAGGACTGAGGGAGAGTGTT
6801 ACTAAAGGACTTTCAGGCTGAGAGGATAGCACAGGACTCAGCCCAAAGGAGGGCCAGTGTGGACTGTCCAGGGCCAGCCT
6881 GCAGTACAGAGGCTGGAGCTTGGACTTGTAGAGGGAGAGAGAAGAGCAAGGGACGTGGACGGGGCAGTGAGCCAGGCTAG
6961 CCACAGAGGGTTCCCGGGGCTTTGCTGGGGATTCAGGGAGCATAAATAAGAGCTTTAGGTGGTGCTGTGTCCTCTGCAGC
7041 CCACTGCTGAGGTCCTCCAGACAGGTAAGGTGTGGTCACAATCAGGGCCGGGGTTTCCCTGCTCACTGCGGCAGTGCAGG
7121 GGTGCTTGCTGAGATGATTCATCCCAGGGTGTCCTCTGTCCCTTACCCAGCCCCAACTCCTCTTCCTCTGCCAAAAGCTA
7201 TTTGAATTCAAGGACTTTAACCTGGGCCGGATCTGGTTTGGAGACAAAGGGGACAGCTCTGGGTCAGCATGACCTTCTTT
7281 AGAGCCACTAAGGCGAAAAATACCGTTTGGGACCAGGCTGGCCTAGACCCAGGGATGAGAATGCACCCTAAAATAAATAT
7361 ACGGGAAGCAGCAGAGGGCTTCCCTGTCTAGTGTGTGATCCTAACTAAAGGCAGCTCTCTTGGACAGCCTTCCCCTGGAT
7441 TAGGTCACATACACCTGGTGGCCAAGCCTCTGCTGGGTCCCAAATACACACCCGAGTCCTGCCAAAGAAAGGAGATTTTT
7521 AAAAAGCACAGACAAATTGTATGCAAGTGGAAAATACCCATAGGCCTAGACAGCTGTGGAGGGAAGACCTCGTGGGTACC
7601 TGGAGGCTGCCAGAGCTGGGAGCTCTGCAGGTATGAGTCAGGGAAGGCTCAGAGACAAGCAGAATCTCTCTATGGAGACA
7681 ACTTGCAGTGCCTTTTAGGTTTTCCAAATAACCTCGGAGTTCAGAGCATTGGGTTTTTTTCTCCCCTCCCCACCCCCAGA
7761 AAAATAATTAGAAAAATGTTTAGGAGAAAGGAAAAGAATTAGATGCATCAGAATACCAGCTATAAGCCAACACTGTTTCC
7841 AGAAACTCAAGAAAAAGCTCAAACAGAAGACAGTTCCCCTGAGAGGCTGGAGGCGTTGGTGCTGAAGGCAATTTTCCTAG
7921 CTAAGGGGCACTGGGCCTTGCTGCACCTTGGGGCTGACCTTTTTTGCAAAACACCCACCCCTGCCCTCCTGGCATACTCA
8001 ACAGCAACGCCAGCTTTCTGGACCCTTGGAAAGATGTTAGCTCAAACACCCACTTTTTCCAGATCTTCCTCTTGCTCTTC
8081 ACTGAGGAATTTGTAATTCTGAGGCTAGCGATGCCCACTCGGATATTCCGCAGGCCCAGGTGTTTAGATTAGAATTTGTC
8161 CAGCGGTAATCCTGATGCTGGAAACCAACAAACATTTGGCCTCATATTCACCCATTTAAAAACTAGAGCCCCTGGCAGGT
8241 CCCCTTAGGGCCATGTGTTCATGGAATATAAGCCAAGTTTGCCTTAGGCTTGTTCATGGAATATAAGCCAAGTTTACCTC
8321 TCCCCATTTTCTGCCCTGGCCCACTTCCCACTCACCTCCACCTCATTGCCAGGAAGGGATCAAAATGCCTCCATGCCAGT
8401 TGTTAATGGCTACATATTTGCCCTTCCCAAGGGTATTTGCATTTTATTTAGGAACATGGCCTTATATTCAAGGAAAATCT
8481 AGCATCAAGATTACGAGGCATCACCTCTCAATCAGGTCTGGGAGGTATCTTGGGGCATTGCTCTTCTGAACACCTGCAGA
8561 GGCTTCCTCAGGTGAGTGTGGGAGCCCGGAAGGGTGGCCTCCCTAACCACTCTGCCTGCACATGAATTCTCCAAAGCAGT
8641 GGGCCCCCATCTGTTTCAATTACACATGCCTGTCAGCAAAAACTTCGTGAGATGCACTCTCTCTGTGTGTTTATTAATTT
8721 ATTTAAAGCATATATCCCTTTACTTTTGTACTACTATATTAGGCACATTATAAAAAGTATACAGCATAGAAACTTTAAAT
8801 GAATAAGACACAAAATATTATAAACAGAGGTTCTGGCATTTTCTCTCTGAACTCCTGAGGGGGACCTTGGGCACCTCCTG
8881 GTATGTGCACACCCCACTTTGAACACCCTTGCTTTAGTGCAAATCAGCACGCCTAAATAGCATCCCAAACCACTGTGCGA
8961 CATTTGGCCTGCAGAATAAGAAAGTCCTAAGGCAGAATCCCCAGGAACTTCAAATCTGGGAGATGAGGAAAGAAAACTCA
9041 CTCACAAACAACATAAATGTAAATAATTCAAAACCCTAAAGGAGAGCTGTCCCTAGACAGTAGTGGCTACAGGTGCTAAG
9121 CAAAAGTCAGGTACACTGGACAGAGCCATGCGATTGATTGTTCATCTTCCCTCTCTGGGTCTCCAGAAAAGGACACTGGC
9201 AATATCCCCAGCTCTCTCCTGATTGGAATTCTTTGAACCCTCGAAGTGCTCCAGCAGTACTACCCCCCACGTAGCAGTGG
9281 GCCCATGTCGCTTGAATATTATTTTTGATTTGACCACCAAGATGTAATGATGATTCTATTCCATTTTGAAAAGGGTCTGA
9361 GAAAGTGTACAGGTCTAATTATATATACATATTTATACATGTGTATTTTTGTTTATTGTTACATTTTGACATTGGACTTT
9441 CTATTAAATAATTTTTAAGAGTTGG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-AUAC-ACGACGAu 5'
            |:|||: | | || ||||||| 
Target 5' atCGAACTTTCTTTGTTGCTGCTa 3'
204 - 227 160.00 -16.30
2
miRNA  3' guguUUGGUAA--UACACGACGau 5'
              |||::||  | |||||||  
Target 5' tagcAACTGTTAAAGGTGCTGCct 3'
5308 - 5331 144.00 -13.80
3
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |:| | ||| ||| |||| 
Target 5' ataAGAGCTTTAGGTGGTGCTg 3'
7006 - 7027 135.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31507311 45 COSMIC
COSN26968499 53 COSMIC
COSN30469161 55 COSMIC
COSN30541126 62 COSMIC
COSN30179958 72 COSMIC
COSN31574673 83 COSMIC
COSN30145394 117 COSMIC
COSN28185501 122 COSMIC
COSN30118239 132 COSMIC
COSN30145335 154 COSMIC
COSN20068009 199 COSMIC
COSN208054 265 COSMIC
COSN20128132 407 COSMIC
COSN31521696 540 COSMIC
COSN17650022 679 COSMIC
COSN26585429 803 COSMIC
COSN30173115 819 COSMIC
COSN30164449 917 COSMIC
COSN1417120 1049 COSMIC
COSN31534998 1066 COSMIC
COSN8637016 1193 COSMIC
COSN30159275 1246 COSMIC
COSN216709 1258 COSMIC
COSN30543562 1346 COSMIC
COSN28310694 1354 COSMIC
COSN30164534 1354 COSMIC
COSN17962005 1494 COSMIC
COSN31596733 1507 COSMIC
COSN7188447 1613 COSMIC
COSN30174764 1687 COSMIC
COSN31607265 1736 COSMIC
COSN31554889 1750 COSMIC
COSN28725054 1800 COSMIC
COSN31536531 1941 COSMIC
COSN6011737 1946 COSMIC
COSN31531431 1967 COSMIC
COSN31607092 2008 COSMIC
COSN32056562 2318 COSMIC
COSN28741501 2839 COSMIC
COSN9052815 2872 COSMIC
COSN5856748 2874 COSMIC
COSN31538499 2945 COSMIC
COSN21006355 2974 COSMIC
COSN31521695 3016 COSMIC
COSN25483354 3137 COSMIC
COSN28201031 3161 COSMIC
COSN2836934 3216 COSMIC
COSN20132854 3322 COSMIC
COSN17718098 3835 COSMIC
COSN8410488 3842 COSMIC
COSN20871292 3897 COSMIC
COSN26430128 4064 COSMIC
COSN15663067 4286 COSMIC
COSN31480909 4309 COSMIC
COSN25197081 4325 COSMIC
COSN31593973 4466 COSMIC
COSN8323803 4501 COSMIC
COSN31516560 4512 COSMIC
COSN26145333 4579 COSMIC
COSN31547189 4592 COSMIC
COSN26509431 4742 COSMIC
COSN21160975 5236 COSMIC
COSN6431950 5300 COSMIC
COSN6011738 5320 COSMIC
COSN28418813 5369 COSMIC
COSN15661278 5489 COSMIC
COSN25070444 5502 COSMIC
COSN1417121 5623 COSMIC
COSN21345177 5687 COSMIC
COSN31522738 5899 COSMIC
COSN31556611 5956 COSMIC
COSN26568246 5986 COSMIC
COSN31555823 6003 COSMIC
COSN15661369 6013 COSMIC
COSN31540959 6085 COSMIC
COSN21203147 6424 COSMIC
COSN15725412 6627 COSMIC
COSN28201868 6634 COSMIC
COSN24803122 6741 COSMIC
COSN8410489 6935 COSMIC
COSN9052816 7214 COSMIC
COSN7188448 7544 COSMIC
COSN27243429 7818 COSMIC
COSN1417122 8241 COSMIC
COSN6431951 8376 COSMIC
COSN31778031 8471 COSMIC
COSN31778032 8473 COSMIC
COSN26714698 8493 COSMIC
COSN32056087 8495 COSMIC
COSN32069267 8519 COSMIC
COSN7188449 8688 COSMIC
COSN1417124 8856 COSMIC
COSN6011739 8931 COSMIC
COSN24271979 9065 COSMIC
COSN31522027 9188 COSMIC
COSN22544658 9192 COSMIC
COSN8410490 9231 COSMIC
COSN31584675 9232 COSMIC
COSN31608980 9244 COSMIC
COSN31481819 9251 COSMIC
COSN8637017 9275 COSMIC
COSN16882453 9290 COSMIC
COSN31609831 9337 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1237997237 1 dbSNP
rs1472469482 2 dbSNP
rs778119102 8 dbSNP
rs1291921216 11 dbSNP
rs1425990379 11 dbSNP
rs759944882 13 dbSNP
rs200150085 16 dbSNP
rs747444504 17 dbSNP
rs1034509512 18 dbSNP
rs16823344 21 dbSNP
rs1394780618 22 dbSNP
rs777041732 26 dbSNP
rs1335381232 27 dbSNP
rs1340405292 36 dbSNP
rs759618253 37 dbSNP
rs753832764 38 dbSNP
rs1341873380 43 dbSNP
rs769782929 48 dbSNP
rs1257094620 49 dbSNP
rs1337134122 51 dbSNP
rs775795914 53 dbSNP
rs1384456190 54 dbSNP
rs1289262330 69 dbSNP
rs1455109360 76 dbSNP
rs1366699373 79 dbSNP
rs1164093234 82 dbSNP
rs1475288607 85 dbSNP
rs1215827919 91 dbSNP
rs990552713 92 dbSNP
rs1253677201 97 dbSNP
rs1468120049 98 dbSNP
rs1427565590 111 dbSNP
rs145367537 117 dbSNP
rs781246797 118 dbSNP
rs1271870832 121 dbSNP
rs540421236 125 dbSNP
rs1335615453 131 dbSNP
rs551119843 133 dbSNP
rs190038985 135 dbSNP
rs1225284456 137 dbSNP
rs569368877 141 dbSNP
rs753130753 144 dbSNP
rs1383749145 150 dbSNP
rs996780839 162 dbSNP
rs769936547 163 dbSNP
rs1325209816 179 dbSNP
rs911034954 181 dbSNP
rs942513374 182 dbSNP
rs775568401 184 dbSNP
rs1394536618 187 dbSNP
rs1028220074 191 dbSNP
rs562859427 191 dbSNP
rs749341511 191 dbSNP
rs1439611789 195 dbSNP
rs1321496812 197 dbSNP
rs1337402626 199 dbSNP
rs1442848413 201 dbSNP
rs1278698964 204 dbSNP
rs1348332847 207 dbSNP
rs536886164 208 dbSNP
rs377743598 214 dbSNP
rs901222425 222 dbSNP
rs962461138 228 dbSNP
rs1235330612 229 dbSNP
rs1368982871 236 dbSNP
rs1274112439 239 dbSNP
rs34211113 240 dbSNP
rs374189424 245 dbSNP
rs1041716693 246 dbSNP
rs1326739814 256 dbSNP
rs1211832888 259 dbSNP
rs548761702 265 dbSNP
rs567057258 267 dbSNP
rs1432491905 268 dbSNP
rs1394030921 269 dbSNP
rs534480954 272 dbSNP
rs199784650 276 dbSNP
rs755785119 277 dbSNP
rs1000435892 286 dbSNP
rs1034625485 289 dbSNP
rs947657997 297 dbSNP
rs147994697 310 dbSNP
rs774495718 315 dbSNP
rs1197565314 332 dbSNP
rs924786772 333 dbSNP
rs934436468 335 dbSNP
rs1234809374 339 dbSNP
rs866658072 342 dbSNP
rs1024903318 346 dbSNP
rs970465893 349 dbSNP
rs1441372117 351 dbSNP
rs1336216059 352 dbSNP
rs900857891 355 dbSNP
rs1231510345 359 dbSNP
rs1412339137 367 dbSNP
rs1374525585 369 dbSNP
rs972927089 376 dbSNP
rs1025294951 377 dbSNP
rs1435800973 379 dbSNP
rs10228 380 dbSNP
rs1157132678 381 dbSNP
rs1470075708 386 dbSNP
rs996475107 397 dbSNP
rs1364835999 401 dbSNP
rs952403059 404 dbSNP
rs1049682096 411 dbSNP
rs570462353 412 dbSNP
rs753340574 416 dbSNP
rs537426571 418 dbSNP
rs182626413 424 dbSNP
rs1211867229 426 dbSNP
rs942628292 436 dbSNP
rs1160883597 441 dbSNP
rs761667174 445 dbSNP
rs368085327 446 dbSNP
rs1354266166 449 dbSNP
rs961206102 450 dbSNP
rs529750530 452 dbSNP
rs1343002408 461 dbSNP
rs1416447557 469 dbSNP
rs1316717231 506 dbSNP
rs1042222603 513 dbSNP
rs1386379794 517 dbSNP
rs1161969510 519 dbSNP
rs904505804 527 dbSNP
rs1035695827 539 dbSNP
rs1188679540 542 dbSNP
rs866505160 544 dbSNP
rs1055819893 557 dbSNP
rs1240535318 565 dbSNP
rs1242919989 577 dbSNP
rs1447332738 585 dbSNP
rs991486018 596 dbSNP
rs915913176 597 dbSNP
rs1340209011 603 dbSNP
rs969402248 604 dbSNP
rs187087556 605 dbSNP
rs1014519186 606 dbSNP
rs1359451703 608 dbSNP
rs1345060839 611 dbSNP
rs1269202531 619 dbSNP
rs1486851756 624 dbSNP
rs924788530 633 dbSNP
rs1346157590 639 dbSNP
rs934793651 642 dbSNP
rs1460353392 645 dbSNP
rs1211976406 655 dbSNP
rs572266645 663 dbSNP
rs1024467989 664 dbSNP
rs922313733 669 dbSNP
rs1186142298 677 dbSNP
rs1475651266 682 dbSNP
rs898015827 695 dbSNP
rs993911271 696 dbSNP
rs932386797 697 dbSNP
rs1184995691 703 dbSNP
rs1273677867 708 dbSNP
rs1215070018 730 dbSNP
rs370873816 730 dbSNP
rs531793874 730 dbSNP
rs888106166 738 dbSNP
rs10030 739 dbSNP
rs941287378 740 dbSNP
rs1167244723 755 dbSNP
rs1300276203 761 dbSNP
rs546110221 770 dbSNP
rs1439111246 774 dbSNP
rs1370937652 777 dbSNP
rs1327137510 780 dbSNP
rs1025789718 787 dbSNP
rs1376872091 788 dbSNP
rs1368565476 789 dbSNP
rs1352824684 793 dbSNP
rs1036925393 799 dbSNP
rs896980955 803 dbSNP
rs868507719 807 dbSNP
rs191142916 812 dbSNP
rs1313218101 819 dbSNP
rs1034806696 821 dbSNP
rs1017896900 823 dbSNP
rs532583916 834 dbSNP
rs544606053 836 dbSNP
rs1192851105 844 dbSNP
rs182611011 847 dbSNP
rs530172261 852 dbSNP
rs1231830234 853 dbSNP
rs1204530290 859 dbSNP
rs548825490 859 dbSNP
rs1343899033 864 dbSNP
rs772905176 867 dbSNP
rs1327098456 872 dbSNP
rs1232621738 887 dbSNP
rs1347572384 894 dbSNP
rs1304881667 897 dbSNP
rs922449223 898 dbSNP
rs1226863856 901 dbSNP
rs967640150 901 dbSNP
rs567023488 902 dbSNP
rs1297708694 905 dbSNP
rs1350602393 909 dbSNP
rs968722069 923 dbSNP
rs760335526 924 dbSNP
rs1433943535 925 dbSNP
rs1395446900 932 dbSNP
rs765952729 942 dbSNP
rs979443229 950 dbSNP
rs936080480 953 dbSNP
rs1484926000 958 dbSNP
rs1177298590 962 dbSNP
rs1483737887 972 dbSNP
rs1255010423 976 dbSNP
rs1198363568 977 dbSNP
rs1209690823 987 dbSNP
rs1485761595 994 dbSNP
rs1256956731 1000 dbSNP
rs1055766516 1001 dbSNP
rs547902249 1002 dbSNP
rs1235830357 1003 dbSNP
rs1263477588 1014 dbSNP
rs915954768 1027 dbSNP
rs12754494 1029 dbSNP
rs141633164 1030 dbSNP
rs1046426216 1036 dbSNP
rs1387814967 1040 dbSNP
rs1414414324 1045 dbSNP
rs571055538 1083 dbSNP
rs778905076 1085 dbSNP
rs1451297486 1089 dbSNP
rs898093234 1091 dbSNP
rs776981140 1095 dbSNP
rs754544084 1097 dbSNP
rs1159705338 1106 dbSNP
rs1473325661 1107 dbSNP
rs1415037607 1115 dbSNP
rs922747004 1120 dbSNP
rs530411551 1124 dbSNP
rs1202599965 1126 dbSNP
rs150085786 1129 dbSNP
rs745833013 1131 dbSNP
rs1290843458 1142 dbSNP
rs888156495 1143 dbSNP
rs1385873737 1168 dbSNP
rs1260719739 1170 dbSNP
rs1381870620 1171 dbSNP
rs1318580399 1194 dbSNP
rs1331770816 1199 dbSNP
rs752106439 1205 dbSNP
rs1005296479 1208 dbSNP
rs1017888541 1224 dbSNP
rs1232710917 1225 dbSNP
rs1341323172 1240 dbSNP
rs1373319818 1241 dbSNP
rs1315083504 1242 dbSNP
rs1380354688 1258 dbSNP
rs1442258772 1265 dbSNP
rs72737731 1281 dbSNP
rs567835994 1310 dbSNP
rs1029970151 1313 dbSNP
rs967336376 1316 dbSNP
rs779666242 1318 dbSNP
rs1163608786 1325 dbSNP
rs1392148213 1325 dbSNP
rs1461485031 1328 dbSNP
rs1369875219 1334 dbSNP
rs1190566443 1335 dbSNP
rs977626239 1338 dbSNP
rs1241546358 1343 dbSNP
rs1427165437 1347 dbSNP
rs925780570 1353 dbSNP
rs1261679668 1354 dbSNP
rs957440601 1357 dbSNP
rs534855850 1358 dbSNP
rs188870407 1361 dbSNP
rs915894204 1363 dbSNP
rs781577362 1366 dbSNP
rs1213200986 1370 dbSNP
rs1357109685 1381 dbSNP
rs1194182703 1384 dbSNP
rs1225499777 1401 dbSNP
rs553570085 1402 dbSNP
rs1056252945 1403 dbSNP
rs572231416 1403 dbSNP
rs1160938058 1405 dbSNP
rs1364199286 1406 dbSNP
rs929576902 1408 dbSNP
rs1049216558 1413 dbSNP
rs193150134 1414 dbSNP
rs1453266552 1418 dbSNP
rs1157283229 1419 dbSNP
rs1461180806 1421 dbSNP
rs1396755668 1428 dbSNP
rs397841688 1430 dbSNP
rs3841434 1432 dbSNP
rs397974022 1432 dbSNP
rs56715278 1432 dbSNP
rs201966512 1436 dbSNP
rs16823345 1437 dbSNP
rs571717615 1437 dbSNP
rs1000167642 1440 dbSNP
rs1251726472 1440 dbSNP
rs1452315526 1447 dbSNP
rs1269563852 1448 dbSNP
rs1194110036 1455 dbSNP
rs1366021841 1457 dbSNP
rs1275593377 1465 dbSNP
rs1393675217 1472 dbSNP
rs3814339 1477 dbSNP
rs1335594530 1483 dbSNP
rs1227363747 1486 dbSNP
rs371794103 1487 dbSNP
rs756301911 1492 dbSNP
rs780197936 1508 dbSNP
rs1332692342 1509 dbSNP
rs189211873 1525 dbSNP
rs138675102 1527 dbSNP
rs1336286249 1536 dbSNP
rs1370842705 1540 dbSNP
rs113468284 1546 dbSNP
rs530235269 1553 dbSNP
rs1432089385 1555 dbSNP
rs998824343 1556 dbSNP
rs1393644108 1557 dbSNP
rs542379173 1559 dbSNP
rs147414727 1561 dbSNP
rs1487443164 1564 dbSNP
rs1379830138 1567 dbSNP
rs957213488 1571 dbSNP
rs527934778 1573 dbSNP
rs552488348 1574 dbSNP
rs1252892702 1587 dbSNP
rs1023025578 1591 dbSNP
rs971511782 1592 dbSNP
rs1250949668 1595 dbSNP
rs1279351954 1599 dbSNP
rs981809097 1613 dbSNP
rs1347068977 1618 dbSNP
rs919302168 1624 dbSNP
rs1277683474 1641 dbSNP
rs1472167479 1642 dbSNP
rs909598317 1651 dbSNP
rs1289896362 1652 dbSNP
rs1412555673 1653 dbSNP
rs12096795 1657 dbSNP
rs1420214321 1658 dbSNP
rs1462164819 1662 dbSNP
rs531854584 1669 dbSNP
rs1415380568 1676 dbSNP
rs1164248393 1684 dbSNP
rs985037446 1688 dbSNP
rs909367314 1694 dbSNP
rs191709889 1695 dbSNP
rs1184350525 1697 dbSNP
rs943518043 1697 dbSNP
rs1257019808 1698 dbSNP
rs568465250 1712 dbSNP
rs1282150539 1716 dbSNP
rs899548223 1729 dbSNP
rs1269485219 1730 dbSNP
rs916435964 1730 dbSNP
rs947874485 1736 dbSNP
rs1295504186 1742 dbSNP
rs535915080 1752 dbSNP
rs1449300009 1753 dbSNP
rs933760564 1755 dbSNP
rs2378890 1759 dbSNP
rs1233546431 1762 dbSNP
rs1311334162 1764 dbSNP
rs1319443233 1768 dbSNP
rs140086170 1776 dbSNP
rs1389972204 1781 dbSNP
rs763123006 1786 dbSNP
rs768895059 1787 dbSNP
rs1161494440 1806 dbSNP
rs1051201720 1819 dbSNP
rs1413399871 1831 dbSNP
rs1182661766 1837 dbSNP
rs774409964 1840 dbSNP
rs1251872832 1853 dbSNP
rs1482692954 1856 dbSNP
rs998751211 1858 dbSNP
rs1032902684 1860 dbSNP
rs1202694324 1869 dbSNP
rs893070421 1877 dbSNP
rs1249790622 1878 dbSNP
rs1211322526 1886 dbSNP
rs891771974 1899 dbSNP
rs1290214470 1903 dbSNP
rs1012719982 1922 dbSNP
rs1475636934 1923 dbSNP
rs998456463 1926 dbSNP
rs1336966469 1935 dbSNP
rs1268816345 1942 dbSNP
rs1181540915 1943 dbSNP
rs1029880034 1945 dbSNP
rs1366624899 1949 dbSNP
rs1022806445 1960 dbSNP
rs1411694033 1962 dbSNP
rs1007090919 1965 dbSNP
rs139681744 1978 dbSNP
rs981584342 1979 dbSNP
rs752680487 1980 dbSNP
rs1315116487 1982 dbSNP
rs1417589012 1987 dbSNP
rs1376474332 1989 dbSNP
rs1449810990 1993 dbSNP
rs1392020050 1994 dbSNP
rs1191655605 1995 dbSNP
rs575628167 2000 dbSNP
rs1414982739 2001 dbSNP
rs984774378 2012 dbSNP
rs547514000 2017 dbSNP
rs565627300 2025 dbSNP
rs960341830 2036 dbSNP
rs1228186814 2040 dbSNP
rs1343318287 2045 dbSNP
rs909441043 2046 dbSNP
rs1232759291 2052 dbSNP
rs943632519 2064 dbSNP
rs143599854 2069 dbSNP
rs184061451 2070 dbSNP
rs1307651370 2097 dbSNP
rs933730190 2099 dbSNP
rs1391794273 2105 dbSNP
rs1171445203 2106 dbSNP
rs1050895269 2112 dbSNP
rs1043606896 2114 dbSNP
rs902947081 2130 dbSNP
rs1192478834 2131 dbSNP
rs1468132082 2136 dbSNP
rs1250707268 2148 dbSNP
rs934282956 2149 dbSNP
rs376076759 2157 dbSNP
rs1341314780 2170 dbSNP
rs925094668 2175 dbSNP
rs936111901 2176 dbSNP
rs1277219438 2182 dbSNP
rs1226133710 2183 dbSNP
rs1054129202 2185 dbSNP
rs891803401 2188 dbSNP
rs1282162377 2193 dbSNP
rs1485905647 2196 dbSNP
rs576428554 2197 dbSNP
rs1287740961 2205 dbSNP
rs1410668560 2207 dbSNP
rs35382132 2208 dbSNP
rs1372596760 2209 dbSNP
rs1310864494 2213 dbSNP
rs537309537 2235 dbSNP
rs1012877757 2236 dbSNP
rs147273699 2243 dbSNP
rs1182187606 2248 dbSNP
rs1410601405 2248 dbSNP
rs890082142 2253 dbSNP
rs1254901886 2254 dbSNP
rs1180518160 2256 dbSNP
rs907063193 2260 dbSNP
rs1007533179 2261 dbSNP
rs1187123603 2270 dbSNP
rs1327613969 2271 dbSNP
rs1003352138 2274 dbSNP
rs1389654919 2281 dbSNP
rs1448159566 2284 dbSNP
rs1229026634 2285 dbSNP
rs1310812816 2286 dbSNP
rs1352610793 2286 dbSNP
rs1379612039 2289 dbSNP
rs148733332 2289 dbSNP
rs759907378 2297 dbSNP
rs1304317680 2316 dbSNP
rs950878273 2317 dbSNP
rs993899064 2318 dbSNP
rs1458339831 2319 dbSNP
rs1006145211 2322 dbSNP
rs1016223430 2323 dbSNP
rs1432491965 2326 dbSNP
rs1288906527 2329 dbSNP
rs1423971610 2339 dbSNP
rs960370477 2342 dbSNP
rs1183919550 2348 dbSNP
rs142297331 2372 dbSNP
rs1432783211 2374 dbSNP
rs541854879 2376 dbSNP
rs760404040 2384 dbSNP
rs964930053 2392 dbSNP
rs975002417 2393 dbSNP
rs150818634 2396 dbSNP
rs572409580 2397 dbSNP
rs1276260825 2406 dbSNP
rs1244356240 2408 dbSNP
rs1322484608 2411 dbSNP
rs116007773 2416 dbSNP
rs1216811017 2419 dbSNP
rs1432574704 2428 dbSNP
rs776107267 2428 dbSNP
rs1463636493 2441 dbSNP
rs925157994 2447 dbSNP
rs935119796 2459 dbSNP
rs1292369779 2471 dbSNP
rs978675816 2473 dbSNP
rs924348801 2477 dbSNP
rs988901640 2479 dbSNP
rs913351747 2484 dbSNP
rs1196033317 2489 dbSNP
rs1254248062 2492 dbSNP
rs934398614 2493 dbSNP
rs1390176919 2503 dbSNP
rs766045605 2519 dbSNP
rs914273383 2520 dbSNP
rs1466597101 2529 dbSNP
rs1265371056 2531 dbSNP
rs948605812 2542 dbSNP
rs1044343359 2544 dbSNP
rs1477998284 2544 dbSNP
rs1051117802 2546 dbSNP
rs907133141 2550 dbSNP
rs1002681234 2551 dbSNP
rs1189798178 2551 dbSNP
rs768096783 2552 dbSNP
rs564486530 2553 dbSNP
rs1048030595 2561 dbSNP
rs78595070 2562 dbSNP
rs550088528 2578 dbSNP
rs1230528999 2579 dbSNP
rs1387261704 2583 dbSNP
rs1329236098 2585 dbSNP
rs1006302528 2590 dbSNP
rs1386819949 2592 dbSNP
rs1392479055 2595 dbSNP
rs1305789002 2599 dbSNP
rs1428289149 2604 dbSNP
rs1370353700 2609 dbSNP
rs1016212192 2610 dbSNP
rs1451913554 2620 dbSNP
rs1327337062 2628 dbSNP
rs1198312029 2631 dbSNP
rs1433814500 2640 dbSNP
rs964712514 2642 dbSNP
rs996816289 2648 dbSNP
rs1030552658 2652 dbSNP
rs955134809 2653 dbSNP
rs1206964884 2654 dbSNP
rs112519537 2668 dbSNP
rs1274143002 2673 dbSNP
rs1233421754 2674 dbSNP
rs1272815499 2682 dbSNP
rs1285847758 2686 dbSNP
rs1408848082 2687 dbSNP
rs1350688901 2691 dbSNP
rs1375306881 2695 dbSNP
rs1309043225 2696 dbSNP
rs1023312664 2698 dbSNP
rs1400744074 2712 dbSNP
rs115445936 2719 dbSNP
rs955765945 2728 dbSNP
rs1267803497 2737 dbSNP
rs1327152723 2740 dbSNP
rs989926522 2741 dbSNP
rs776217080 2742 dbSNP
rs1180054482 2752 dbSNP
rs1472399764 2756 dbSNP
rs139428197 2757 dbSNP
rs1277899546 2759 dbSNP
rs914222597 2762 dbSNP
rs547035321 2763 dbSNP
rs1265730283 2764 dbSNP
rs947290681 2767 dbSNP
rs1044467809 2768 dbSNP
rs1227197036 2772 dbSNP
rs1331811153 2777 dbSNP
rs1329496334 2780 dbSNP
rs1451501307 2784 dbSNP
rs1197425157 2786 dbSNP
rs988009617 2788 dbSNP
rs1333842331 2789 dbSNP
rs1397152420 2792 dbSNP
rs923080384 2806 dbSNP
rs1408872289 2811 dbSNP
rs1157096956 2812 dbSNP
rs1456746880 2816 dbSNP
rs934091358 2820 dbSNP
rs986855739 2821 dbSNP
rs1471901133 2829 dbSNP
rs1236686353 2839 dbSNP
rs573189968 2847 dbSNP
rs928536913 2861 dbSNP
rs1187951984 2862 dbSNP
rs1444085820 2864 dbSNP
rs759018480 2866 dbSNP
rs565769709 2869 dbSNP
rs1329233304 2870 dbSNP
rs1182447293 2872 dbSNP
rs180672173 2881 dbSNP
rs1355157789 2887 dbSNP
rs1038626856 2897 dbSNP
rs1245952219 2915 dbSNP
rs898777774 2921 dbSNP
rs1047245244 2931 dbSNP
rs1390866607 2933 dbSNP
rs1320296912 2938 dbSNP
rs1403845871 2939 dbSNP
rs764676108 2948 dbSNP
rs896646363 2955 dbSNP
rs752232832 2969 dbSNP
rs551570481 2970 dbSNP
rs79770493 2975 dbSNP
rs1187841852 2976 dbSNP
rs1037775881 2978 dbSNP
rs1465238394 2981 dbSNP
rs1243374603 2988 dbSNP
rs1218675899 2996 dbSNP
rs537224038 2999 dbSNP
rs555746541 3002 dbSNP
rs1287490178 3006 dbSNP
rs1210881425 3016 dbSNP
rs1362023170 3025 dbSNP
rs1295781902 3026 dbSNP
rs767919450 3034 dbSNP
rs1023765398 3038 dbSNP
rs573974920 3043 dbSNP
rs1348808710 3044 dbSNP
rs890709227 3046 dbSNP
rs1375814336 3053 dbSNP
rs1272025344 3062 dbSNP
rs900761757 3062 dbSNP
rs750786747 3069 dbSNP
rs1349561864 3070 dbSNP
rs1235407379 3074 dbSNP
rs1293953366 3075 dbSNP
rs1324454987 3080 dbSNP
rs1000219080 3085 dbSNP
rs1031161039 3087 dbSNP
rs1368490549 3095 dbSNP
rs1167682928 3097 dbSNP
rs958215909 3100 dbSNP
rs1450025560 3109 dbSNP
rs761131516 3115 dbSNP
rs1188986748 3116 dbSNP
rs186129471 3117 dbSNP
rs956630094 3122 dbSNP
rs1224266310 3124 dbSNP
rs1275803141 3125 dbSNP
rs553836382 3126 dbSNP
rs572516376 3128 dbSNP
rs1030185426 3131 dbSNP
rs1204815142 3147 dbSNP
rs1275688889 3149 dbSNP
rs1250092008 3154 dbSNP
rs1481845751 3162 dbSNP
rs1275454255 3168 dbSNP
rs970219814 3169 dbSNP
rs979753742 3180 dbSNP
rs1430128389 3182 dbSNP
rs954506198 3185 dbSNP
rs1368517501 3186 dbSNP
rs986909173 3195 dbSNP
rs1425264481 3199 dbSNP
rs1200912266 3210 dbSNP
rs1471419647 3212 dbSNP
rs928330606 3216 dbSNP
rs756501053 3217 dbSNP
rs911265442 3221 dbSNP
rs780290493 3223 dbSNP
rs749568692 3231 dbSNP
rs1263855042 3238 dbSNP
rs983804528 3239 dbSNP
rs964153488 3244 dbSNP
rs1421482525 3250 dbSNP
rs1327388643 3253 dbSNP
rs368755731 3265 dbSNP
rs547749956 3265 dbSNP
rs907697148 3279 dbSNP
rs941847535 3285 dbSNP
rs1300792173 3291 dbSNP
rs546013146 3293 dbSNP
rs930257238 3296 dbSNP
rs1416835030 3298 dbSNP
rs1047279714 3302 dbSNP
rs1178030945 3306 dbSNP
rs1455158839 3310 dbSNP
rs1335175755 3311 dbSNP
rs918086857 3313 dbSNP
rs1410854903 3317 dbSNP
rs949520958 3322 dbSNP
rs1037503310 3323 dbSNP
rs1253112154 3324 dbSNP
rs144520341 3325 dbSNP
rs932096327 3330 dbSNP
rs1000600417 3331 dbSNP
rs1463589143 3334 dbSNP
rs1267520931 3335 dbSNP
rs1051761687 3336 dbSNP
rs545090189 3341 dbSNP
rs576272624 3342 dbSNP
rs1343439210 3344 dbSNP
rs1053889936 3346 dbSNP
rs1310341692 3348 dbSNP
rs1227511280 3349 dbSNP
rs1379857586 3351 dbSNP
rs543599824 3352 dbSNP
rs562053292 3354 dbSNP
rs894075958 3365 dbSNP
rs1272891075 3374 dbSNP
rs190590144 3377 dbSNP
rs1011045248 3382 dbSNP
rs367865890 3388 dbSNP
rs779097751 3390 dbSNP
rs1009507685 3394 dbSNP
rs1023812307 3399 dbSNP
rs547393707 3401 dbSNP
rs1256499302 3402 dbSNP
rs1163165777 3417 dbSNP
rs1441488064 3421 dbSNP
rs1184702245 3422 dbSNP
rs1423589926 3424 dbSNP
rs1243381848 3430 dbSNP
rs1185977278 3433 dbSNP
rs1448131946 3437 dbSNP
rs1449975357 3439 dbSNP
rs763823162 3440 dbSNP
rs1487001221 3441 dbSNP
rs1388079926 3444 dbSNP
rs1220642910 3447 dbSNP
rs954538394 3448 dbSNP
rs1316826438 3451 dbSNP
rs980294879 3456 dbSNP
rs1226095337 3461 dbSNP
rs1035351646 3466 dbSNP
rs1364324268 3467 dbSNP
rs1231870069 3475 dbSNP
rs960000880 3486 dbSNP
rs1383381422 3490 dbSNP
rs983100560 3496 dbSNP
rs753610808 3498 dbSNP
rs564685437 3507 dbSNP
rs1292566714 3508 dbSNP
rs1388210690 3508 dbSNP
rs1458043826 3515 dbSNP
rs1366587481 3517 dbSNP
rs1165817081 3520 dbSNP
rs941953857 3522 dbSNP
rs973205873 3523 dbSNP
rs964499469 3527 dbSNP
rs921801018 3537 dbSNP
rs559052973 3550 dbSNP
rs1190845901 3554 dbSNP
rs1490556924 3562 dbSNP
rs1293715441 3569 dbSNP
rs1341414999 3577 dbSNP
rs1251810636 3589 dbSNP
rs748244832 3593 dbSNP
rs1254827099 3596 dbSNP
rs974174447 3598 dbSNP
rs1299910367 3610 dbSNP
rs146627050 3614 dbSNP
rs1052304048 3615 dbSNP
rs919941039 3618 dbSNP
rs76087995 3620 dbSNP
rs1305389721 3621 dbSNP
rs1396501758 3633 dbSNP
rs1168984402 3642 dbSNP
rs527296337 3646 dbSNP
rs935300381 3649 dbSNP
rs1052443652 3651 dbSNP
rs371635078 3655 dbSNP
rs1480901098 3657 dbSNP
rs894023748 3663 dbSNP
rs1179830118 3664 dbSNP
rs569767924 3675 dbSNP
rs1250895722 3724 dbSNP
rs1197487320 3726 dbSNP
rs918202974 3729 dbSNP
rs1254922905 3730 dbSNP
rs1223567269 3733 dbSNP
rs1011202434 3738 dbSNP
rs1045250855 3742 dbSNP
rs530769411 3757 dbSNP
rs1045660672 3779 dbSNP
rs556288473 3779 dbSNP
rs905389720 3784 dbSNP
rs936429595 3794 dbSNP
rs549160561 3796 dbSNP
rs1393681956 3799 dbSNP
rs1400633467 3800 dbSNP
rs1053519047 3805 dbSNP
rs1470340672 3809 dbSNP
rs200407867 3809 dbSNP
rs567571744 3810 dbSNP
rs1364196316 3811 dbSNP
rs1183656041 3812 dbSNP
rs1035826483 3816 dbSNP
rs959832637 3817 dbSNP
rs1051423296 3818 dbSNP
rs1004462913 3822 dbSNP
rs534578005 3823 dbSNP
rs1255781489 3825 dbSNP
rs1203827209 3826 dbSNP
rs553214697 3828 dbSNP
rs1014580890 3835 dbSNP
rs1320433884 3838 dbSNP
rs565966531 3839 dbSNP
rs973321475 3862 dbSNP
rs1187851975 3863 dbSNP
rs539815164 3883 dbSNP
rs1339291978 3889 dbSNP
rs771987881 3896 dbSNP
rs561920145 3897 dbSNP
rs777634147 3905 dbSNP
rs557871739 3909 dbSNP
rs746819073 3914 dbSNP
rs1376889058 3924 dbSNP
rs1400364681 3929 dbSNP
rs995998066 3935 dbSNP
rs1160564745 3940 dbSNP
rs770674697 3941 dbSNP
rs576087379 3949 dbSNP
rs935406188 3956 dbSNP
rs1384595854 3961 dbSNP
rs1052432913 3963 dbSNP
rs1318623313 3977 dbSNP
rs1446301200 3980 dbSNP
rs951458752 3983 dbSNP
rs764704146 3989 dbSNP
rs1207502687 3993 dbSNP
rs749970965 4008 dbSNP
rs1447274215 4009 dbSNP
rs776430273 4010 dbSNP
rs1207317355 4017 dbSNP
rs1354698733 4019 dbSNP
rs1314716644 4035 dbSNP
rs1247381758 4038 dbSNP
rs946939912 4039 dbSNP
rs182245913 4052 dbSNP
rs1045366077 4054 dbSNP
rs971413852 4058 dbSNP
rs1230596038 4060 dbSNP
rs1269705404 4065 dbSNP
rs1327314874 4070 dbSNP
rs1329436147 4077 dbSNP
rs1207489200 4084 dbSNP
rs143756226 4085 dbSNP
rs1364741678 4090 dbSNP
rs1004094446 4091 dbSNP
rs936816219 4095 dbSNP
rs1388227604 4099 dbSNP
rs1185475493 4101 dbSNP
rs1475455713 4102 dbSNP
rs1056635852 4107 dbSNP
rs769437244 4108 dbSNP
rs1210399351 4123 dbSNP
rs1196309306 4133 dbSNP
rs1266382671 4137 dbSNP
rs895551205 4138 dbSNP
rs1184241694 4142 dbSNP
rs1004621821 4147 dbSNP
rs1362271569 4148 dbSNP
rs774919216 4149 dbSNP
rs945108068 4167 dbSNP
rs1362766231 4169 dbSNP
rs1271938356 4176 dbSNP
rs963037209 4178 dbSNP
rs762507883 4190 dbSNP
rs1029296029 4193 dbSNP
rs890112994 4194 dbSNP
rs186874700 4198 dbSNP
rs541395463 4199 dbSNP
rs943294780 4201 dbSNP
rs768064233 4203 dbSNP
rs911769387 4212 dbSNP
rs559975565 4217 dbSNP
rs1170240143 4228 dbSNP
rs532835921 4229 dbSNP
rs545014953 4232 dbSNP
rs994713340 4237 dbSNP
rs761077355 4239 dbSNP
rs1231478348 4247 dbSNP
rs142572193 4248 dbSNP
rs1350676722 4250 dbSNP
rs887216165 4255 dbSNP
rs915228773 4257 dbSNP
rs766605739 4260 dbSNP
rs77761425 4261 dbSNP
rs1004238482 4267 dbSNP
rs754287780 4274 dbSNP
rs1285875712 4287 dbSNP
rs946679094 4291 dbSNP
rs563384535 4303 dbSNP
rs970728633 4307 dbSNP
rs1225182099 4308 dbSNP
rs1348397380 4311 dbSNP
rs1245411893 4317 dbSNP
rs59900760 4322 dbSNP
rs549223523 4326 dbSNP
rs567500949 4333 dbSNP
rs149058976 4361 dbSNP
rs1252297505 4365 dbSNP
rs1468829006 4376 dbSNP
rs914054798 4379 dbSNP
rs530303286 4387 dbSNP
rs1471367399 4393 dbSNP
rs1406284027 4394 dbSNP
rs1176936551 4401 dbSNP
rs987190448 4403 dbSNP
rs1235073935 4407 dbSNP
rs574314289 4409 dbSNP
rs375052952 4411 dbSNP
rs1201927547 4425 dbSNP
rs752815742 4432 dbSNP
rs1460920773 4441 dbSNP
rs911567712 4442 dbSNP
rs571506820 4450 dbSNP
rs1180338023 4452 dbSNP
rs1306081399 4455 dbSNP
rs1416041780 4458 dbSNP
rs1375526305 4462 dbSNP
rs898932410 4478 dbSNP
rs758478798 4481 dbSNP
rs1282343154 4482 dbSNP
rs541945602 4493 dbSNP
rs539458293 4494 dbSNP
rs1338082720 4506 dbSNP
rs1455338798 4511 dbSNP
rs550438619 4515 dbSNP
rs1158890867 4519 dbSNP
rs930543443 4529 dbSNP
rs1410881428 4532 dbSNP
rs1463999267 4534 dbSNP
rs563216046 4542 dbSNP
rs1019182079 4543 dbSNP
rs886242386 4544 dbSNP
rs1004269877 4545 dbSNP
rs956550830 4566 dbSNP
rs1216305519 4570 dbSNP
rs987993106 4571 dbSNP
rs906536032 4572 dbSNP
rs1002245882 4573 dbSNP
rs1228326782 4577 dbSNP
rs79755161 4592 dbSNP
rs968135332 4597 dbSNP
rs1289078161 4607 dbSNP
rs116616432 4609 dbSNP
rs1347344858 4612 dbSNP
rs867359740 4615 dbSNP
rs770928988 4616 dbSNP
rs541827153 4620 dbSNP
rs1386367897 4624 dbSNP
rs369785973 4629 dbSNP
rs987223068 4638 dbSNP
rs911679295 4642 dbSNP
rs1187334034 4643 dbSNP
rs992445407 4651 dbSNP
rs1486949116 4659 dbSNP
rs780895893 4667 dbSNP
rs1360126343 4668 dbSNP
rs1293854755 4670 dbSNP
rs1203280828 4672 dbSNP
rs1224686971 4688 dbSNP
rs532456664 4690 dbSNP
rs1295596633 4693 dbSNP
rs1383579691 4695 dbSNP
rs920241557 4698 dbSNP
rs555426014 4699 dbSNP
rs1254207603 4703 dbSNP
rs1451848927 4704 dbSNP
rs1166031806 4708 dbSNP
rs745671367 4722 dbSNP
rs12743178 4724 dbSNP
rs1169838361 4727 dbSNP
rs1460857489 4731 dbSNP
rs753667416 4733 dbSNP
rs1389928757 4742 dbSNP
rs1047611874 4765 dbSNP
rs796839461 4779 dbSNP
rs769419014 4780 dbSNP
rs1490449455 4784 dbSNP
rs1215830589 4792 dbSNP
rs930444375 4805 dbSNP
rs143043543 4810 dbSNP
rs1050511262 4811 dbSNP
rs541611173 4813 dbSNP
rs1251431390 4817 dbSNP
rs1175922809 4820 dbSNP
rs888810892 4823 dbSNP
rs1360474846 4833 dbSNP
rs1321052503 4835 dbSNP
rs1223684429 4836 dbSNP
rs374185479 4851 dbSNP
rs553433035 4852 dbSNP
rs775189204 4868 dbSNP
rs1018832201 4875 dbSNP
rs1448326336 4876 dbSNP
rs906659791 4881 dbSNP
rs1002683560 4892 dbSNP
rs148190243 4893 dbSNP
rs1298861979 4894 dbSNP
rs141088163 4899 dbSNP
rs1427537182 4901 dbSNP
rs1437159022 4906 dbSNP
rs563247358 4913 dbSNP
rs762493376 4917 dbSNP
rs1480850380 4919 dbSNP
rs778376057 4924 dbSNP
rs1022142351 4929 dbSNP
rs1011182414 4935 dbSNP
rs1280501525 4949 dbSNP
rs41263676 4950 dbSNP
rs1209733912 4951 dbSNP
rs1197093855 4953 dbSNP
rs570769699 4957 dbSNP
rs966942969 4965 dbSNP
rs1009108851 4966 dbSNP
rs563211672 4969 dbSNP
rs1277024013 4986 dbSNP
rs1325185070 4986 dbSNP
rs980904796 4992 dbSNP
rs1335758181 4993 dbSNP
rs1034085156 4996 dbSNP
rs1247878144 4997 dbSNP
rs964521515 5004 dbSNP
rs960713147 5005 dbSNP
rs1470451435 5007 dbSNP
rs528347694 5016 dbSNP
rs920289871 5017 dbSNP
rs1414649201 5032 dbSNP
rs1364094009 5047 dbSNP
rs1174971243 5052 dbSNP
rs1403265677 5065 dbSNP
rs908760058 5067 dbSNP
rs561032906 5071 dbSNP
rs974204736 5074 dbSNP
rs1242022426 5077 dbSNP
rs773932610 5108 dbSNP
rs534721713 5114 dbSNP
rs190384325 5129 dbSNP
rs1350412285 5131 dbSNP
rs74134121 5149 dbSNP
rs1050213781 5151 dbSNP
rs1381168688 5153 dbSNP
rs910305563 5158 dbSNP
rs949970036 5162 dbSNP
rs944362405 5163 dbSNP
rs1040062291 5167 dbSNP
rs369704430 5173 dbSNP
rs1160195449 5175 dbSNP
rs372961914 5184 dbSNP
rs143640629 5207 dbSNP
rs532245313 5217 dbSNP
rs938123215 5221 dbSNP
rs1163730331 5227 dbSNP
rs546837722 5228 dbSNP
rs893815188 5229 dbSNP
rs1043563099 5231 dbSNP
rs150561188 5232 dbSNP
rs569750805 5241 dbSNP
rs902790951 5254 dbSNP
rs1219225689 5260 dbSNP
rs1358003755 5271 dbSNP
rs113327191 5273 dbSNP
rs1019124337 5275 dbSNP
rs1358581453 5281 dbSNP
rs1268444764 5286 dbSNP
rs942502670 5287 dbSNP
rs1033747375 5291 dbSNP
rs961078970 5298 dbSNP
rs41263678 5300 dbSNP
rs1364954952 5306 dbSNP
rs567739865 5308 dbSNP
rs1015583248 5309 dbSNP
rs1406959025 5314 dbSNP
rs951789550 5315 dbSNP
rs1166763887 5317 dbSNP
rs760037293 5326 dbSNP
rs1477937518 5335 dbSNP
rs974319484 5336 dbSNP
rs115019756 5337 dbSNP
rs753012202 5343 dbSNP
rs866583552 5344 dbSNP
rs954208509 5357 dbSNP
rs1453795118 5360 dbSNP
rs1473383692 5368 dbSNP
rs981740160 5375 dbSNP
rs1280330809 5381 dbSNP
rs1221841092 5385 dbSNP
rs149372870 5402 dbSNP
rs937133126 5404 dbSNP
rs1325512624 5410 dbSNP
rs1438556773 5411 dbSNP
rs1352655491 5413 dbSNP
rs1327673483 5416 dbSNP
rs1410039401 5428 dbSNP
rs910260830 5433 dbSNP
rs1173832498 5436 dbSNP
rs990930043 5444 dbSNP
rs1429065906 5445 dbSNP
rs944459282 5451 dbSNP
rs1040052193 5454 dbSNP
rs745962075 5455 dbSNP
rs913595388 5458 dbSNP
rs945264555 5472 dbSNP
rs370338964 5487 dbSNP
rs772397652 5490 dbSNP
rs1202030218 5504 dbSNP
rs1323041675 5507 dbSNP
rs1171256138 5508 dbSNP
rs1283728226 5509 dbSNP
rs1287766848 5511 dbSNP
rs902483280 5520 dbSNP
rs185305938 5538 dbSNP
rs41263680 5539 dbSNP
rs1291137001 5544 dbSNP
rs1002005433 5549 dbSNP
rs1055374785 5551 dbSNP
rs1219767375 5564 dbSNP
rs1254462470 5567 dbSNP
rs1483814981 5575 dbSNP
rs144714170 5578 dbSNP
rs557663181 5592 dbSNP
rs1468217596 5594 dbSNP
rs1406154164 5598 dbSNP
rs538321072 5603 dbSNP
rs575355399 5604 dbSNP
rs1404716912 5619 dbSNP
rs76007814 5620 dbSNP
rs761114993 5627 dbSNP
rs190117887 5630 dbSNP
rs1256809178 5634 dbSNP
rs755943212 5635 dbSNP
rs1212432157 5647 dbSNP
rs1410638222 5649 dbSNP
rs1307720348 5651 dbSNP
rs1334050003 5666 dbSNP
rs1378987798 5667 dbSNP
rs1312342486 5668 dbSNP
rs560827323 5678 dbSNP
rs971449819 5681 dbSNP
rs1027168155 5682 dbSNP
rs954442831 5696 dbSNP
rs1428143464 5697 dbSNP
rs1343824057 5701 dbSNP
rs1034648888 5705 dbSNP
rs779656762 5707 dbSNP
rs990410880 5711 dbSNP
rs914392896 5720 dbSNP
rs946794164 5729 dbSNP
rs1277185920 5732 dbSNP
rs866015291 5736 dbSNP
rs1183842055 5750 dbSNP
rs1484994580 5754 dbSNP
rs1205425682 5763 dbSNP
rs923940756 5772 dbSNP
rs1250525591 5773 dbSNP
rs1355840512 5778 dbSNP
rs1245073826 5784 dbSNP
rs572849199 5793 dbSNP
rs965807108 5800 dbSNP
rs944670057 5807 dbSNP
rs1380196235 5813 dbSNP
rs1360797938 5822 dbSNP
rs1040367129 5824 dbSNP
rs975861223 5831 dbSNP
rs1362776583 5834 dbSNP
rs1301856086 5839 dbSNP
rs1463849308 5840 dbSNP
rs540075512 5850 dbSNP
rs932235375 5856 dbSNP
rs1049249327 5857 dbSNP
rs1427014256 5866 dbSNP
rs887917868 5867 dbSNP
rs1194204943 5872 dbSNP
rs1472405891 5878 dbSNP
rs945002265 5894 dbSNP
rs144176516 5895 dbSNP
rs979095852 5908 dbSNP
rs1221682603 5909 dbSNP
rs1488742898 5915 dbSNP
rs1430241614 5920 dbSNP
rs1167744307 5921 dbSNP
rs925190495 5927 dbSNP
rs937959908 5929 dbSNP
rs748841599 5936 dbSNP
rs1054964630 5949 dbSNP
rs551079338 5963 dbSNP
rs906878109 5964 dbSNP
rs764593444 5970 dbSNP
rs1334888994 5984 dbSNP
rs146155533 5996 dbSNP
rs1037047770 5997 dbSNP
rs1342803404 5998 dbSNP
rs140176003 5998 dbSNP
rs1386751031 5999 dbSNP
rs182841991 5999 dbSNP
rs1300533946 6001 dbSNP
rs1295424351 6002 dbSNP
rs1366565891 6002 dbSNP
rs1460525959 6003 dbSNP
rs1353943723 6005 dbSNP
rs7551013 6007 dbSNP
rs1249996390 6009 dbSNP
rs773670416 6012 dbSNP
rs1269353485 6016 dbSNP
rs1201863215 6023 dbSNP
rs978179095 6024 dbSNP
rs569246720 6025 dbSNP
rs1019769354 6035 dbSNP
rs976514424 6043 dbSNP
rs1232972165 6045 dbSNP
rs1332246863 6056 dbSNP
rs1304057758 6063 dbSNP
rs1390109450 6066 dbSNP
rs1376282748 6076 dbSNP
rs921943014 6077 dbSNP
rs1249738369 6079 dbSNP
rs778647479 6084 dbSNP
rs988999519 6102 dbSNP
rs567660540 6106 dbSNP
rs1049278676 6118 dbSNP
rs1187657630 6120 dbSNP
rs1171841956 6122 dbSNP
rs777348888 6134 dbSNP
rs1020678066 6139 dbSNP
rs966458600 6140 dbSNP
rs979085842 6141 dbSNP
rs1418394712 6146 dbSNP
rs535092035 6158 dbSNP
rs546896071 6163 dbSNP
rs1401579676 6164 dbSNP
rs1036482636 6169 dbSNP
rs1179951728 6171 dbSNP
rs151294901 6180 dbSNP
rs937924916 6183 dbSNP
rs991173128 6184 dbSNP
rs745333049 6185 dbSNP
rs1237564092 6192 dbSNP
rs1353575928 6202 dbSNP
rs1310136340 6203 dbSNP
rs1435050513 6204 dbSNP
rs187746423 6206 dbSNP
rs192229197 6207 dbSNP
rs575965013 6212 dbSNP
rs1036827308 6213 dbSNP
rs140795081 6216 dbSNP
rs149696900 6217 dbSNP
rs761324895 6227 dbSNP
rs1201182009 6231 dbSNP
rs966557662 6234 dbSNP
rs1269512550 6240 dbSNP
rs889815865 6243 dbSNP
rs184015731 6244 dbSNP
rs1187840381 6248 dbSNP
rs953340914 6249 dbSNP
rs1020264305 6250 dbSNP
rs17640962 6258 dbSNP
rs764973563 6261 dbSNP
rs901428434 6270 dbSNP
rs1010376164 6271 dbSNP
rs1488281459 6276 dbSNP
rs1020499601 6278 dbSNP
rs187988838 6286 dbSNP
rs979615563 6287 dbSNP
rs1377226298 6288 dbSNP
rs865842989 6295 dbSNP
rs145499286 6299 dbSNP
rs1161410823 6302 dbSNP
rs6677295 6315 dbSNP
rs1316036184 6321 dbSNP
rs374741286 6323 dbSNP
rs1457156056 6324 dbSNP
rs576675094 6325 dbSNP
rs141131881 6326 dbSNP
rs1387636107 6330 dbSNP
rs6701227 6331 dbSNP
rs947069186 6341 dbSNP
rs146920866 6345 dbSNP
rs972530882 6346 dbSNP
rs1370968718 6347 dbSNP
rs1329319416 6348 dbSNP
rs757421576 6349 dbSNP
rs1264271625 6353 dbSNP
rs931376936 6354 dbSNP
rs1489994694 6370 dbSNP
rs1489432331 6371 dbSNP
rs1019879659 6373 dbSNP
rs900983500 6381 dbSNP
rs34959231 6387 dbSNP
rs561304109 6395 dbSNP
rs1340922135 6403 dbSNP
rs1279812898 6405 dbSNP
rs192028499 6406 dbSNP
rs1323710583 6407 dbSNP
rs942658582 6408 dbSNP
rs1041061329 6410 dbSNP
rs1169532518 6440 dbSNP
rs1477914123 6449 dbSNP
rs1489911759 6450 dbSNP
rs953457350 6455 dbSNP
rs1477362158 6458 dbSNP
rs901418362 6459 dbSNP
rs1246637931 6466 dbSNP
rs1184670910 6469 dbSNP
rs1252605433 6470 dbSNP
rs1472341545 6475 dbSNP
rs984797341 6489 dbSNP
rs1016202185 6490 dbSNP
rs1157015267 6496 dbSNP
rs1370644160 6498 dbSNP
rs547115598 6516 dbSNP
rs1458895932 6524 dbSNP
rs1010533133 6526 dbSNP
rs184581016 6532 dbSNP
rs1364154655 6549 dbSNP
rs1275369828 6550 dbSNP
rs928796340 6563 dbSNP
rs374493772 6567 dbSNP
rs1330058788 6569 dbSNP
rs992058967 6575 dbSNP
rs1402011079 6576 dbSNP
rs1173365318 6577 dbSNP
rs915702824 6578 dbSNP
rs947100184 6587 dbSNP
rs756066046 6589 dbSNP
rs1178074524 6590 dbSNP
rs779783498 6594 dbSNP
rs551146024 6612 dbSNP
rs934584485 6617 dbSNP
rs1208196711 6636 dbSNP
rs1040928643 6644 dbSNP
rs959153729 6648 dbSNP
rs569591938 6649 dbSNP
rs1028574328 6655 dbSNP
rs41263682 6657 dbSNP
rs970614421 6659 dbSNP
rs1378394603 6664 dbSNP
rs1323388114 6673 dbSNP
rs1016236427 6676 dbSNP
rs1245481284 6682 dbSNP
rs972645755 6683 dbSNP
rs34734654 6687 dbSNP
rs754740561 6693 dbSNP
rs972731729 6694 dbSNP
rs918518844 6707 dbSNP
rs754532202 6711 dbSNP
rs138234523 6712 dbSNP
rs1440401686 6719 dbSNP
rs566491706 6726 dbSNP
rs1180356763 6733 dbSNP
rs916067751 6734 dbSNP
rs1211961768 6740 dbSNP
rs533551597 6741 dbSNP
rs1487308451 6743 dbSNP
rs1285232482 6744 dbSNP
rs1480435987 6748 dbSNP
rs968470291 6756 dbSNP
rs942834503 6771 dbSNP
rs1227427848 6773 dbSNP
rs1175504498 6778 dbSNP
rs1041442366 6785 dbSNP
rs1379412964 6788 dbSNP
rs978485106 6790 dbSNP
rs558659952 6793 dbSNP
rs1450628324 6798 dbSNP
rs922622077 6799 dbSNP
rs1420785696 6807 dbSNP
rs371168973 6808 dbSNP
rs934310429 6818 dbSNP
rs946268454 6819 dbSNP
rs73046783 6824 dbSNP
rs922586635 6826 dbSNP
rs932544549 6827 dbSNP
rs1049612337 6830 dbSNP
rs1476728574 6833 dbSNP
rs1262141935 6840 dbSNP
rs1217287508 6848 dbSNP
rs747608762 6854 dbSNP
rs1489213570 6858 dbSNP
rs888255063 6865 dbSNP
rs142247965 6869 dbSNP
rs1000732086 6883 dbSNP
rs1055975678 6884 dbSNP
rs894877852 6886 dbSNP
rs1216348659 6889 dbSNP
rs1338923911 6896 dbSNP
rs117878964 6900 dbSNP
rs1401185949 6905 dbSNP
rs1169642415 6906 dbSNP
rs1291931139 6908 dbSNP
rs1024576754 6909 dbSNP
rs777259380 6910 dbSNP
rs960347383 6914 dbSNP
rs1370740738 6916 dbSNP
rs1194090275 6920 dbSNP
rs34878677 6920 dbSNP
rs906235239 6922 dbSNP
rs574410234 6925 dbSNP
rs1265177296 6927 dbSNP
rs542143861 6935 dbSNP
rs1025479176 6936 dbSNP
rs560181877 6941 dbSNP
rs952669653 6942 dbSNP
rs984354445 6946 dbSNP
rs367861708 6947 dbSNP
rs746330093 6948 dbSNP
rs1380495700 6952 dbSNP
rs924390511 6953 dbSNP
rs1386660925 6957 dbSNP
rs1275114316 6959 dbSNP
rs1327972668 6961 dbSNP
rs964458217 6971 dbSNP
rs1399822690 6972 dbSNP
rs528526501 6975 dbSNP
rs781018421 6976 dbSNP
rs922696113 6977 dbSNP
rs1175300598 6985 dbSNP
rs1433658076 6986 dbSNP
rs1268887391 6987 dbSNP
rs1176208421 6991 dbSNP
rs1457095970 6993 dbSNP
rs1238415725 6997 dbSNP
rs1257820667 7007 dbSNP
rs373457759 7009 dbSNP
rs1203122650 7026 dbSNP
rs1341942547 7033 dbSNP
rs932601879 7036 dbSNP
rs1233209987 7041 dbSNP
rs1241779170 7045 dbSNP
rs1313277039 7048 dbSNP
rs1305796664 7050 dbSNP
rs1049591422 7052 dbSNP
rs977422465 7062 dbSNP
rs1332313625 7065 dbSNP
rs926162970 7071 dbSNP
rs1393310397 7072 dbSNP
rs936299690 7073 dbSNP
rs1056363584 7076 dbSNP
rs1466529762 7077 dbSNP
rs894665739 7078 dbSNP
rs947780880 7085 dbSNP
rs1046100913 7090 dbSNP
rs906297421 7091 dbSNP
rs941229418 7092 dbSNP
rs1419296280 7099 dbSNP
rs187133475 7110 dbSNP
rs192780878 7111 dbSNP
rs1263989379 7113 dbSNP
rs1167949308 7118 dbSNP
rs1360379840 7119 dbSNP
rs993975428 7123 dbSNP
rs1025299828 7124 dbSNP
rs1238535141 7127 dbSNP
rs565379427 7130 dbSNP
rs1310017258 7138 dbSNP
rs1466044375 7144 dbSNP
rs3814340 7150 dbSNP
rs1005491868 7155 dbSNP
rs1018512152 7158 dbSNP
rs963884453 7162 dbSNP
rs1396385777 7167 dbSNP
rs1376989485 7168 dbSNP
rs1296291268 7169 dbSNP
rs1023189091 7170 dbSNP
rs1360657041 7172 dbSNP
rs1159776144 7176 dbSNP
rs976599323 7178 dbSNP
rs1471641145 7180 dbSNP
rs1367528814 7187 dbSNP
rs904768664 7202 dbSNP
rs1029712097 7215 dbSNP
rs1437226203 7222 dbSNP
rs1298035349 7226 dbSNP
rs1031827685 7229 dbSNP
rs184388443 7230 dbSNP
rs551212038 7251 dbSNP
rs1313015487 7253 dbSNP
rs1354595008 7254 dbSNP
rs1029331523 7264 dbSNP
rs1261377986 7266 dbSNP
rs1466612317 7269 dbSNP
rs1357169856 7270 dbSNP
rs1209953039 7272 dbSNP
rs1399385657 7281 dbSNP
rs865983312 7286 dbSNP
rs1341043813 7288 dbSNP
rs189318275 7295 dbSNP
rs1485133447 7296 dbSNP
rs985081473 7301 dbSNP
rs1193290901 7304 dbSNP
rs530209997 7305 dbSNP
rs1480571304 7306 dbSNP
rs1191927474 7309 dbSNP
rs936231536 7312 dbSNP
rs370044146 7314 dbSNP
rs1449964479 7315 dbSNP
rs1289191648 7328 dbSNP
rs991782416 7331 dbSNP
rs746735199 7337 dbSNP
rs1337203438 7340 dbSNP
rs1255986712 7343 dbSNP
rs1217785400 7346 dbSNP
rs916160341 7349 dbSNP
rs1318253026 7352 dbSNP
rs1271868192 7353 dbSNP
rs950183480 7363 dbSNP
rs1045885233 7364 dbSNP
rs143148590 7365 dbSNP
rs918385917 7376 dbSNP
rs906285959 7387 dbSNP
rs575211492 7389 dbSNP
rs1323606238 7401 dbSNP
rs1442712481 7403 dbSNP
rs929769355 7407 dbSNP
rs1397656099 7410 dbSNP
rs1046696212 7415 dbSNP
rs775656740 7433 dbSNP
rs1005644153 7440 dbSNP
rs929424679 7445 dbSNP
rs1039600124 7463 dbSNP
rs1246250781 7467 dbSNP
rs899749486 7475 dbSNP
rs1194330295 7476 dbSNP
rs1470048785 7477 dbSNP
rs771751114 7480 dbSNP
rs763428945 7484 dbSNP
rs1236590458 7492 dbSNP
rs1198188502 7494 dbSNP
rs567045274 7495 dbSNP
rs1057453038 7502 dbSNP
rs748002535 7510 dbSNP
rs1217442481 7512 dbSNP
rs1229539672 7515 dbSNP
rs1284098139 7516 dbSNP
rs1235844129 7528 dbSNP
rs1373925311 7531 dbSNP
rs967452598 7534 dbSNP
rs998962057 7539 dbSNP
rs1447014525 7540 dbSNP
rs948734764 7544 dbSNP
rs1331267000 7557 dbSNP
rs6680854 7558 dbSNP
rs1224175245 7560 dbSNP
rs1033412533 7562 dbSNP
rs374724915 7569 dbSNP
rs904802778 7570 dbSNP
rs1247687499 7572 dbSNP
rs1000438978 7581 dbSNP
rs1490402126 7584 dbSNP
rs1198315449 7589 dbSNP
rs1178289565 7593 dbSNP
rs1481062048 7597 dbSNP
rs1234439348 7600 dbSNP
rs957363103 7607 dbSNP
rs1212860391 7619 dbSNP
rs1473249460 7623 dbSNP
rs1307860452 7624 dbSNP
rs1240485953 7625 dbSNP
rs1375053030 7626 dbSNP
rs1281710708 7630 dbSNP
rs991915107 7631 dbSNP
rs1358893373 7639 dbSNP
rs180974697 7640 dbSNP
rs1158654797 7643 dbSNP
rs1437078721 7646 dbSNP
rs916133794 7647 dbSNP
rs1358743024 7654 dbSNP
rs1158097275 7657 dbSNP
rs1419955115 7661 dbSNP
rs1410431982 7664 dbSNP
rs891918217 7666 dbSNP
rs764214353 7667 dbSNP
rs971656762 7669 dbSNP
rs997952113 7672 dbSNP
rs1486774766 7673 dbSNP
rs1029858246 7679 dbSNP
rs1398916933 7680 dbSNP
rs981574988 7681 dbSNP
rs953816547 7684 dbSNP
rs919450103 7686 dbSNP
rs558084778 7688 dbSNP
rs985115621 7691 dbSNP
rs929715376 7697 dbSNP
rs1287323168 7699 dbSNP
rs769750344 7700 dbSNP
rs1227340485 7712 dbSNP
rs1046783822 7714 dbSNP
rs774672677