miRTarBase - #MIRT066291 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MTFR1L   
Synonyms FAM54B, HYST1888, MST116, MSTP116
Description mitochondrial fission regulator 1 like
Transcript NM_001099627   
Other Transcripts NM_001099626 , NM_001099625 , NM_019557   
Expression
Putative miRNA Targets on MTFR1L
3'UTR of MTFR1L
(miRNA target sites are highlighted)
>MTFR1L|NM_001099627|3'UTR
   1 TGGGTATCCTGAAGGACTTTCACCGAATGAAACAGAGTCAAGATCTGAACCGGAGTTTATTGAAGGAGGAAGACCCTGCT
  81 GTGCTTATCTCTGAGGTCCTAAGGAGGAAGTTTGCTCTAAAGGAAGAAGATATCAGTAGAAAAGGAAATTGACAACCCTC
 161 AGCTCTGCAAACTCAGTCTCATGCTCCTGGAATACCTTCAATAGCTGCCTTCCTCACCGCAGATGTTTCTGCCTCTTAAG
 241 GATAGATCTTCTGCAACAGTCTTGCTGACAAGCTAGAGCTTGGACTGAAAGAGAAGAGCTGGATTATATATTTCCCAGAC
 321 TTCAAACCCTAGCAGAAGCTAAGGCTTGTGATTTGACCTGAGACATTTGTTTCAGGTAATCGTGTAGAATGAAGTATCTT
 401 AGTTTAAAGGGTAAGAGAGAAGTTGTTTCTGGTTTTTCCTTGCCCCTGTGTGAAAATAGGTCCTAAATGACTGACTTCAC
 481 TGCATTAGACCCTATAGCTGGTCTCACAAGACACTTTGTGCCCAGCTGTCACTCACTCAGCAGCTTCCTTGCAGCAGAGC
 561 AGGGCTGAGGGGAAGGGGCTATGAATGTTTGTATACATGTTCACAGGGCACGGAAAATCTTATGCTGCTCCGTCATAAAC
 641 CTACACCAATGCCCAGCAATCACCCTCCTCACTTCCTTGTCTAGATGTAGAGGTCAGGCTGCTGAACCAGCCAACACATG
 721 GGCTACTGCTGGGAAGCCTGGGCTGTTTTTTTTCTTAAACACATTTTATATTACTGAACAACCAAATCTACCCTCCACGG
 801 CCCTGAGGCCTTATCAGTTCCACTGATTAAAAACTTTCTCTTCCACGGACTTTAAGCCCGGTAGGAAAGAGAGAGGAGGA
 881 GGGGGAAAGAGCAAACCATCTTTCTTCCAGGCCCTTGACTGCTCCTTTGGGCTGGGCCAAGGTTTGTATGTACCACACCA
 961 TGCATGACTCAGATGCCCTCAGGTCCCTTTCTCTATGGTATGTATACTGCTTGTGTTTGGGTTGAAGCACTACCTGACAT
1041 TAAAGGAAGGACTTGGAGAGAGAATGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||:| |||  ||||||| 
Target 5' ggaAAATC-TTA--TGCTGCTc 3'
612 - 630 158.00 -10.10
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||::|| ||:  |||| || 
Target 5' tcCAGGCCCTTGACTGCTCCTt 3'
906 - 927 132.00 -10.30
3
miRNA  3' guGUUUG-GUAAUA-CACGACGAu 5'
            ||||| || | |  |||| || 
Target 5' tgCAAACTCAGTCTCATGCTCCTg 3'
166 - 189 128.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM5783896 28 COSMIC
COSM290165 34 COSMIC
COSM4424988 46 COSMIC
COSM7758926 46 COSMIC
COSN1102056 73 COSMIC
COSN18177937 141 COSMIC
COSN7215658 470 COSMIC
COSN7215659 522 COSMIC
COSN7989658 689 COSMIC
COSN28292448 901 COSMIC
COSN1102058 1557 COSMIC
COSN1102059 1558 COSMIC
COSN28476254 1939 COSMIC
COSN22030330 2032 COSMIC
COSM7194732 2130 COSMIC
COSM3865171 2138 COSMIC
COSM5342191 2143 COSMIC
COSM4683078 2152 COSMIC
COSM244393 2170 COSMIC
COSM4935560 2178 COSMIC
COSM7649894 2242 COSMIC
COSN30497710 2252 COSMIC
COSN31564304 2263 COSMIC
COSN17037343 2281 COSMIC
COSN30532442 2292 COSMIC
COSN30108559 2300 COSMIC
COSM9187502 2310 COSMIC
COSM1626984 2325 COSMIC
COSM7690277 2354 COSMIC
COSN30164476 2596 COSMIC
COSN20094583 2629 COSMIC
COSN26649106 2645 COSMIC
COSN1442126 2651 COSMIC
COSN26637073 2655 COSMIC
COSN19661216 2688 COSMIC
COSN30540561 2891 COSMIC
COSN24298274 2948 COSMIC
COSN25714745 3153 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1443756745 4 dbSNP
rs781333539 9 dbSNP
rs748370350 15 dbSNP
rs376160465 17 dbSNP
rs770898526 24 dbSNP
rs778797500 25 dbSNP
rs756535647 26 dbSNP
rs1384361947 34 dbSNP
rs1242526360 35 dbSNP
rs1204797727 43 dbSNP
rs772065817 52 dbSNP
rs1484129651 55 dbSNP
rs775076956 56 dbSNP
rs1236948380 58 dbSNP
rs760172847 59 dbSNP
rs768184665 65 dbSNP
rs993599697 72 dbSNP
rs578179239 74 dbSNP
rs761481888 78 dbSNP
rs1167499900 84 dbSNP
rs181549158 85 dbSNP
rs768196507 85 dbSNP
rs1337786103 86 dbSNP
rs1318926473 96 dbSNP
rs1370811240 99 dbSNP
rs1456410075 104 dbSNP
rs557774985 107 dbSNP
rs1390629002 112 dbSNP
rs1297137790 113 dbSNP
rs1431160894 118 dbSNP
rs887847192 121 dbSNP
rs1302263114 124 dbSNP
rs976742563 127 dbSNP
rs1376869228 130 dbSNP
rs1007430616 132 dbSNP
rs529493852 142 dbSNP
rs1325232842 143 dbSNP
rs1204119281 148 dbSNP
rs549286058 148 dbSNP
rs1314948556 151 dbSNP
rs1206775967 152 dbSNP
rs560013454 155 dbSNP
rs997406463 159 dbSNP
rs186559842 169 dbSNP
rs1447589955 173 dbSNP
rs1228066345 177 dbSNP
rs778572736 182 dbSNP
rs1266439550 192 dbSNP
rs780629593 204 dbSNP
rs1216934685 206 dbSNP
rs1177653052 212 dbSNP
rs1255711540 213 dbSNP
rs1428977350 217 dbSNP
rs191925710 218 dbSNP
rs1465002813 226 dbSNP
rs1291082775 227 dbSNP
rs75180840 230 dbSNP
rs1184070211 233 dbSNP
rs988717656 238 dbSNP
rs1347055303 239 dbSNP
rs1223708610 241 dbSNP
rs989762580 261 dbSNP
rs1310160986 265 dbSNP
rs532724445 270 dbSNP
rs549465179 275 dbSNP
rs1349855705 280 dbSNP
rs1179626928 284 dbSNP
rs1216046674 284 dbSNP
rs1413708830 287 dbSNP
rs1401132498 288 dbSNP
rs749353772 290 dbSNP
rs914358765 291 dbSNP
rs969777968 296 dbSNP
rs559174148 302 dbSNP
rs1364934007 303 dbSNP
rs74060861 304 dbSNP
rs1156342989 306 dbSNP
rs926777434 317 dbSNP
rs1467541690 321 dbSNP
rs1405197174 336 dbSNP
rs1302071514 340 dbSNP
rs939611870 343 dbSNP
rs927030354 345 dbSNP
rs1392979412 349 dbSNP
rs1056694595 350 dbSNP
rs113663585 353 dbSNP
rs896835388 355 dbSNP
rs929320237 356 dbSNP
rs1223503082 365 dbSNP
rs1049082962 368 dbSNP
rs887899360 371 dbSNP
rs1487618095 379 dbSNP
rs565990935 385 dbSNP
rs1251643966 387 dbSNP
rs775662574 397 dbSNP
rs779273451 410 dbSNP
rs1048700896 412 dbSNP
rs1352572642 413 dbSNP
rs1007608656 419 dbSNP
rs1424821281 429 dbSNP
rs138485197 444 dbSNP
rs1347809819 447 dbSNP
rs1463170996 449 dbSNP
rs748437260 450 dbSNP
rs1310762024 453 dbSNP
rs111801136 458 dbSNP
rs1316987228 472 dbSNP
rs578077341 484 dbSNP
rs1212921968 486 dbSNP
rs1246875049 488 dbSNP
rs1312062203 489 dbSNP
rs997742097 493 dbSNP
rs1031617636 497 dbSNP
rs1281635672 498 dbSNP
rs1206834752 500 dbSNP
rs1482483022 503 dbSNP
rs955951201 512 dbSNP
rs1011238595 514 dbSNP
rs1030948002 516 dbSNP
rs1202393249 519 dbSNP
rs956728492 525 dbSNP
rs1253274384 535 dbSNP
rs1180816500 536 dbSNP
rs1410937284 539 dbSNP
rs371233921 549 dbSNP
rs1021207472 550 dbSNP
rs1190233298 555 dbSNP
rs374387946 564 dbSNP
rs371627438 565 dbSNP
rs1463926770 566 dbSNP
rs968615884 567 dbSNP
rs1174256567 571 dbSNP
rs979922566 581 dbSNP
rs926803733 592 dbSNP
rs1376994854 594 dbSNP
rs1216558384 595 dbSNP
rs1369856564 597 dbSNP
rs1883161 606 dbSNP
rs143404138 611 dbSNP
rs1306263068 616 dbSNP
rs1317507501 620 dbSNP
rs1217239865 621 dbSNP
rs1811819 628 dbSNP
rs1209967223 636 dbSNP
rs919552078 637 dbSNP
rs181973373 639 dbSNP
rs1235257262 640 dbSNP
rs984790904 642 dbSNP
rs373886713 661 dbSNP
rs918236356 662 dbSNP
rs1476621877 664 dbSNP
rs1236956007 674 dbSNP
rs943445606 678 dbSNP
rs1332038687 679 dbSNP
rs1039144408 680 dbSNP
rs1342093159 681 dbSNP
rs888666265 682 dbSNP
rs942965741 687 dbSNP
rs1276197094 689 dbSNP
rs901913235 690 dbSNP
rs933204440 702 dbSNP
rs1340176628 703 dbSNP
rs1437882343 704 dbSNP
rs901367012 713 dbSNP
rs1324642885 719 dbSNP
rs1220421706 738 dbSNP
rs1277201408 742 dbSNP
rs551095884 748 dbSNP
rs565188975 752 dbSNP
rs1031087300 758 dbSNP
rs571228497 759 dbSNP
rs1487120450 766 dbSNP
rs892461017 769 dbSNP
rs1269341198 770 dbSNP
rs1010829767 772 dbSNP
rs1489373692 777 dbSNP
rs1350428216 778 dbSNP
rs147974767 784 dbSNP
rs1022257110 786 dbSNP
rs1011414778 789 dbSNP
rs1021260119 790 dbSNP
rs968639343 792 dbSNP
rs980437441 793 dbSNP
rs1346381702 798 dbSNP
rs1436274651 803 dbSNP
rs1273416937 804 dbSNP
rs1376212839 805 dbSNP
rs1170355272 807 dbSNP
rs1284706511 829 dbSNP
rs1224071319 830 dbSNP
rs1350781984 830 dbSNP
rs1292131788 835 dbSNP
rs1450665473 847 dbSNP
rs1196529514 854 dbSNP
rs1234356630 861 dbSNP
rs1034171057 866 dbSNP
rs549330831 877 dbSNP
rs1470485514 878 dbSNP
rs960166316 880 dbSNP
rs1410576905 892 dbSNP
rs1418013471 899 dbSNP
rs992575392 913 dbSNP
rs79410492 919 dbSNP
rs1035473377 920 dbSNP
rs1322019706 933 dbSNP
rs960050662 937 dbSNP
rs992378240 942 dbSNP
rs760543658 949 dbSNP
rs1364872175 950 dbSNP
rs1309266301 958 dbSNP
rs1433558339 961 dbSNP
rs1247602895 962 dbSNP
rs1315099540 970 dbSNP
rs1355246468 979 dbSNP
rs950949669 981 dbSNP
rs1207649647 985 dbSNP
rs1272400242 987 dbSNP
rs2115804 988 dbSNP
rs1438119591 1000 dbSNP
rs909229044 1005 dbSNP
rs1197774011 1018 dbSNP
rs1236345095 1021 dbSNP
rs1185538714 1027 dbSNP
rs533660549 1033 dbSNP
rs58646127 1037 dbSNP
rs376674283 1040 dbSNP
rs550586291 1044 dbSNP
rs141645995 1050 dbSNP
rs943381732 1051 dbSNP
rs1227232246 1052 dbSNP
rs1287053915 1055 dbSNP
rs534769787 1060 dbSNP
rs770832248 1076 dbSNP
rs1161614687 1078 dbSNP
rs1421915998 1082 dbSNP
rs975143105 1084 dbSNP
rs1331077955 1085 dbSNP
rs1213882867 1089 dbSNP
rs1398793302 1099 dbSNP
rs150533609 1103 dbSNP
rs776671866 1110 dbSNP
rs80353422 1111 dbSNP
rs1242165434 1115 dbSNP
rs1190481033 1119 dbSNP
rs1052965776 1124 dbSNP
rs1475818444 1125 dbSNP
rs891602502 1135 dbSNP
rs1162752885 1142 dbSNP
rs1204163562 1143 dbSNP
rs947326148 1145 dbSNP
rs1441986473 1153 dbSNP
rs1185496070 1155 dbSNP
rs1375053437 1158 dbSNP
rs1042978301 1164 dbSNP
rs1478255709 1170 dbSNP
rs113100448 1178 dbSNP
rs1052563014 1186 dbSNP
rs1421873749 1187 dbSNP
rs1463242444 1190 dbSNP
rs1173606267 1197 dbSNP
rs905774355 1211 dbSNP
rs1001242604 1212 dbSNP
rs138625632 1216 dbSNP
rs1393849140 1219 dbSNP
rs1491039962 1219 dbSNP
rs1340783200 1220 dbSNP
rs1491011740 1220 dbSNP
rs1388415738 1222 dbSNP
rs1010965439 1224 dbSNP
rs1276092193 1225 dbSNP
rs1035761080 1232 dbSNP
rs1320918261 1235 dbSNP
rs905219614 1246 dbSNP
rs895567065 1251 dbSNP
rs1447852756 1253 dbSNP
rs557065575 1263 dbSNP
rs1198846249 1268 dbSNP
rs1263897217 1278 dbSNP
rs1488753128 1280 dbSNP
rs1026495768 1281 dbSNP
rs1034717579 1284 dbSNP
rs1233573234 1286 dbSNP
rs1193145858 1287 dbSNP
rs950835199 1293 dbSNP
rs1267068019 1294 dbSNP
rs187570811 1295 dbSNP
rs959892236 1304 dbSNP
rs1159823603 1306 dbSNP
rs542753173 1312 dbSNP
rs567480975 1317 dbSNP
rs1441775096 1320 dbSNP
rs984945995 1322 dbSNP
rs1185280060 1325 dbSNP
rs1235829845 1327 dbSNP
rs553390273 1330 dbSNP
rs1300300394 1340 dbSNP
rs1329307488 1344 dbSNP
rs55731212 1362 dbSNP
rs983901713 1372 dbSNP
rs909531503 1375 dbSNP
rs4659384 1380 dbSNP
rs975685851 1385 dbSNP
rs974775852 1388 dbSNP
rs1192178081 1392 dbSNP
rs1267056989 1411 dbSNP
rs1160660408 1419 dbSNP
rs923231970 1421 dbSNP
rs934264415 1424 dbSNP
rs954829919 1428 dbSNP
rs752220443 1429 dbSNP
rs913300869 1437 dbSNP
rs1438604496 1438 dbSNP
rs1332743818 1442 dbSNP
rs914083188 1444 dbSNP
rs947250814 1445 dbSNP
rs1458063915 1448 dbSNP
rs1042862103 1451 dbSNP
rs1388238506 1457 dbSNP
rs1242027828 1458 dbSNP
rs1459694088 1464 dbSNP
rs1376790536 1472 dbSNP
rs1043812035 1474 dbSNP
rs905187724 1477 dbSNP
rs927252276 1478 dbSNP
rs1239577019 1482 dbSNP
rs1180183713 1487 dbSNP
rs1307137406 1494 dbSNP
rs1056475679 1508 dbSNP
rs1222516897 1513 dbSNP
rs1265237229 1524 dbSNP
rs1487670105 1535 dbSNP
rs937215519 1536 dbSNP
rs1287399613 1537 dbSNP
rs573336627 1542 dbSNP
rs768960331 1549 dbSNP
rs200634933 1552 dbSNP
rs1386507927 1557 dbSNP
rs1424047848 1560 dbSNP
rs182440571 1562 dbSNP
rs774734834 1563 dbSNP
rs539039756 1565 dbSNP
rs1463387448 1566 dbSNP
rs763836604 1568 dbSNP
rs1399506001 1570 dbSNP
rs951218057 1572 dbSNP
rs1046869880 1576 dbSNP
rs1381354200 1587 dbSNP
rs1229105375 1599 dbSNP
rs1312360398 1600 dbSNP
rs1320120333 1602 dbSNP
rs1220892632 1605 dbSNP
rs1259064996 1607 dbSNP
rs888190758 1620 dbSNP
rs1197242423 1626 dbSNP
rs141640989 1630 dbSNP
rs1017129483 1631 dbSNP
rs767925443 1632 dbSNP
rs1180761071 1633 dbSNP
rs371231333 1641 dbSNP
rs1486727588 1643 dbSNP
rs1171160193 1646 dbSNP
rs964999748 1648 dbSNP
rs996803454 1661 dbSNP
rs1211701869 1663 dbSNP
rs1030350176 1664 dbSNP
rs543041975 1668 dbSNP
rs1417586899 1684 dbSNP
rs1448920639 1693 dbSNP
rs1302307509 1698 dbSNP
rs1377286874 1703 dbSNP
rs563133135 1706 dbSNP
rs913352929 1716 dbSNP
rs1279249205 1717 dbSNP
rs968770174 1719 dbSNP
rs1184185827 1723 dbSNP
rs372630852 1725 dbSNP
rs1281425133 1726 dbSNP
rs988379962 1732 dbSNP
rs927082943 1740 dbSNP
rs937285197 1746 dbSNP
rs577822221 1751 dbSNP
rs1489077811 1753 dbSNP
rs1057409443 1758 dbSNP
rs1377786885 1759 dbSNP
rs867676257 1762 dbSNP
rs929662946 1765 dbSNP
rs1476756317 1767 dbSNP
rs926664975 1769 dbSNP
rs1425838615 1770 dbSNP
rs938111533 1772 dbSNP
rs548814666 1777 dbSNP
rs1056843641 1780 dbSNP
rs896498526 1782 dbSNP
rs1421762156 1789 dbSNP
rs1299107788 1798 dbSNP
rs1340110049 1806 dbSNP
rs1392795960 1814 dbSNP
rs1014162628 1819 dbSNP
rs559353903 1827 dbSNP
rs1368950033 1841 dbSNP
rs1046763649 1846 dbSNP
rs570931421 1858 dbSNP
rs528317174 1860 dbSNP
rs1355142205 1862 dbSNP
rs1216699093 1867 dbSNP
rs1230774069 1867 dbSNP
rs551570821 1871 dbSNP
rs1305281664 1872 dbSNP
rs1284938388 1876 dbSNP
rs1487090212 1884 dbSNP
rs766599240 1890 dbSNP
rs1227523382 1916 dbSNP
rs1477665538 1919 dbSNP
rs1274037555 1931 dbSNP
rs571605836 1932 dbSNP
rs1441691025 1933 dbSNP
rs756547203 1938 dbSNP
rs780390277 1939 dbSNP
rs537322311 1940 dbSNP
rs551001632 1948 dbSNP
rs1197815054 1951 dbSNP
rs1325966973 1951 dbSNP
rs1350768974 1954 dbSNP
rs1436391051 1959 dbSNP
rs1273650905 1967 dbSNP
rs1005357666 1968 dbSNP
rs1251513750 1974 dbSNP
rs1037887111 1975 dbSNP
rs1240299942 1977 dbSNP
rs1192163915 1981 dbSNP
rs750817879 1983 dbSNP
rs900644291 1997 dbSNP
rs899558105 1998 dbSNP
rs996624887 1999 dbSNP
rs1168455379 2003 dbSNP
rs1387836568 2005 dbSNP
rs1029727469 2008 dbSNP
rs1240003481 2010 dbSNP
rs996341382 2026 dbSNP
rs79151090 2029 dbSNP
rs954975466 2031 dbSNP
rs1379714069 2032 dbSNP
rs1468807299 2034 dbSNP
rs1021194573 2039 dbSNP
rs536600405 2040 dbSNP
rs1168195446 2042 dbSNP
rs1403135369 2046 dbSNP
rs1010230975 2051 dbSNP
rs1020203040 2053 dbSNP
rs1330111696 2055 dbSNP
rs1961580 2063 dbSNP
rs978784822 2071 dbSNP
rs535249468 2077 dbSNP
rs779158988 2081 dbSNP
rs1034203398 2082 dbSNP
rs958809191 2086 dbSNP
rs368415663 2088 dbSNP
rs763466588 2089 dbSNP
rs766930439 2090 dbSNP
rs1438491885 2092 dbSNP
rs74388471 2096 dbSNP
rs755052708 2098 dbSNP
rs1348225015 2101 dbSNP
rs1363567110 2104 dbSNP
rs781309675 2107 dbSNP
rs1238316349 2108 dbSNP
rs1275742039 2111 dbSNP
rs1341786172 2112 dbSNP
rs752881811 2113 dbSNP
rs146230804 2117 dbSNP
rs368328019 2119 dbSNP
rs372209872 2120 dbSNP
rs771992112 2122 dbSNP
rs544914222 2126 dbSNP
rs375254636 2128 dbSNP
rs746947619 2130 dbSNP
rs1476221710 2132 dbSNP
rs768077073 2135 dbSNP
rs776167327 2136 dbSNP
rs1414553299 2140 dbSNP
rs747804055 2142 dbSNP
rs369289953 2143 dbSNP
rs1047769544 2145 dbSNP
rs1339542360 2151 dbSNP
rs772839924 2153 dbSNP
rs1412482854 2157 dbSNP
rs1304670252 2160 dbSNP
rs1279870177 2163 dbSNP
rs763373271 2169 dbSNP
rs575578562 2171 dbSNP
rs774769196 2173 dbSNP
rs886987299 2178 dbSNP
rs1467389884 2180 dbSNP
rs187133360 2187 dbSNP
rs767522440 2188 dbSNP
rs1279372048 2189 dbSNP
rs752751670 2212 dbSNP
rs756415974 2219 dbSNP
rs200691279 2221 dbSNP
rs899568551 2223 dbSNP
rs190048702 2224 dbSNP
rs779854046 2225 dbSNP
rs1455698877 2227 dbSNP
rs1448523093 2231 dbSNP
rs1038583533 2235 dbSNP
rs753340593 2235 dbSNP
rs375483961 2240 dbSNP
rs746954787 2241 dbSNP
rs756830838 2242 dbSNP
rs1178013126 2244 dbSNP
rs1409103596 2247 dbSNP
rs754878855 2254 dbSNP
rs542581241 2256 dbSNP
rs747716346 2257 dbSNP
rs769290291 2259 dbSNP
rs772890946 2261 dbSNP
rs1172682030 2263 dbSNP
rs373824378 2264 dbSNP
rs750063229 2266 dbSNP
rs1449202927 2270 dbSNP
rs369725159 2273 dbSNP
rs771220849 2275 dbSNP
rs1454393463 2280 dbSNP
rs1051934134 2282 dbSNP
rs774733846 2284 dbSNP
rs759960464 2286 dbSNP
rs1399218869 2292 dbSNP
rs1261253464 2295 dbSNP
rs768007186 2297 dbSNP
rs1207870244 2304 dbSNP
rs559199865 2307 dbSNP
rs760881358 2308 dbSNP
rs754508878 2309 dbSNP
rs757518015 2310 dbSNP
rs1020252364 2313 dbSNP
rs114553184 2314 dbSNP
rs751310706 2316 dbSNP
rs1347330974 2317 dbSNP
rs1456804643 2320 dbSNP
rs551632698 2321 dbSNP
rs754718281 2322 dbSNP
rs1163083645 2324 dbSNP
rs1391888370 2326 dbSNP
rs1407063125 2328 dbSNP
rs781259558 2332 dbSNP
rs565072603 2334 dbSNP
rs1410536557 2337 dbSNP
rs755668704 2344 dbSNP
rs746750623 2353 dbSNP
rs1435436158 2360 dbSNP
rs1242485761 2361 dbSNP
rs748969751 2369 dbSNP
rs1359885548 2370 dbSNP
rs770546738 2374 dbSNP
rs779154551 2376 dbSNP
rs1452088194 2378 dbSNP
rs758115298 2380 dbSNP
rs1482496888 2382 dbSNP
rs746299675 2385 dbSNP
rs1159906445 2388 dbSNP
rs1252010973 2389 dbSNP
rs1422635203 2390 dbSNP
rs1187453998 2393 dbSNP
rs530869193 2395 dbSNP
rs1009151466 2398 dbSNP
rs1392533748 2399 dbSNP
rs779678879 2399 dbSNP
rs1239181905 2408 dbSNP
rs1322877849 2409 dbSNP
rs753218882 2410 dbSNP
rs1167047345 2412 dbSNP
rs1370216526 2414 dbSNP
rs1430605105 2416 dbSNP
rs1300015491 2420 dbSNP
rs1020579378 2421 dbSNP
rs1377044561 2423 dbSNP
rs772316363 2424 dbSNP
rs1354720347 2427 dbSNP
rs1238533377 2436 dbSNP
rs1259336160 2439 dbSNP
rs2294223 2440 dbSNP
rs1210791632 2450 dbSNP
rs1267323824 2455 dbSNP
rs1467502092 2461 dbSNP
rs770828921 2465 dbSNP
rs1180005382 2466 dbSNP
rs1380323625 2468 dbSNP
rs776538386 2470 dbSNP
rs550602452 2472 dbSNP
rs1024109992 2473 dbSNP
rs1336007799 2485 dbSNP
rs1458265404 2495 dbSNP
rs778482859 2501 dbSNP
rs1162404244 2510 dbSNP
rs1034250038 2511 dbSNP
rs959606888 2512 dbSNP
rs1208508124 2513 dbSNP
rs1377650736 2520 dbSNP
rs1390884665 2520 dbSNP
rs554957964 2529 dbSNP
rs1259259939 2534 dbSNP
rs992646174 2544 dbSNP
rs951292676 2546 dbSNP
rs759415127 2548 dbSNP
rs909782300 2550 dbSNP
rs567522064 2552 dbSNP
rs1254931888 2562 dbSNP
rs941034811 2569 dbSNP
rs917974189 2572 dbSNP
rs1174952308 2574 dbSNP
rs1418104253 2580 dbSNP
rs983429944 2584 dbSNP
rs1415326208 2588 dbSNP
rs1472028388 2596 dbSNP
rs1156675435 2599 dbSNP
rs1346705043 2613 dbSNP
rs1399436434 2619 dbSNP
rs1461585854 2621 dbSNP
rs1454267779 2622 dbSNP
rs113609111 2624 dbSNP
rs1302175513 2624 dbSNP
rs111641290 2625 dbSNP
rs5773135 2626 dbSNP
rs76012520 2626 dbSNP
rs34376104 2627 dbSNP
rs72508774 2628 dbSNP
rs397735933 2629 dbSNP
rs1220837306 2640 dbSNP
rs779996053 2643 dbSNP
rs1307396576 2646 dbSNP
rs1201865733 2661 dbSNP
rs1257197485 2669 dbSNP
rs375244065 2671 dbSNP
rs1374971336 2674 dbSNP
rs1483383351 2676 dbSNP
rs921051633 2681 dbSNP
rs1440492680 2684 dbSNP
rs1413011308 2686 dbSNP
rs1254950612 2687 dbSNP
rs15045 2688 dbSNP
rs1194085342 2690 dbSNP
rs1356339658 2695 dbSNP
rs1227970462 2702 dbSNP
rs1426621940 2703 dbSNP
rs1052371040 2704 dbSNP
rs1305331587 2704 dbSNP
rs1319078491 2708 dbSNP
rs546956964 2713 dbSNP
rs1466749197 2714 dbSNP
rs941264334 2715 dbSNP
rs1373845999 2720 dbSNP
rs768508038 2722 dbSNP
rs890594994 2727 dbSNP
rs1217183839 2735 dbSNP
rs1038312134 2739 dbSNP
rs1361899980 2740 dbSNP
rs1213269209 2741 dbSNP
rs1255916323 2744 dbSNP
rs921092641 2761 dbSNP
rs2294222 2763 dbSNP
rs1489047623 2767 dbSNP
rs1217103412 2772 dbSNP
rs777610433 2781 dbSNP
rs1041973373 2784 dbSNP
rs1484859587 2787 dbSNP
rs1472078934 2795 dbSNP
rs1425779622 2797 dbSNP
rs1454802358 2806 dbSNP
rs139329709 2811 dbSNP
rs1409959302 2816 dbSNP
rs1419424511 2831 dbSNP
rs1421704461 2834 dbSNP
rs1175361277 2836 dbSNP
rs1299208105 2836 dbSNP
rs1344912782 2836 dbSNP
rs1393182683 2837 dbSNP
rs1295858381 2840 dbSNP
rs1436434090 2842 dbSNP
rs1314872256 2844 dbSNP
rs1376090714 2846 dbSNP
rs1050890754 2847 dbSNP
rs1355433009 2852 dbSNP
rs1240346658 2853 dbSNP
rs543347912 2867 dbSNP
rs890837034 2870 dbSNP
rs1441812704 2877 dbSNP
rs1009289121 2878 dbSNP
rs1296636916 2880 dbSNP
rs1000637628 2889 dbSNP
rs1034316494 2890 dbSNP
rs1042006027 2891 dbSNP
rs1467947588 2894 dbSNP
rs903557098 2896 dbSNP
rs1441785436 2897 dbSNP
rs762469053 2900 dbSNP
rs1159437402 2902 dbSNP
rs894561505 2905 dbSNP
rs2294221 2906 dbSNP
rs559401656 2908 dbSNP
rs1300948388 2912 dbSNP
rs201247954 2914 dbSNP
rs959897857 2914 dbSNP
rs1237095438 2925 dbSNP
rs558766562 2928 dbSNP
rs1378387333 2929 dbSNP
rs1278649260 2930 dbSNP
rs1482430066 2932 dbSNP
rs3210937 2936 dbSNP
rs951217792 2937 dbSNP
rs1004036176 2938 dbSNP
rs1334090458 2941 dbSNP
rs182709543 2950 dbSNP
rs58504236 2951 dbSNP
rs1190424486 2952 dbSNP
rs1250861705 2959 dbSNP
rs1044488 2960 dbSNP
rs1044494 2962 dbSNP
rs200490558 2963 dbSNP
rs1044496 2964 dbSNP
rs1183985048 2987 dbSNP
rs1174157863 2988 dbSNP
rs909196374 2989 dbSNP
rs1044508 2995 dbSNP
rs1461381651 2998 dbSNP
rs1395808035 3002 dbSNP
rs554985833 3004 dbSNP
rs575043578 3008 dbSNP
rs1449695215 3010 dbSNP
rs1356504847 3012 dbSNP
rs1443116439 3015 dbSNP
rs974387838 3036 dbSNP
rs1231217112 3038 dbSNP
rs975485942 3044 dbSNP
rs920904856 3045 dbSNP
rs781309366 3047 dbSNP
rs1044518 3048 dbSNP
rs986543324 3050 dbSNP
rs1325689639 3051 dbSNP
rs913633355 3056 dbSNP
rs1436302987 3057 dbSNP
rs921155101 3062 dbSNP
rs932562381 3066 dbSNP
rs1050861321 3068 dbSNP
rs1304771237 3072 dbSNP
rs1186227538 3093 dbSNP
rs1426447956 3101 dbSNP
rs912408702 3104 dbSNP
rs945114393 3109 dbSNP
rs540759114 3112 dbSNP
rs1415681103 3113 dbSNP
rs1223508149 3119 dbSNP
rs946245971 3120 dbSNP
rs1374458219 3121 dbSNP
rs760942305 3124 dbSNP
rs1274430875 3130 dbSNP
rs1279809722 3132 dbSNP
rs1307745018 3133 dbSNP
rs1000503252 3139 dbSNP
rs1055201391 3144 dbSNP
rs1041858909 3147 dbSNP
rs1269675518 3148 dbSNP
rs926212306 3155 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||:| |||  ||||||| 
Target 5' ggaAAAUC-UUA--UGCUGCUc 3'
12 - 30
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000474295.1 | 3UTR | UCACAGGGCACGGAAAAUCUUAUGCUGCUCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*