miRTarBase - #MIRT066312 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol USP15   
Synonyms UNPH-2, UNPH4
Description ubiquitin specific peptidase 15
Transcript NM_006313   
Expression
Putative miRNA Targets on USP15
3'UTR of USP15
(miRNA target sites are highlighted)
>USP15|NM_006313|3'UTR
   1 TGAAAGTCCTAGAAGCCATAAAAGAGACACTTTCCTGCTGGTGGTATCTATGGAAATGATGAAGTTACCCACCACATTAA
  81 AACAAAAGTCTGAGATGGGGAGTTTCAGATAACCGAATGTAAATCCTTTATCAGATTTTAACTTGTGCAGTACTTGAAGT
 161 GAAACACAATGAAAACTTTAACAGAAATTGTCTCTTAATACATTTACAGTCTTGTATTTACAAGCTAAATATATATAGGA
 241 AATCACAAATAAATCCCTTTTAAGTTTGCTGCTGTTTTGATTAATTATGTTTCCTTTAATTTTTTGGATGTGAGTTGATG
 321 ACAAATGTTAAATTTGTGGATGTTGGTCATTTATTTTGCTCTAATAATACTGCAAGAAAACTATGGCTGAACTTAGTTTT
 401 TGGATAATCTAGTTCATGTGCATTAGGCTGCCGTATATACTACTATGATATTTAGCTGCAGTATCAATGTGGCATAAATA
 481 CTGCGGCAGCATTCTTCGAAAACCGCATTTTCAAATTTATCCCCGTAATCAATGTGGGCCTATTAAAAAACCAAATCATG
 561 ATACAAGAAACAACCTTGGAAAAGTTATTTCCCTTTGTAATACCTTTAAAAATCCAGAGTATTATATTCATTTTACTGCC
 641 ACTGTGGAAACAGGTTCTAGATTTCATACTCCATCTAAAGTCATTTTTCAGTTACATGTAAGTATTATTTACTGCTATTG
 721 GGATCTATTCTTCAGATATTCAAAAACATTTTTTGCTTTAAAATGCATATCTTTAATTGGGTGTTGGTCCAAAATTAAAA
 801 TTTTTGCTGTCTGTTTTTCTCTACCCCATTTTGTGGTAATTTGGCAACTTGAGCTCTCCCAATTATTGTAATATAAGGAC
 881 AGACATAATAGTATTCTGTACCCATAGTAATAATTGCATCAAGCTTAGATGAGAAATTTTTTTCATATACTGGCCTTTAA
 961 ATCATTAATGGACAATTGGCTATAAAGGTAGGTCTGTTAACTTTCTTTGTGTGTTCCTGATGGAATTCACCATAGCCTTA
1041 CAGCTTTTCTCAGAAGGTAACTTGTTATAAGAGAAATGGCATTTGCATGTTCCAGAGTCAGAACCTGTACAGTATATAAA
1121 GCATAAACACCTTGAATTTGATTTTAGTTCACCACATTCAAGGATCCAGGATGCCAAAAATATGTGTGAACATTTGAAAC
1201 ATTTTTATTTGCTGCTTTTTCCCTTTGATATAGTTGAAAGAATGTATTGTAAATTGGCATACAATACTGCCTTTAATAGA
1281 AAACCTAAATGCTGGGGCACATTTCACATATCGACTACCTGAGAAATTGCTTTGTGTCCCACTGTTATTAAAGCAAAAAG
1361 TATAATGTTCTTCACTTGAACTAATCAAATACAATAGATTATAAATTGTGTATTGTAAATAAAAGTTCACTCTGTGAGTG
1441 CACATTTTGGTAAATTATTTATTTATGTTAGCATTTAAAAGTTTAAAAAAAATGCATTTGACCAGGATAAATGAGGTATG
1521 TTGATCATGGCTTTGCTTTATATCTTGATATTAAAGCTGGTTTATCATCCTGGTATTTTAAAAGCTGCTTTGGGGTTTTT
1601 TTTTTCTTTTTTTTTTTTTTAATGTAAACTAACCTCCTGCATGACAGAGGTTAAAATTTTGTCTGCACTTGAGTTCACTT
1681 GAGTTTACATTTGAAATGTGCATGTTTATTTATATAGATTTCAATAAAGCTATTCAAGGCCTTATTTAGTCTTTTATTTC
1761 TTACTCTTAATCTTTTAATAAAAATCCCCTACTTTATGGTTAGATGACTATATGCTAGACTTTTTAGTTATAAATAGTTA
1841 ATACTAGAAAGGAAATTATGTCAGAGCAAAATGAATCCTACTATTAAGGACGTTTTAAAGTTGATTTTTGTCCACTTTAA
1921 TATTTATTCATTAAACATATGTTTGTGTACCAATCACTGTTGTAGAGTCTGGAGATACAGCAGTAAACAAATATCCTTAC
2001 CTTCACAGAGCTTACATTCTTTCTGCCATCTACCAACTAATGAACTATATTTCCATTTTTCTGAAGATTTAAAGAAAAGT
2081 CAAAGCTAAATCTTTTAAACCTATATTGTGGTCTCCATCCTAATTCTTCAGAGACCACTTTCTTTTTAATGCCTGTCATT
2161 AACTTCTGTTCCCACTAAAAGAAGTGATGTTAATAATGCCATTGAAACTGCCAAACTCAAATGTCATTTTTCAGCTGCAA
2241 GAAGTATACTTTAAAAATAGTGCAAAAGGATAATACATATTCTAATTAAAAGTAGGCATTCAGACTGGGCACGGTGGTTC
2321 ATGCCTGTAATCCCAGCACTTTGGGAGACTCAGGCGGGAGGATCACTTGAGCCCAGGAGTTTGAGACCAGCCTGAGTAAC
2401 ATAGTGAGAACCTCATCTGTACAAATATATGTATTTTTTTTTAATTAGCTGGGTGTGCACACACCTGTGTTCCCAGCTAC
2481 TGGGGAGGCTGAGGTGAGAGAATTGCTTGAGCCCAGGCAGTCAAGGCCGCAGTTAGCCGAAATCACACCCCTGCACTCCA
2561 GCCTGTGCAACATAGCAAGACTCTGTCTCAAAAAAAAAAAAGATATTCATAGGTAATACAGGGTAATGGGAATATATCTA
2641 GACTAGAATTTCTACTTCTAGCTTTGCCACTTAGCAATCATATGACTTTGAACTTAATCTTTGATAGTGTTTCTTTACCT
2721 GTAGAATAATGATGATAATAGCCAGCATTTATTGAGCACTTACTATGGACCAGGCACTATATTAAAGTGTTTATATGCAT
2801 TCTCTCATTTAATCCCACAACAGCTATGAGGTAGGGATAGTTGTCATCCCCATTTTTCATATGAAGAAACCAAGATACAA
2881 AGCATTTAAGTAATATTCCCAAGCTCACACAATTGCTATGGGGTAGAGCCAATATTCTATCCTCAGATATATACTACCTC
2961 TCACTGTGTTATAGTGTCTGCCTCATAGGATTGTTGAGAGCTCAAATGAGATCATGTATTTTATGGGAAGAGCTTTGTAA
3041 ACTTTATTACACACTCACTGATTTCTTCAGTCTAAATAGAAAGACATCTTGAAGTCTAATAACTTTGCTTCTAAAAGTAT
3121 ATTTAGCTCAGTATTCGAGCATTGAATAAGAAAGTACCCACTGGAATATTGACTAACCCATTCCCTTTTAAAAATTAATT
3201 TCATTTAATTTATATACCTTTATTACAATTTTAATTAAATGGTAAATACAATGTGACATTTTTTTCTTACCTTTTCATCT
3281 AACTTGTGTCCCCTTCTTTCCATTTCCCCAAATGCAACCCTGAATTTCAGGACTTTGTAAACTCTACTCTAGTTTTGCTT
3361 TCTGTTTGTTTGTTTGTTTGTTTAGAGACAAGGTCTCCCTCTGTCGCCCAGGCTGGAGTGCAGTGACATAATCATAGTTC
3441 ACTGTAACCTTGAACTCCTGGGTTAAAGTGATCCTCCTGCCTCAGCCTTATAATTTAGTTTTAATTAACCTCCTTGAAAA
3521 AGTTGCAGCCTGGTGCTTTATTTAAATATCTTGCTTTCTCATAATCTGTGTTATTTTAGTAGTCCTGTATTTATCCTTGC
3601 TTTCCTGACAACTGGATATAAAACTACACAAAACATTGATTTGGGCACAAAGAAAATCAGTAAGTACCAAAATAGATACA
3681 ACATAAAGGTGGTGGGGTTTTTTATGAACTAATTTGATTGAAGTGAGTTTATCTTATAAAATAAGCCGGGAGACTGAAAT
3761 GGAGTCTCCTTCAGTGGTACACCAAAGGGAGTGTAGGGTGTAGTAGGAGCTCTCTGCCTCCGAGAGGAGGAATATATTAG
3841 ACTGATAACGTTTAAGTCTGATGTATGGTGACAAGAAAAAGGCCAATTTTTTGTTTTGTTATTTTTAAGTTACCTACAGA
3921 TAATGCATTTCATTATTGCCTACTTCCAACTCTCCCTATGTAGTATGTTTCTGATCTTCTGTGCTTGTGCAGTGTAGATG
4001 AGCTCACCGCTTTAATTTTTAAGATAGAAATGTGGAAAACTCTTGAATCATAGACTAGGGGAAGGAACCAGAGGTCCTCT
4081 AAAATATCAGAGGAGTGAGAAGGAAAGGAAGAGCTCCTTTCTAGGGCCATAGAATAAGAGTAGAAGTTTTTGCTCATTTT
4161 TTTTGTTTGTTTTTACTTTACAAAAAAATAAAAAATTTTTTGCTCTTTGAATAACTTAACATGAGGAATTTGGAAACAAC
4241 CTCTCTTGAAAATATATTGGTATTCATTCCCAAATAATTCTTCTAAGTACCACTTGACCAGAGGATAGGGAAAGGAGGAA
4321 AAGGTGAGTGTATTTATATCCTTGCTAGTTTTTGTTATATATTCAGTTGCAGATCTATATTATATATCATTTTATTATCA
4401 GATTTTCTAGTGAGAAATATATATGATGGTTTTTTAATAATCATTTTAGGTTTGGAGGCCATTTCAATTCAATATGTATG
4481 TGTTTTACGTGTTTAATTCGTATTTACTATATATTAAAAGAATTTCCAAATAGCTCAGATAAGAAAACTTTGGTTTAAAA
4561 TTGAGTTATTTTATAAGCTACATAGAATACATCAAAATTTTATAAGCTGCATAGAATAGGCTTTAAAATATCAGAATTAG
4641 GAAAATAAAATATAGATGGTAAAAATTCAAATATTTATCAAGACTTTTTTCTTCACTAATGATGGGGTAAAGAATTTTTA
4721 AATGGATAATATAAAACAGACAGTTCAAAAATTATTTTTGGAAAATATATGCATCGGGAAACATACCCCACACGGTGCCA
4801 TGGTTTAATTATTCCCCAGCTCTACTTTTGGGAGCCTGGAACTTGTCAGGGTTGTGAAATAGATCTCAGACTATTAAGGA
4881 CATTCAGAAACTGGCTAAGCCATTCAAGGAAAATCAGGAATTTACGTAATATATTGGACTACAGTCTCAAAGGACAGAGA
4961 GAAAATCAGTCAAATGGGTTTTGATATTTTTTTTTCCTAGAAATGTGTAGCAAATGTGATTTTACAAAGCAGCTAAAAAT
5041 ACAACTATCTCTCTGGAATTGAAAATGTGTAAAATAAGACCACACACTTTCAATATGCACAAAATATATTTTAAATGTTT
5121 AAGTTGTATTGGTAATTTACTATGTTCTCCTGTAGAAAATCATAATTAAAGTTGGTGCTCGTGTTGCTAAAGTTTTTTTT
5201 CTCATGTCAGGAACTTGCAGCTTGTTCTATATAGTTTGGTGAAACAAACAAAACAGTTTTTATCTGCTGTGACATTTAAG
5281 TTTGTTGTTAGCTGGAGTTAAATCTACATACATAAAAGTAAAACAATAAATATGGAAACATCCCAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUG--GUAAUACACGACGAu 5'
             ||||  : |||| ||||||| 
Target 5' ttgAAACATTTTTATTTGCTGCTt 3'
1194 - 1217 165.00 -12.80
2
miRNA  3' guGUUU--GGUAA---UACACGACGAu 5'
            :|||  || ||   :| ||||||| 
Target 5' aaTAAATCCCTTTTAAGTTTGCTGCTg 3'
248 - 274 154.00 -11.90
3
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              || :||||| | ||||| 
Target 5' atgtAAGTATTATTTACTGCTa 3'
696 - 717 138.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN17076087 5 COSMIC
COSN30529382 19 COSMIC
COSN31552756 68 COSMIC
COSN31568583 115 COSMIC
COSN16130635 197 COSMIC
COSN23013684 199 COSMIC
COSN9567072 322 COSMIC
COSN31482221 390 COSMIC
COSN30543949 416 COSMIC
COSN23692422 544 COSMIC
COSN7377094 552 COSMIC
COSN5949062 737 COSMIC
COSN17076378 822 COSMIC
COSN21768067 863 COSMIC
COSN23378192 1035 COSMIC
COSN31484744 1102 COSMIC
COSN28754190 1260 COSMIC
COSN31487647 1267 COSMIC
COSN30544025 1330 COSMIC
COSN23854745 1379 COSMIC
COSN31490101 1394 COSMIC
COSN17038183 1416 COSMIC
COSN31548016 1461 COSMIC
COSN31609536 1486 COSMIC
COSN31534300 1493 COSMIC
COSN31544531 1519 COSMIC
COSN20092595 1584 COSMIC
COSN26601758 1596 COSMIC
COSN31536130 1606 COSMIC
COSN19658254 1607 COSMIC
COSN15663089 1608 COSMIC
COSN26419201 1880 COSMIC
COSN20964208 2209 COSMIC
COSN9567073 2213 COSMIC
COSN15855797 2374 COSMIC
COSN9753415 2445 COSMIC
COSN16724490 2603 COSMIC
COSN1150552 2759 COSMIC
COSN16223168 2780 COSMIC
COSN20995698 3012 COSMIC
COSN29375965 3312 COSMIC
COSN25015199 3699 COSMIC
COSN5949064 3766 COSMIC
COSN25899417 3773 COSMIC
COSN29236468 4718 COSMIC
COSN29843896 4723 COSMIC
COSN29185912 4930 COSMIC
COSN5718032 4932 COSMIC
COSN25481880 5191 COSMIC
COSN5718033 5708 COSMIC
COSN29752750 6047 COSMIC
COSN21865077 8065 COSMIC
COSN19510311 8453 COSMIC
COSN1150553 8506 COSMIC
COSN1579937 8570 COSMIC
COSN17655035 8902 COSMIC
COSN4730803 9237 COSMIC
COSN1150554 9370 COSMIC
COSN23391994 9555 COSMIC
COSN26443367 10215 COSMIC
COSN6536905 10215 COSMIC
COSN27191853 10459 COSMIC
COSN27371748 10459 COSMIC
COSN22284072 10482 COSMIC
COSN18858816 10598 COSMIC
COSN28277618 10610 COSMIC
COSN18758322 10632 COSMIC
COSN18858817 10639 COSMIC
COSN23807714 10769 COSMIC
COSN1150555 10830 COSMIC
COSN16191140 11939 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs138462391 1 dbSNP
rs769774382 3 dbSNP
rs773697677 7 dbSNP
rs763360166 8 dbSNP
rs1448414679 9 dbSNP
rs771485750 10 dbSNP
rs763695002 11 dbSNP
rs200560588 13 dbSNP
rs1487879687 15 dbSNP
rs1286019756 16 dbSNP
rs1313896506 19 dbSNP
rs761330711 21 dbSNP
rs1243289805 22 dbSNP
rs764659739 23 dbSNP
rs1004402893 25 dbSNP
rs765867746 31 dbSNP
rs1340122845 32 dbSNP
rs1289191859 35 dbSNP
rs1200679137 39 dbSNP
rs750017498 40 dbSNP
rs758259570 45 dbSNP
rs766477857 51 dbSNP
rs11559219 74 dbSNP
rs774195268 75 dbSNP
rs8291 78 dbSNP
rs1017490912 80 dbSNP
rs898755433 89 dbSNP
rs551681312 99 dbSNP
rs550571838 100 dbSNP
rs1390115669 101 dbSNP
rs1001081070 115 dbSNP
rs1422085855 116 dbSNP
rs748220553 119 dbSNP
rs1028359645 127 dbSNP
rs1230527582 129 dbSNP
rs561251546 131 dbSNP
rs892450668 135 dbSNP
rs1296045328 139 dbSNP
rs1009553351 155 dbSNP
rs15106 168 dbSNP
rs1196307450 193 dbSNP
rs1340920268 201 dbSNP
rs1025509939 203 dbSNP
rs1263294474 209 dbSNP
rs1228470189 213 dbSNP
rs772218824 214 dbSNP
rs547617543 221 dbSNP
rs1285307608 227 dbSNP
rs1031737132 229 dbSNP
rs1003159568 243 dbSNP
rs1208929698 247 dbSNP
rs1253957921 247 dbSNP
rs567352213 260 dbSNP
rs956096633 261 dbSNP
rs1345066727 269 dbSNP
rs1279041751 278 dbSNP
rs780315120 279 dbSNP
rs1338501779 280 dbSNP
rs1484073874 281 dbSNP
rs958628144 282 dbSNP
rs1298135161 287 dbSNP
rs1184769601 300 dbSNP
rs1404834989 301 dbSNP
rs1171132451 306 dbSNP
rs1247317792 312 dbSNP
rs973937047 314 dbSNP
rs1026839296 318 dbSNP
rs951079105 331 dbSNP
rs982459428 337 dbSNP
rs773267586 342 dbSNP
rs61921870 343 dbSNP
rs915021570 346 dbSNP
rs943761027 347 dbSNP
rs1392044986 355 dbSNP
rs199949518 359 dbSNP
rs1188172028 363 dbSNP
rs1444029208 366 dbSNP
rs1253845085 370 dbSNP
rs975992478 384 dbSNP
rs1199711710 397 dbSNP
rs3825301 403 dbSNP
rs1220631946 413 dbSNP
rs1316146465 418 dbSNP
rs1175539593 423 dbSNP
rs936927155 429 dbSNP
rs1054065144 434 dbSNP
rs981086750 436 dbSNP
rs1319196731 441 dbSNP
rs760955863 446 dbSNP
rs892711148 446 dbSNP
rs1332969028 451 dbSNP
rs1463675936 454 dbSNP
rs1365067525 458 dbSNP
rs945404715 466 dbSNP
rs926303685 467 dbSNP
rs1186735321 468 dbSNP
rs555856771 468 dbSNP
rs1046391733 469 dbSNP
rs906614236 473 dbSNP
rs1458055359 477 dbSNP
rs1239700435 479 dbSNP
rs183536208 485 dbSNP
rs1034163964 486 dbSNP
rs894335153 487 dbSNP
rs1228999514 490 dbSNP
rs1444564320 493 dbSNP
rs1358559931 498 dbSNP
rs79599984 505 dbSNP
rs755237772 506 dbSNP
rs1313786548 515 dbSNP
rs1378120135 523 dbSNP
rs558808704 525 dbSNP
rs374838170 526 dbSNP
rs1038538209 531 dbSNP
rs951325816 533 dbSNP
rs1190366205 543 dbSNP
rs1249981776 545 dbSNP
rs997137432 552 dbSNP
rs1190894061 569 dbSNP
rs572737191 576 dbSNP
rs1028514708 582 dbSNP
rs1416560206 584 dbSNP
rs1157447365 590 dbSNP
rs982855843 591 dbSNP
rs1176591712 596 dbSNP
rs1019240510 598 dbSNP
rs965517117 604 dbSNP
rs1232593672 605 dbSNP
rs1222574167 612 dbSNP
rs891355578 615 dbSNP
rs975137999 640 dbSNP
rs571131719 644 dbSNP
rs1458244460 647 dbSNP
rs1288755367 656 dbSNP
rs775343453 671 dbSNP
rs1238479450 679 dbSNP
rs1373035348 683 dbSNP
rs1275085292 684 dbSNP
rs1031601377 705 dbSNP
rs146768153 716 dbSNP
rs1328921055 718 dbSNP
rs989640561 728 dbSNP
rs1435098513 739 dbSNP
rs555097044 741 dbSNP
rs1369321244 748 dbSNP
rs574941507 750 dbSNP
rs968271856 752 dbSNP
rs540921909 761 dbSNP
rs543872888 767 dbSNP
rs980736071 768 dbSNP
rs563803435 770 dbSNP
rs1479108231 776 dbSNP
rs937990869 780 dbSNP
rs577297915 781 dbSNP
rs774314975 784 dbSNP
rs995337220 789 dbSNP
rs1210583354 790 dbSNP
rs1488640443 791 dbSNP
rs745379358 807 dbSNP
rs908168798 807 dbSNP
rs372331640 809 dbSNP
rs1449992177 810 dbSNP
rs546263886 814 dbSNP
rs887030339 821 dbSNP
rs1279733286 834 dbSNP
rs1247327282 837 dbSNP
rs1220618314 849 dbSNP
rs1481556124 855 dbSNP
rs1004102029 867 dbSNP
rs1282205539 869 dbSNP
rs1400146366 876 dbSNP
rs1019719530 881 dbSNP
rs1296283442 882 dbSNP
rs1411697686 885 dbSNP
rs1473120978 886 dbSNP
rs932832822 888 dbSNP
rs1359560563 889 dbSNP
rs1177908582 894 dbSNP
rs565175298 895 dbSNP
rs1049856879 896 dbSNP
rs965098304 904 dbSNP
rs553360890 905 dbSNP
rs1389165193 909 dbSNP
rs1028111908 915 dbSNP
rs1478196738 917 dbSNP
rs1192164514 927 dbSNP
rs1485798771 931 dbSNP
rs1238531746 934 dbSNP
rs1441040596 937 dbSNP
rs957772786 937 dbSNP
rs55766252 946 dbSNP
rs1262178461 947 dbSNP
rs527535744 949 dbSNP
rs1008396698 951 dbSNP
rs1474486820 958 dbSNP
rs1319399434 962 dbSNP
rs771541689 965 dbSNP
rs775079274 973 dbSNP
rs1323668690 974 dbSNP
rs1172947783 976 dbSNP
rs140413081 977 dbSNP
rs1351055023 980 dbSNP
rs1304482990 981 dbSNP
rs1445634291 982 dbSNP
rs1424343699 983 dbSNP
rs566873445 988 dbSNP
rs1407615609 991 dbSNP
rs891781080 992 dbSNP
rs760179099 1005 dbSNP
rs1168485191 1009 dbSNP
rs967383158 1010 dbSNP
rs1022107530 1012 dbSNP
rs970142082 1015 dbSNP
rs780883539 1040 dbSNP
rs1307017166 1042 dbSNP
rs982408530 1044 dbSNP
rs763995463 1048 dbSNP
rs1229982799 1061 dbSNP
rs1198922951 1065 dbSNP
rs1458783751 1067 dbSNP
rs928193033 1068 dbSNP
rs1203258693 1071 dbSNP
rs1355597907 1072 dbSNP
rs1321790868 1073 dbSNP
rs938059060 1078 dbSNP
rs561104817 1080 dbSNP
rs1381806113 1086 dbSNP
rs1309652545 1088 dbSNP
rs1448690098 1105 dbSNP
rs763838581 1111 dbSNP
rs1402777057 1115 dbSNP
rs1296660338 1124 dbSNP
rs1055044612 1132 dbSNP
rs1350479993 1136 dbSNP
rs188647351 1137 dbSNP
rs1490842404 1142 dbSNP
rs1385034152 1148 dbSNP
rs1179713515 1156 dbSNP
rs930692337 1165 dbSNP
rs1441896549 1167 dbSNP
rs960616160 1170 dbSNP
rs1203364423 1175 dbSNP
rs1488530258 1184 dbSNP
rs1048226767 1185 dbSNP
rs886925519 1189 dbSNP
rs1358703715 1194 dbSNP
rs1004437404 1196 dbSNP
rs908230825 1198 dbSNP
rs1374362837 1201 dbSNP
rs1184463744 1202 dbSNP
rs1390975039 1206 dbSNP
rs1367035245 1210 dbSNP
rs1295319226 1212 dbSNP
rs961316517 1224 dbSNP
rs1365553606 1231 dbSNP
rs1159779745 1232 dbSNP
rs973741278 1245 dbSNP
rs11174462 1247 dbSNP
rs932387339 1253 dbSNP
rs1164272446 1254 dbSNP
rs1049889446 1258 dbSNP
rs1433358047 1261 dbSNP
rs901079070 1265 dbSNP
rs996554667 1269 dbSNP
rs1196701483 1273 dbSNP
rs1490041346 1279 dbSNP
rs35504082 1279 dbSNP
rs1263884288 1281 dbSNP
rs1218624557 1284 dbSNP
rs1296725836 1284 dbSNP
rs1348277313 1289 dbSNP
rs1415412987 1290 dbSNP
rs1027954699 1294 dbSNP
rs957782708 1298 dbSNP
rs762315061 1300 dbSNP
rs1238635320 1301 dbSNP
rs944329223 1304 dbSNP
rs1167624517 1306 dbSNP
rs767435828 1307 dbSNP
rs1303645062 1309 dbSNP
rs1403255987 1310 dbSNP
rs765807020 1311 dbSNP
rs891816125 1313 dbSNP
rs1402328649 1314 dbSNP
rs569446479 1320 dbSNP
rs1383286653 1331 dbSNP
rs1012008073 1342 dbSNP
rs1466846533 1346 dbSNP
rs538238596 1349 dbSNP
rs1173794177 1357 dbSNP
rs1411235317 1366 dbSNP
rs1423636957 1381 dbSNP
rs966932745 1382 dbSNP
rs1339593619 1390 dbSNP
rs1445163945 1394 dbSNP
rs751033854 1395 dbSNP
rs1001579753 1396 dbSNP
rs1200868433 1399 dbSNP
rs1448677245 1400 dbSNP
rs1033552300 1406 dbSNP
rs1265296321 1410 dbSNP
rs896306844 1415 dbSNP
rs1285880586 1427 dbSNP
rs1361754817 1435 dbSNP
rs1278866957 1442 dbSNP
rs1220518645 1444 dbSNP
rs982679447 1454 dbSNP
rs1325240372 1455 dbSNP
rs1226248614 1469 dbSNP
rs1397032557 1472 dbSNP
rs1273959410 1474 dbSNP
rs928276148 1480 dbSNP
rs959574700 1482 dbSNP
rs1015946439 1485 dbSNP
rs961291029 1485 dbSNP
rs551800542 1486 dbSNP
rs1372503146 1488 dbSNP
rs1026613784 1494 dbSNP
rs1442200450 1501 dbSNP
rs1240970078 1517 dbSNP
rs565540601 1522 dbSNP
rs769614041 1531 dbSNP
rs930744682 1532 dbSNP
rs1258917724 1546 dbSNP
rs576189633 1547 dbSNP
rs1337515903 1550 dbSNP
rs1397605488 1552 dbSNP
rs1270138353 1554 dbSNP
rs1246079343 1561 dbSNP
rs555866052 1561 dbSNP
rs1385473719 1563 dbSNP
rs756715809 1574 dbSNP
rs1208443721 1582 dbSNP
rs1167455215 1586 dbSNP
rs1400632319 1589 dbSNP
rs953838356 1595 dbSNP
rs1407772171 1596 dbSNP
rs535282428 1596 dbSNP
rs985170697 1596 dbSNP
rs912757390 1597 dbSNP
rs1182799357 1598 dbSNP
rs1440071186 1599 dbSNP
rs944189348 1602 dbSNP
rs939906406 1605 dbSNP
rs373301417 1606 dbSNP
rs115374030 1607 dbSNP
rs375651843 1607 dbSNP
rs776795596 1607 dbSNP
rs1170376886 1609 dbSNP
rs1362284026 1610 dbSNP
rs796285568 1612 dbSNP
rs1041275867 1613 dbSNP
rs1280941940 1614 dbSNP
rs1336144969 1621 dbSNP
rs1439487678 1621 dbSNP
rs1362981753 1622 dbSNP
rs1434214162 1625 dbSNP
rs758489445 1627 dbSNP
rs1425969023 1651 dbSNP
rs1363707844 1655 dbSNP
rs1162835973 1660 dbSNP
rs1420094973 1662 dbSNP
rs947631009 1672 dbSNP
rs1160542386 1688 dbSNP
rs554977630 1690 dbSNP
rs901093388 1692 dbSNP
rs1232493875 1703 dbSNP
rs1043453663 1709 dbSNP
rs1490860761 1715 dbSNP
rs1267457580 1725 dbSNP
rs1222324318 1730 dbSNP
rs1354873353 1737 dbSNP
rs996732008 1742 dbSNP
rs192958208 1752 dbSNP
rs1286735310 1759 dbSNP
rs1296980876 1761 dbSNP
rs1049436651 1762 dbSNP
rs893499401 1763 dbSNP
rs558705853 1786 dbSNP
rs937443407 1789 dbSNP
rs1343028358 1793 dbSNP
rs1302471040 1801 dbSNP
rs1400488210 1809 dbSNP
rs1010562581 1819 dbSNP
rs537678301 1824 dbSNP
rs1316017589 1847 dbSNP
rs1399867434 1859 dbSNP
rs1231335913 1860 dbSNP
rs1407622262 1862 dbSNP
rs1173368018 1864 dbSNP
rs11174463 1865 dbSNP
rs1481470004 1872 dbSNP
rs879863511 1880 dbSNP
rs1201353543 1881 dbSNP
rs879274224 1884 dbSNP
rs557483739 1888 dbSNP
rs1244316931 1892 dbSNP
rs879713814 1893 dbSNP
rs1446771190 1894 dbSNP
rs1013437746 1904 dbSNP
rs577464486 1905 dbSNP
rs1003715909 1909 dbSNP
rs1429772136 1918 dbSNP
rs184815265 1925 dbSNP
rs1364035481 1930 dbSNP
rs559659467 1933 dbSNP
rs897064363 1937 dbSNP
rs995431605 1938 dbSNP
rs1027098744 1941 dbSNP
rs953698707 1944 dbSNP
rs1471056061 1947 dbSNP
rs985201858 1948 dbSNP
rs1376695855 1959 dbSNP
rs1429192836 1963 dbSNP
rs1478257651 1977 dbSNP
rs1185229361 1994 dbSNP
rs1475293937 1995 dbSNP
rs959626782 2007 dbSNP
rs1205196383 2010 dbSNP
rs559041340 2010 dbSNP
rs1262086103 2017 dbSNP
rs1198801814 2020 dbSNP
rs991006510 2021 dbSNP
rs965071919 2029 dbSNP
rs188030802 2034 dbSNP
rs1379668036 2043 dbSNP
rs541292499 2044 dbSNP
rs113079011 2061 dbSNP
rs1389544056 2062 dbSNP
rs1380909646 2068 dbSNP
rs1336302453 2071 dbSNP
rs543575762 2072 dbSNP
rs1299511508 2082 dbSNP
rs781447088 2084 dbSNP
rs1168987640 2091 dbSNP
rs1409846614 2095 dbSNP
rs944750235 2104 dbSNP
rs1706485 2110 dbSNP
rs976621791 2121 dbSNP
rs1443155759 2132 dbSNP
rs1330778541 2141 dbSNP
rs183625759 2147 dbSNP
rs1481331436 2154 dbSNP
rs1249076092 2169 dbSNP
rs1285602729 2172 dbSNP
rs143536843 2178 dbSNP
rs563037377 2179 dbSNP
rs937343619 2180 dbSNP
rs76921390 2185 dbSNP
rs1243570201 2187 dbSNP
rs1057125650 2210 dbSNP
rs7133294 2212 dbSNP
rs1392135813 2214 dbSNP
rs1208724266 2222 dbSNP
rs1375646522 2227 dbSNP
rs1296573894 2231 dbSNP
rs1441525785 2235 dbSNP
rs940714544 2236 dbSNP
rs1269306480 2242 dbSNP
rs1486591243 2250 dbSNP
rs893720101 2253 dbSNP
rs1166006946 2258 dbSNP
rs1423145518 2264 dbSNP
rs1384930167 2275 dbSNP
rs1037310030 2277 dbSNP
rs896977123 2281 dbSNP
rs188322020 2289 dbSNP
rs1265996390 2292 dbSNP
rs376533478 2293 dbSNP
rs1220071108 2294 dbSNP
rs551862282 2313 dbSNP
rs778810123 2314 dbSNP
rs1240891578 2315 dbSNP
rs1318995694 2318 dbSNP
rs902266338 2335 dbSNP
rs1305126912 2336 dbSNP
rs745749095 2355 dbSNP
rs1006526687 2356 dbSNP
rs1346170152 2357 dbSNP
rs1305495111 2362 dbSNP
rs1003674048 2373 dbSNP
rs1403596470 2380 dbSNP
rs1035210893 2390 dbSNP
rs369352532 2392 dbSNP
rs796913234 2400 dbSNP
rs1455646628 2402 dbSNP
rs1019207180 2420 dbSNP
rs1480479201 2428 dbSNP
rs1430736184 2430 dbSNP
rs373729342 2431 dbSNP
rs1009986959 2434 dbSNP
rs565634099 2434 dbSNP
rs965103490 2434 dbSNP
rs74408690 2435 dbSNP
rs1020905926 2437 dbSNP
rs1012358748 2438 dbSNP
rs968901635 2442 dbSNP
rs528105044 2443 dbSNP
rs927543621 2452 dbSNP
rs952296202 2453 dbSNP
rs1365433188 2458 dbSNP
rs983476072 2458 dbSNP
rs1201413768 2460 dbSNP
rs958909274 2473 dbSNP
rs36016511 2482 dbSNP
rs1291887142 2490 dbSNP
rs992829306 2491 dbSNP
rs779637209 2496 dbSNP
rs1287952817 2500 dbSNP
rs1469949507 2513 dbSNP
rs1015306165 2516 dbSNP
rs1407812272 2519 dbSNP
rs1257209635 2522 dbSNP
rs1405790240 2524 dbSNP
rs1173684796 2525 dbSNP
rs772051251 2529 dbSNP
rs976550427 2530 dbSNP
rs1349082314 2533 dbSNP
rs921997761 2539 dbSNP
rs543902266 2540 dbSNP
rs918436717 2543 dbSNP
rs1319286230 2545 dbSNP
rs974661263 2548 dbSNP
rs1461973602 2549 dbSNP
rs1243177942 2551 dbSNP
rs749643003 2552 dbSNP
rs931183039 2555 dbSNP
rs923202522 2558 dbSNP
rs1488519260 2560 dbSNP
rs548850650 2565 dbSNP
rs915163449 2571 dbSNP
rs755445565 2581 dbSNP
rs1249129712 2586 dbSNP
rs1230206133 2588 dbSNP
rs1006724247 2590 dbSNP
rs1484980872 2590 dbSNP
rs79855870 2590 dbSNP
rs79382974 2591 dbSNP
rs1482628200 2598 dbSNP
rs1334268664 2601 dbSNP
rs779393357 2604 dbSNP
rs151253164 2607 dbSNP
rs1040726793 2614 dbSNP
rs1460359155 2618 dbSNP
rs779517782 2623 dbSNP
rs1372407789 2624 dbSNP
rs946589439 2630 dbSNP
rs1184019135 2632 dbSNP
rs1446227061 2633 dbSNP
rs1042066331 2635 dbSNP
rs900839476 2643 dbSNP
rs537641520 2645 dbSNP
rs1251269603 2647 dbSNP
rs1010430843 2655 dbSNP
rs1338056908 2659 dbSNP
rs1422004436 2661 dbSNP
rs1247245669 2670 dbSNP
rs1361964189 2677 dbSNP
rs1163911585 2679 dbSNP
rs746551076 2680 dbSNP
rs1446781958 2683 dbSNP
rs1335858342 2693 dbSNP
rs1368041632 2699 dbSNP
rs1389143613 2700 dbSNP
rs768171172 2704 dbSNP
rs557542510 2705 dbSNP
rs968844418 2718 dbSNP
rs1165760487 2729 dbSNP
rs1368916618 2733 dbSNP
rs1409400311 2735 dbSNP
rs1299112663 2740 dbSNP
rs1472617787 2741 dbSNP
rs1000375722 2745 dbSNP
rs1034477145 2752 dbSNP
rs1312617293 2756 dbSNP
rs958980463 2757 dbSNP
rs1359590008 2762 dbSNP
rs1251743877 2763 dbSNP
rs140478761 2765 dbSNP
rs539907854 2766 dbSNP
rs1012409767 2772 dbSNP
rs1350997003 2775 dbSNP
rs1049182337 2776 dbSNP
rs888038732 2780 dbSNP
rs1236332359 2790 dbSNP
rs962049563 2794 dbSNP
rs1303696535 2800 dbSNP
rs1406639222 2801 dbSNP
rs1205361133 2805 dbSNP
rs1363611135 2815 dbSNP
rs553215455 2816 dbSNP
rs1234401294 2822 dbSNP
rs972453482 2825 dbSNP
rs1014944283 2827 dbSNP
rs1409061046 2829 dbSNP
rs377437948 2832 dbSNP
rs966464380 2835 dbSNP
rs997517696 2842 dbSNP
rs1029121385 2851 dbSNP
rs1411276981 2853 dbSNP
rs1200811559 2863 dbSNP
rs1481735268 2866 dbSNP
rs1482153451 2872 dbSNP
rs1181271320 2873 dbSNP
rs1447929671 2880 dbSNP
rs573168473 2897 dbSNP
rs181873688 2911 dbSNP
rs1327887243 2918 dbSNP
rs942654809 2920 dbSNP
rs915046848 2929 dbSNP
rs773723065 2930 dbSNP
rs1274166547 2933 dbSNP
rs554838651 2934 dbSNP
rs574439398 2940 dbSNP
rs1431217662 2951 dbSNP
rs376832815 2952 dbSNP
rs543313383 2957 dbSNP
rs1455797956 2963 dbSNP
rs1171389834 2973 dbSNP
rs1177295446 2977 dbSNP
rs200062489 2977 dbSNP
rs939051000 2979 dbSNP
rs1056057197 2982 dbSNP
rs1191069398 2985 dbSNP
rs1475950083 2985 dbSNP
rs1244157015 2987 dbSNP
rs1191453370 2990 dbSNP
rs1000349691 2991 dbSNP
rs1263365313 2994 dbSNP
rs1464839130 2996 dbSNP
rs1047586238 2997 dbSNP
rs916334877 3005 dbSNP
rs1320725177 3007 dbSNP
rs1384220870 3011 dbSNP
rs1277835882 3014 dbSNP
rs1215044812 3015 dbSNP
rs563099636 3020 dbSNP
rs1455001296 3025 dbSNP
rs1363840571 3027 dbSNP
rs370180118 3028 dbSNP
rs1268250997 3030 dbSNP
rs1294789266 3033 dbSNP
rs947774583 3044 dbSNP
rs185675335 3048 dbSNP
rs894632394 3051 dbSNP
rs1471007341 3053 dbSNP
rs558922138 3055 dbSNP
rs1274664467 3057 dbSNP
rs1410973858 3062 dbSNP
rs1310272103 3070 dbSNP
rs887921703 3072 dbSNP
rs766935370 3076 dbSNP
rs1209125960 3078 dbSNP
rs1256331174 3079 dbSNP
rs1243389325 3089 dbSNP
rs1184980316 3091 dbSNP
rs1477574425 3091 dbSNP
rs1024578998 3104 dbSNP
rs1204581393 3104 dbSNP
rs74770687 3104 dbSNP
rs962582017 3107 dbSNP
rs972100629 3110 dbSNP
rs1227468989 3114 dbSNP
rs1037055093 3122 dbSNP
rs545853371 3128 dbSNP
rs751573226 3134 dbSNP
rs559219775 3137 dbSNP
rs997518863 3142 dbSNP
rs1443009592 3143 dbSNP
rs942518528 3145 dbSNP
rs1246333477 3148 dbSNP
rs976526206 3148 dbSNP
rs1429515433 3152 dbSNP
rs922552220 3155 dbSNP
rs1168381027 3157 dbSNP
rs759704149 3158 dbSNP
rs1448925789 3159 dbSNP
rs1187377834 3164 dbSNP
rs1412581944 3165 dbSNP
rs1177348134 3170 dbSNP
rs1481321675 3174 dbSNP
rs945913953 3176 dbSNP
rs1028963831 3178 dbSNP
rs528082278 3179 dbSNP
rs1421872487 3190 dbSNP
rs1431611868 3195 dbSNP
rs1293615888 3196 dbSNP
rs1175822105 3217 dbSNP
rs1243474894 3217 dbSNP
rs904177679 3218 dbSNP
rs953454163 3219 dbSNP
rs1011643400 3220 dbSNP
rs1306750349 3221 dbSNP
rs1021697849 3223 dbSNP
rs1319128514 3229 dbSNP
rs1366709729 3236 dbSNP
rs894203814 3239 dbSNP
rs1456710697 3248 dbSNP
rs1349004786 3252 dbSNP
rs1159307410 3258 dbSNP
rs12818222 3259 dbSNP
rs977945705 3260 dbSNP
rs1430799198 3266 dbSNP
rs1271611583 3267 dbSNP
rs1480753757 3270 dbSNP
rs747118078 3271 dbSNP
rs1218229769 3272 dbSNP
rs771182220 3274 dbSNP
rs1024862349 3277 dbSNP
rs138261385 3278 dbSNP
rs994155434 3279 dbSNP
rs1216718331 3284 dbSNP
rs117691132 3287 dbSNP
rs952129321 3292 dbSNP
rs530539191 3293 dbSNP
rs571030656 3303 dbSNP
rs1285737125 3309 dbSNP
rs1385468666 3312 dbSNP
rs1017662651 3320 dbSNP
rs966065764 3321 dbSNP
rs916220081 3329 dbSNP
rs947826482 3330 dbSNP
rs1216624351 3334 dbSNP
rs1385968769 3334 dbSNP
rs1243866586 3341 dbSNP
rs1469852290 3343 dbSNP
rs1431366027 3348 dbSNP
rs976557471 3352 dbSNP
rs1048820465 3358 dbSNP
rs1432414196 3361 dbSNP
rs1266469714 3363 dbSNP
rs1324300554 3363 dbSNP
rs201244192 3363 dbSNP
rs35916086 3363 dbSNP
rs763905954 3363 dbSNP
rs765318071 3363 dbSNP
rs908949061 3369 dbSNP
rs1487634158 3380 dbSNP
rs1258292198 3383 dbSNP
rs940894970 3384 dbSNP
rs549435218 3387 dbSNP
rs1330909901 3390 dbSNP
rs1296809534 3396 dbSNP
rs1036493391 3407 dbSNP
rs1319396873 3411 dbSNP
rs902099829 3418 dbSNP
rs933530528 3425 dbSNP
rs1452729986 3427 dbSNP
rs540067894 3429 dbSNP
rs1170765789 3437 dbSNP
rs977727456 3446 dbSNP
rs1430519415 3451 dbSNP
rs1447420874 3455 dbSNP
rs925663915 3456 dbSNP
rs79754992 3458 dbSNP
rs1055437498 3462 dbSNP
rs1461853793 3467 dbSNP
rs1011568400 3469 dbSNP
rs1022159819 3473 dbSNP
rs1401755039 3476 dbSNP
rs867433595 3480 dbSNP
rs903266811 3490 dbSNP
rs1045940155 3500 dbSNP
rs377426171 3503 dbSNP
rs1319744343 3507 dbSNP
rs190181976 3510 dbSNP
rs1435394374 3512 dbSNP
rs535835735 3514 dbSNP
rs1303364742 3518 dbSNP
rs1381213973 3524 dbSNP
rs993795045 3525 dbSNP
rs1049761021 3526 dbSNP
rs1347221137 3530 dbSNP
rs142587820 3545 dbSNP
rs1287437826 3550 dbSNP
rs575243255 3553 dbSNP
rs543278623 3554 dbSNP
rs1299756639 3555 dbSNP
rs992015240 3556 dbSNP
rs1351333898 3559 dbSNP
rs1023490370 3566 dbSNP
rs758218843 3568 dbSNP
rs984417713 3574 dbSNP
rs908958294 3611 dbSNP
rs1168225421 3612 dbSNP
rs1445524443 3616 dbSNP
rs1370389319 3618 dbSNP
rs1286433228 3620 dbSNP
rs1319997907 3636 dbSNP
rs1222105113 3644 dbSNP
rs1269846536 3659 dbSNP
rs1482290138 3661 dbSNP
rs966137101 3663 dbSNP
rs1247132222 3671 dbSNP
rs940417080 3674 dbSNP
rs972654666 3675 dbSNP
rs923438201 3681 dbSNP
rs1180511041 3682 dbSNP
rs1282051381 3686 dbSNP
rs1251487368 3693 dbSNP
rs933455458 3695 dbSNP
rs1050692707 3699 dbSNP
rs1290173540 3704 dbSNP
rs1470807099 3704 dbSNP
rs1407869214 3705 dbSNP
rs370837467 3707 dbSNP
rs889361581 3716 dbSNP
rs1369852872 3719 dbSNP
rs947410539 3720 dbSNP
rs1160731619 3723 dbSNP
rs1411066327 3736 dbSNP
rs1393226075 3740 dbSNP
rs1043024476 3744 dbSNP
rs112127529 3748 dbSNP
rs1364404006 3749 dbSNP
rs1184408483 3751 dbSNP
rs1471918786 3753 dbSNP
rs998923980 3757 dbSNP
rs780088128 3762 dbSNP
rs896347341 3767 dbSNP
rs1453626717 3768 dbSNP
rs375357116 3769 dbSNP
rs571064887 3770 dbSNP
rs1013360588 3780 dbSNP
rs139308209 3798 dbSNP
rs1336057102 3800 dbSNP
rs143320919 3804 dbSNP
rs1349871231 3811 dbSNP
rs1282347615 3812 dbSNP
rs984870018 3813 dbSNP
rs1015902726 3821 dbSNP
rs370531496 3822 dbSNP
rs1245304414 3823 dbSNP
rs1329094683 3826 dbSNP
rs1321851230 3830 dbSNP
rs1389614559 3832 dbSNP
rs1405037832 3832 dbSNP
rs971861552 3833 dbSNP
rs1045878796 3837 dbSNP
rs1455698489 3844 dbSNP
rs922998306 3850 dbSNP
rs933507926 3851 dbSNP
rs373965401 3860 dbSNP
rs1361892253 3863 dbSNP
rs1203216350 3864 dbSNP
rs986294270 3866 dbSNP
rs1272749868 3867 dbSNP
rs910811180 3875 dbSNP
rs1206350576 3876 dbSNP
rs547358344 3881 dbSNP
rs1043466531 3882 dbSNP
rs888032136 3887 dbSNP
rs1007762893 3894 dbSNP
rs1039043917 3897 dbSNP
rs924613359 3898 dbSNP
rs901837059 3902 dbSNP
rs934640654 3905 dbSNP
rs528127342 3920 dbSNP
rs541921136 3921 dbSNP
rs1386495742 3937 dbSNP
rs966787434 3941 dbSNP
rs1427424345 3945 dbSNP
rs1177454966 3949 dbSNP
rs11174464 3950 dbSNP
rs11454397 3953 dbSNP
rs397959632 3953 dbSNP
rs201918018 3955 dbSNP
rs1475940507 3957 dbSNP
rs1044842334 3959 dbSNP
rs1186231640 3964 dbSNP
rs1411430479 3975 dbSNP
rs549130985 3978 dbSNP
rs367752993 3981 dbSNP
rs1243268924 3987 dbSNP
rs371713306 3992 dbSNP
rs530545462 3994 dbSNP
rs1440693755 4004 dbSNP
rs991398485 4009 dbSNP
rs780975920 4010 dbSNP
rs1453225216 4015 dbSNP
rs971034055 4016 dbSNP
rs981108186 4024 dbSNP
rs1315838781 4026 dbSNP
rs919015298 4027 dbSNP
rs1385001080 4041 dbSNP
rs929037170 4048 dbSNP
rs1226553199 4049 dbSNP
rs1016574609 4051 dbSNP
rs1430813662 4052 dbSNP
rs1340547690 4053 dbSNP
rs1197958516 4055 dbSNP
rs1167072072 4067 dbSNP
rs961763616 4071 dbSNP
rs569302522 4080 dbSNP
rs909375680 4088 dbSNP
rs1461271569 4093 dbSNP
rs551275512 4102 dbSNP
rs1471486198 4104 dbSNP
rs1236850577 4108 dbSNP
rs943652066 4118 dbSNP
rs1483931175 4122 dbSNP
rs1272257107 4132 dbSNP
rs1244513359 4135 dbSNP
rs1447120765 4138 dbSNP
rs1313696990 4139 dbSNP
rs1341788726 4139 dbSNP
rs1192092516 4147 dbSNP
rs564803467 4154 dbSNP
rs1039241257 4157 dbSNP
rs902079016 4157 dbSNP
rs933328145 4162 dbSNP
rs954406619 4162 dbSNP
rs1170618255 4164 dbSNP
rs986308345 4165 dbSNP
rs1166400543 4170 dbSNP
rs910696812 4170 dbSNP
rs1421566502 4173 dbSNP
rs968979197 4174 dbSNP
rs1412393782 4182 dbSNP
rs747741594 4191 dbSNP
rs767689280 4196 dbSNP
rs979060760 4196 dbSNP
rs924844474 4197 dbSNP
rs75282180 4199 dbSNP
rs1338621228 4202 dbSNP
rs1181264811 4206 dbSNP
rs1057441321 4213 dbSNP
rs902601030 4222 dbSNP
rs1408450369 4229 dbSNP
rs186410400 4230 dbSNP
rs917338932 4238 dbSNP
rs1317676515 4239 dbSNP
rs143431567 4240 dbSNP
rs892963570 4242 dbSNP
rs1229808080 4246 dbSNP
rs948775809 4247 dbSNP
rs1273445794 4254 dbSNP
rs773668048 4260 dbSNP
rs1286931105 4269 dbSNP
rs1409616780 4271 dbSNP
rs1323265545 4278 dbSNP
rs1044893655 4280 dbSNP
rs905057441 4281 dbSNP
rs490834 4284 dbSNP
rs1006451037 4294 dbSNP
rs1348916689 4305 dbSNP
rs1159331182 4316 dbSNP
rs1458352797 4318 dbSNP
rs1409664922 4321 dbSNP
rs1012863217 4324 dbSNP
rs1037656042 4335 dbSNP
rs1433576419 4359 dbSNP
rs897732279 4360 dbSNP
rs993179007 4371 dbSNP
rs375862116 4377 dbSNP
rs981523092 4385 dbSNP
rs549470779 4388 dbSNP
rs1025977255 4389 dbSNP
rs1007294703 4390 dbSNP
rs1266807108 4392 dbSNP
rs1228276380 4393 dbSNP
rs984543089 4395 dbSNP
rs568882988 4400 dbSNP
rs556692631 4401 dbSNP
rs1303926996 4408 dbSNP
rs909408263 4411 dbSNP
rs943557237 4417 dbSNP
rs1017349508 4419 dbSNP
rs968942921 4421 dbSNP
rs1385740588 4422 dbSNP
rs974851803 4424 dbSNP
rs923530557 4427 dbSNP
rs979331695 4432 dbSNP
rs1428422143 4435 dbSNP
rs1394720516 4460 dbSNP
rs1189401789 4468 dbSNP
rs1480634132 4475 dbSNP
rs924929088 4479 dbSNP
rs1409702086 4488 dbSNP
rs1376341 4489 dbSNP
rs1042823772 4490 dbSNP
rs1483897133 4492 dbSNP
rs539335591 4500 dbSNP
rs992800593 4501 dbSNP
rs917224381 4508 dbSNP
rs948704159 4510 dbSNP
rs1385670570 4512 dbSNP
rs147985615 4513 dbSNP
rs909959870 4514 dbSNP
rs941911285 4516 dbSNP
rs114607466 4530 dbSNP
rs1319374660 4532 dbSNP
rs141671116 4536 dbSNP
rs1012770426 4539 dbSNP
rs552851875 4540 dbSNP
rs573011956 4542 dbSNP
rs929186789 4552 dbSNP
rs1051449057 4564 dbSNP
rs1370896920 4567 dbSNP
rs890152032 4574 dbSNP
rs1007219541 4580 dbSNP
rs1017399808 4584 dbSNP
rs530026122 4596 dbSNP
rs1192648366 4600 dbSNP
rs1000372382 4601 dbSNP
rs1258886181 4606 dbSNP
rs747273824 4619 dbSNP
rs1026427612 4621 dbSNP
rs1485565441 4624 dbSNP
rs1275842515 4629 dbSNP
rs1207729575 4631 dbSNP
rs1339720790 4633 dbSNP
rs1207762489 4642 dbSNP
rs190261575 4643 dbSNP
rs956333508 4652 dbSNP
rs993063923 4653 dbSNP
rs1490399139 4654 dbSNP
rs575297727 4661 dbSNP
rs1201339741 4665 dbSNP
rs1015978330 4667 dbSNP
rs572724902 4668 dbSNP
rs1309683383 4675 dbSNP
rs565980853 4676 dbSNP
rs1167494393 4680 dbSNP
rs1368952484 4680 dbSNP
rs1364517009 4681 dbSNP
rs1370223299 4685 dbSNP
rs1455389990 4685 dbSNP
rs139298830 4688 dbSNP
rs180699814 4703 dbSNP
rs1425484689 4704 dbSNP
rs564764769 4706 dbSNP
rs1482246907 4712 dbSNP
rs1271881375 4722 dbSNP
rs980067112 4727 dbSNP
rs1210025095 4728 dbSNP
rs909969197 4732 dbSNP
rs1305353824 4736 dbSNP
rs1371551263 4738 dbSNP
rs941406732 4752 dbSNP
rs34665438 4755 dbSNP
rs973276304 4755 dbSNP
rs533410445 4766 dbSNP
rs759524850 4769 dbSNP
rs1290061081 4770 dbSNP
rs1407777948 4771 dbSNP
rs1334896248 4774 dbSNP
rs1328469178 4776 dbSNP
rs1051713504 4777 dbSNP
rs1161606676 4784 dbSNP
rs1242018402 4786 dbSNP
rs1413366085 4787 dbSNP
rs1290332290 4788 dbSNP
rs936704842 4792 dbSNP
rs1471833768 4793 dbSNP
rs767528954 4794 dbSNP
rs150548180 4795 dbSNP
rs1038681330 4801 dbSNP
rs904281260 4809 dbSNP
rs1272294053 4816 dbSNP
rs560446332 4819 dbSNP
rs1000328702 4820 dbSNP
rs561545363 4822 dbSNP
rs1031399974 4825 dbSNP
rs948080924 4830 dbSNP
rs1212526950 4831 dbSNP
rs891987106 4833 dbSNP
rs907021981 4836 dbSNP
rs185272318 4840 dbSNP
rs1024549177 4842 dbSNP
rs1226453239 4843 dbSNP
rs1047658316 4851 dbSNP
rs1275270019 4852 dbSNP
rs1177756870 4863 dbSNP
rs1438346854 4866 dbSNP
rs1333056031 4870 dbSNP
rs1252537874 4872 dbSNP
rs1421947956 4875 dbSNP
rs372265021 4875 dbSNP
rs886323998 4879 dbSNP
rs1322606510 4883 dbSNP
rs1005847977 4897 dbSNP
rs1015841925 4916 dbSNP
rs1173595894 4917 dbSNP
rs964468525 4923 dbSNP
rs995876130 4926 dbSNP
rs139913465 4927 dbSNP
rs376598496 4930 dbSNP
rs1425543640 4931 dbSNP
rs954884896 4932 dbSNP
rs1206255049 4934 dbSNP
rs978644416 4942 dbSNP
rs1279163376 4945 dbSNP
rs1165701973 4953 dbSNP
rs761010766 4956 dbSNP
rs1301569002 4958 dbSNP
rs1461780270 4965 dbSNP
rs980078611 4968 dbSNP
rs1366179147 4971 dbSNP
rs569051640 4972 dbSNP
rs962848128 4975 dbSNP
rs1345120960 4977 dbSNP
rs537846524 4982 dbSNP
rs1313737557 4986 dbSNP
rs918668554 4986 dbSNP
rs1173366584 4987 dbSNP
rs558742781 4987 dbSNP
rs948145679 4987 dbSNP
rs950565379 4989 dbSNP
rs1247790037 4996 dbSNP
rs760848095 4996 dbSNP
rs987301317 5002 dbSNP
rs1294916808 5004 dbSNP
rs911815965 5004 dbSNP
rs1186132880 5006 dbSNP
rs1474763777 5015 dbSNP
rs938539718 5028 dbSNP
rs1047983968 5034 dbSNP
rs1440598511 5035 dbSNP
rs943234545 5038 dbSNP
rs1279403888 5040 dbSNP
rs1205594330 5042 dbSNP
rs74095749 5045 dbSNP
rs571317471 5047 dbSNP
rs1006089859 5048 dbSNP
rs1285333003 5048 dbSNP
rs1037365877 5055 dbSNP
rs1354085383 5057 dbSNP
rs1312709898 5062 dbSNP
rs925632554 5071 dbSNP
rs1430796602 5072 dbSNP
rs900165385 5072 dbSNP
rs1252803190 5073 dbSNP
rs935666247 5077 dbSNP
rs1053313929 5082 dbSNP
rs1167822433 5092 dbSNP
rs891539030 5093 dbSNP
rs764323324 5094 dbSNP
rs1408899586 5095 dbSNP
rs1413943628 5096 dbSNP
rs1183073850 5105 dbSNP
rs1474218540 5108 dbSNP
rs1045840212 5112 dbSNP
rs539322316 5122 dbSNP
rs906137094 5124 dbSNP
rs1001719524 5127 dbSNP
rs1202882044 5128 dbSNP
rs1242685484 5129 dbSNP
rs1277060095 5129 dbSNP
rs1307103485 5130 dbSNP
rs553257430 5143 dbSNP
rs1185716265 5145 dbSNP
rs1230086564 5150 dbSNP
rs764362784 5162 dbSNP
rs1333418575 5172 dbSNP
rs1293155874 5174 dbSNP
rs1417600976 5182 dbSNP
rs572932301 5190 dbSNP
rs1030102870 5193 dbSNP
rs1441089848 5193 dbSNP
rs750161301 5194 dbSNP
rs994176020 5205 dbSNP
rs1026189076 5212 dbSNP
rs1166379297 5214 dbSNP
rs999707248 5215 dbSNP
rs758251830 5221 dbSNP
rs1336636262 5224 dbSNP
rs1406234344 5229 dbSNP
rs987311388 5230 dbSNP
rs1176385236 5231 dbSNP
rs958316780 5232 dbSNP
rs911699978 5238 dbSNP
rs1223865899 5251 dbSNP
rs1454088580 5252 dbSNP
rs964521674 5254 dbSNP
rs1360866502 5260 dbSNP
rs1214737663 5272 dbSNP
rs989717417 5274 dbSNP
rs1331816307 5278 dbSNP
rs867868403 5292 dbSNP
rs1321146155 5299 dbSNP
rs1023663414 5307 dbSNP
rs1367875336 5308 dbSNP
rs772411647 5308 dbSNP
rs969396635 5312 dbSNP
rs758932974 5315 dbSNP
rs1263660811 5317 dbSNP
rs1461861874 5325 dbSNP
rs1438104095 5331 dbSNP
rs1393044179 5334 dbSNP
rs1320603264 5342 dbSNP
rs1458800334 5348 dbSNP
rs975093033 5362 dbSNP
rs1158186518 5368 dbSNP
rs1433484188 5374 dbSNP
rs1195693258 5375 dbSNP
rs1426169589 5375 dbSNP
rs925884099 5379 dbSNP
rs928076894 5385 dbSNP
rs935702843 5399 dbSNP
rs930010222 5408 dbSNP
rs1209426340 5417 dbSNP
rs1487175757 5429 dbSNP
rs1259420928 5430 dbSNP
rs200056739 5437 dbSNP
rs1313097435 5438 dbSNP
rs1302992513 5446 dbSNP
rs1052744979 5447 dbSNP
rs1231673618 5451 dbSNP
rs779850619 5469 dbSNP
rs1297760928 5475 dbSNP
rs1566079 5499 dbSNP
rs941983395 5501 dbSNP
rs1288154437 5518 dbSNP
rs1466390503 5518 dbSNP
rs564666523 5518 dbSNP
rs1422165762 5519 dbSNP
rs1479648344 5526 dbSNP
rs1394700358 5529 dbSNP
rs1189302166 5544 dbSNP
rs1430325847 5553 dbSNP
rs1260291325 5554 dbSNP
rs1186402633 5556 dbSNP
rs1045895354 5570 dbSNP
rs1430649389 5580 dbSNP
rs1037564898 5582 dbSNP
rs1274826462 5583 dbSNP
rs906066459 5583 dbSNP
rs533602059 5589 dbSNP
rs1228988341 5590 dbSNP
rs1001699648 5592 dbSNP
rs1396590789 5596 dbSNP
rs555490372 5599 dbSNP
rs1039062842 5600 dbSNP
rs1344026879 5612 dbSNP
rs575455961 5624 dbSNP
rs1431097821 5629 dbSNP
rs1169414341 5637 dbSNP
rs1290260580 5640 dbSNP
rs1343466237 5649 dbSNP
rs1404079582 5651 dbSNP
rs898745585 5653 dbSNP
rs931664860 5658 dbSNP
rs79471885 5661 dbSNP
rs1325602044 5663 dbSNP
rs1025610942 5666 dbSNP
rs1221934732 5675 dbSNP
rs1160217825 5695 dbSNP
rs1485514777 5700 dbSNP
rs891230326 5707 dbSNP
rs890214427 5713 dbSNP
rs1008339473 5714 dbSNP
rs1250332551 5719 dbSNP
rs1018357778 5722 dbSNP
rs964573830 5723 dbSNP
rs1316394683 5737 dbSNP
rs1291299013 5740 dbSNP
rs754975492 5763 dbSNP
rs974600766 5770 dbSNP
rs1033342369 5774 dbSNP
rs1309585577 5777 dbSNP
rs190031065 5777 dbSNP
rs957274156 5786 dbSNP
rs982134399 5793 dbSNP
rs577582107 5800 dbSNP
rs1163340196 5802 dbSNP
rs912874273 5806 dbSNP
rs949705658 5818 dbSNP
rs1413227307 5822 dbSNP
rs540541493 5843 dbSNP
rs1435790823 5848 dbSNP
rs115811405 5850 dbSNP
rs183968669 5851 dbSNP
rs1160892006 5852 dbSNP
rs542862245 5853 dbSNP
rs1423541604 5867 dbSNP
rs1038497702 5868 dbSNP
rs755809421 5876 dbSNP
rs1303536522 5890 dbSNP
rs1328366415 5899 dbSNP
rs562748253 5903 dbSNP
rs931852447 5907 dbSNP
rs1323950158 5915 dbSNP
rs1461433741 5916 dbSNP
rs898751764 5923 dbSNP
rs17661264 5925 dbSNP
rs1047113729 5929 dbSNP
rs891160247 5933 dbSNP
rs551475766 5937 dbSNP
rs1250648877 5956 dbSNP
rs893531031 5969 dbSNP
rs749614283 5988 dbSNP
rs1224433970 5995 dbSNP
rs1286179221 5995 dbSNP
rs1011086234 6002 dbSNP
rs1045215594 6002 dbSNP
rs1279218207 6002 dbSNP
rs571525886 6002 dbSNP
rs905480262 6002 dbSNP
rs1018409354 6003 dbSNP
rs1440185300 6013 dbSNP
rs146243672 6014 dbSNP
rs1035054071 6019 dbSNP
rs996417464 6024 dbSNP
rs1032815410 6031 dbSNP
rs1221942359 6033 dbSNP
rs1384752776 6034 dbSNP
rs1436263363 6036 dbSNP
rs951442470 6037 dbSNP
rs1004195141 6038 dbSNP
rs1192470192 6038 dbSNP
rs1243795386 6044 dbSNP
rs1016989770 6053 dbSNP
rs1446321606 6059 dbSNP
rs1279140284 6081 dbSNP
rs771388725 6083 dbSNP
rs957534027 6099 dbSNP
rs988769474 6100 dbSNP
rs1020147409 6103 dbSNP
rs1293043812 6104 dbSNP
rs971073648 6107 dbSNP
rs1453673344 6109 dbSNP
rs981073936 6121 dbSNP
rs1180353211 6126 dbSNP
rs973213929 6127 dbSNP
rs927048386 6128 dbSNP
rs549321305 6141 dbSNP
rs1470776888 6147 dbSNP
rs866999820 6153 dbSNP
rs746320120 6155 dbSNP
rs376775189 6164 dbSNP
rs1302323928 6177 dbSNP
rs569164868 6182 dbSNP
rs1373254283 6189 dbSNP
rs1172572813 6191 dbSNP
rs1047378557 6195 dbSNP
rs891381080 6198 dbSNP
rs1421073463 6208 dbSNP
rs1165627680 6210 dbSNP
rs935003276 6220 dbSNP
rs1237920968 6223 dbSNP
rs75302196 6224 dbSNP
rs1039689617 6235 dbSNP
rs1484539667 6247 dbSNP
rs547718 6249 dbSNP
rs1255710924 6250 dbSNP
rs914995803 6251 dbSNP
rs1308280109 6254 dbSNP
rs946444760 6255 dbSNP
rs1327893987 6256 dbSNP
rs1339311563 6256 dbSNP
rs1294380769 6257 dbSNP
rs1355061586 6257 dbSNP
rs537948883 6258 dbSNP
rs1242827483 6261 dbSNP
rs905345511 6263 dbSNP
rs773264407 6266 dbSNP
rs555551231 6271 dbSNP
rs188902636 6278 dbSNP
rs537904368 6288 dbSNP
rs1358959472 6290 dbSNP
rs1194473024 6303 dbSNP
rs191681429 6306 dbSNP
rs760792530 6322 dbSNP
rs115493679 6323 dbSNP
rs774116386 6329 dbSNP
rs1201066373 6337 dbSNP
rs1202536851 6351 dbSNP
rs893000459 6358 dbSNP
rs1010019326 6360 dbSNP
rs1460464964 6361 dbSNP
rs1235717888 6371 dbSNP
rs1183862834 6383 dbSNP
rs1020199839 6387 dbSNP
rs1224620895 6401 dbSNP
rs539275623 6402 dbSNP
rs1016850730 6405 dbSNP
rs776979408 6406 dbSNP
rs540257567 6414 dbSNP
rs1459866006 6415 dbSNP
rs1393633019 6421 dbSNP
rs1159566465 6422 dbSNP
rs1420590946 6431 dbSNP
rs1419885396 6434 dbSNP
rs762642797 6434 dbSNP
rs1439282881 6438 dbSNP
rs1253757474 6439 dbSNP
rs1411657443 6441 dbSNP
rs996879886 6444 dbSNP
rs772012276 6447 dbSNP
rs1404062960 6453 dbSNP
rs765734584 6456 dbSNP
rs1033948060 6465 dbSNP
rs1342511450 6469 dbSNP
rs11834405 6470 dbSNP
rs1305273657 6474 dbSNP
rs200332560 6474 dbSNP
rs1370169452 6475 dbSNP
rs1437993205 6475 dbSNP
rs201309634 6475 dbSNP
rs869194241 6475 dbSNP
rs987291473 6475 dbSNP
rs919660398 6476 dbSNP
rs911805170 6477 dbSNP
rs112861699 6479 dbSNP
rs956610287 6479 dbSNP
rs11413557 6480 dbSNP
rs199666419 6480 dbSNP
rs35107820 6481 dbSNP
rs58058394 6481 dbSNP
rs912823576 6483 dbSNP
rs1267307334 6485 dbSNP
rs944242372 6486 dbSNP
rs1221052141 6490 dbSNP
rs1487126367 6490 dbSNP
rs200506655 6491 dbSNP
rs1216343345 6496 dbSNP
rs1323401836 6497 dbSNP
rs1203779329 6498 dbSNP
rs946475939 6500 dbSNP
rs766135897 6502 dbSNP
rs1444926283 6505 dbSNP
rs921297438 6510 dbSNP
rs76527494 6516 dbSNP
rs939529917 6519 dbSNP
rs1056604178 6520 dbSNP
rs554988277 6526 dbSNP
rs754497829 6535 dbSNP
rs531812047 6545 dbSNP
rs892543081 6550 dbSNP
rs1175717703 6552 dbSNP
rs1010027665 6558 dbSNP
rs1478667966 6563 dbSNP
rs545078746 6574 dbSNP
rs1171212324 6590 dbSNP
rs751313003 6593 dbSNP
rs940275041 6595 dbSNP
rs1041500199 6603 dbSNP
rs1428557315 6621 dbSNP
rs907144117 6623 dbSNP
rs1260178884 6624 dbSNP
rs1002723966 6627 dbSNP
rs1034663761 6631 dbSNP
rs996911990 6632 dbSNP
rs1028838209 6633 dbSNP
rs1251443417 6649 dbSNP
rs958430784 6652 dbSNP
rs891176012 6656 dbSNP
rs1173252316 6658 dbSNP
rs1011310038 6661 dbSNP
rs374604697 6661 dbSNP
rs773075014 6664 dbSNP
rs1357178180 6667 dbSNP
rs565415095 6668 dbSNP
rs1018776622 6669 dbSNP
rs1401767084 6675 dbSNP
rs1413233536 6675 dbSNP
rs1026736303 6677 dbSNP
rs1463536211 6683 dbSNP
rs1371869372 6686 dbSNP
rs1170537854 6687 dbSNP
rs1475800212 6688 dbSNP
rs1420536324 6690 dbSNP
rs1317874190 6693 dbSNP
rs780646798 6693 dbSNP
rs183522598 6700 dbSNP
rs951074716 6707 dbSNP
rs988042323 6707 dbSNP
rs1021991854 6711 dbSNP
rs1256836437 6723 dbSNP
rs1214299968 6725 dbSNP