miRTarBase - #MIRT071206 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FCF1   
Synonyms Bka, C14orf111, CGI-35, UTP24
Description FCF1, rRNA-processing protein
Transcript NM_015962   
Expression
Putative miRNA Targets on FCF1
3'UTR of FCF1
(miRNA target sites are highlighted)
>FCF1|NM_015962|3'UTR
   1 TTCTTACAAGACACAGTTCCTCTGCCTTTCTTCGACCAACTTTCTCTTGTTGCCAGTTCATTACACAAAATGTAGCGGGA
  81 TTTTTAAGGAATCAGAGAGACTGATGGAGTTCAGGGAGATATTTATTATTTAGGTGCACCAGCCCAGTCAGATTAACATC
 161 CAAAGGACTGAACCCTGAACAGAGTTAAGTTACCTTTTAAGCATTTTGTGGGGCCGCGGGGGTTGGGGGGAATCTGTGCA
 241 GGGGGAAGCATATTACAGAAGCAAGAAAGACAGTTATTCAATTAACTGAGACATGCATTACATCATTTCTTACTTTTCAA
 321 GGAAAATCATGTTTTACGACTTGAGTTTATCTGTCTAGTTACCTTGCAGCTGCACAGCTAGAGAAACAGGGTATTTACAA
 401 TGCCTGGGAAAGGAGGAGAGATAAGGCTCACTAGCCACAGAAAAACAGGCAGTTAATTTTTAAAGGACTCCAGCTCTTTC
 481 TCTTTCTCACGGGGAATTGGATTTTCTTACATGCAACTGAATTTCTGCTTACACATTTTTAAATTTCTTTTAATTGCTTT
 561 TCCAATGCAATAGCATGAATTATTATTCTGTTGACCTATTTGCCTTACTATGAGCTGAGGGTAGTTCAATATGCTCACTC
 641 TTTTTTTTTTTTTTCTTGAGATGAAGTTTTGCTCTGTCACCAGGCTGGAGTGCAGTGGCGTGATCTGGGCTCACTGCAAC
 721 CCCTGCCTCCCATCCTTCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTACACACCACCATGCTC
 801 AACTAATTTTTCTTTTTTGGGCGGGGGGGGTGGATATTTTTAGTAGAGACAAATACTTTTGTATTTTTAATACAGAAAAG
 881 TATGCCTCGGCCTCCCAAAGTGCTGGAATTACAGACATGAGCCACTGTGCCTGGCCTGCTCACTTTCTGATGCTGCTTTT
 961 TTGTTGTTTGTTTGTTTATTTGTTTGTTTTGAGACGGAGTCTCGCTCTGTCACCAGGCTGGAGTGCAGTGGCGCAATCTC
1041 GGCTCATTGCAACCTCCGCCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTGCGGAGTAGCTGGGACTATAGGTGCGT
1121 GCCACCACGTCCAGCCACTGATGCTGTTTTGCCACTGATGCTGTTTTGAAATTGATATTTTGTCTCATAAAAACTAGGCC
1201 AGGCATGGTGGCTCATTCCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACCTGAGGTCAGGAGTTGGAGA
1281 TGAGCCTGGACAACATGGCAAAACCCCACCTCTACTAAAAATACAAAAAAAATTAGCTGGGTATGGTGTCACGTGCCTGT
1361 AATCCCAGCCACTGGGGAGGCTGAGGCAGGAGAACCTCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATTGCGC
1441 CACTGCATTCCAGCCTGGGTGACAGAGTGAGACTGTCTCAAAAAAAAAAAAAAATTAATGATGGTCAAAGGGTATAAAAT
1521 CTCAGACAGGAAGAATATGTTTTATGCTTTTTTTGAGTTCTGTTGTACAGTGTGGTGCCTATACTTAATAATGGGGTATT
1601 ATACATTTCAAAATTGATGTTCTCATCACAGAAATGTATTTGAAGTATTGCATATGTTAACTAGCTTGATTTAACTATTC
1681 CATATTGTATCCACAATTTATGATATCACTTTGTAACCCATACATTTATACAATTATAAATTGTCAATTTACAATAAAAA
1761 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUAC-ACGACGAu 5'
               ||: || || ||||||| 
Target 5' tgctcACT-TTCTGATGCTGCTt 3'
937 - 958 152.00 -11.10
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | |:||| |:  |||||:| 
Target 5' gtCCAGCCACTG-ATGCTGTTt 3'
1129 - 1149 139.00 -11.40
3
miRNA  3' guGUUUGGUAA--UACACGACGAu 5'
            || :| | |  || | ||||| 
Target 5' taCATGCAACTGAAT-TTCTGCTt 3'
508 - 530 117.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31525313 4 COSMIC
COSN30526122 40 COSMIC
COSN30450988 55 COSMIC
COSN30493021 60 COSMIC
COSN31610144 74 COSMIC
COSN26976252 77 COSMIC
COSN30539407 89 COSMIC
COSN30539426 90 COSMIC
COSN30152154 94 COSMIC
COSN31521614 124 COSMIC
COSN21341407 319 COSMIC
COSN20111481 655 COSMIC
COSN20111482 655 COSMIC
COSN24802864 656 COSMIC
COSN4903790 1449 COSMIC
COSN4758865 1502 COSMIC
COSN24227315 1819 COSMIC
COSN29694259 1868 COSMIC
COSN25912166 1942 COSMIC
COSN5172282 2483 COSMIC
COSN7026412 2556 COSMIC
COSN7026413 3092 COSMIC
COSN22083978 3479 COSMIC
COSN7026414 3511 COSMIC
rs2111703 2883 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1213774572 8 dbSNP
rs765840451 9 dbSNP
rs141595537 12 dbSNP
rs1256536385 13 dbSNP
rs758801045 16 dbSNP
rs1262919200 17 dbSNP
rs557111381 19 dbSNP
rs747999712 20 dbSNP
rs201572591 21 dbSNP
rs755799836 24 dbSNP
rs779513112 26 dbSNP
rs748852936 28 dbSNP
rs768469693 31 dbSNP
rs764425077 34 dbSNP
rs747851512 35 dbSNP
rs373453156 39 dbSNP
rs773184903 40 dbSNP
rs760957453 41 dbSNP
rs1203378772 42 dbSNP
rs1413932652 47 dbSNP
rs766766176 50 dbSNP
rs776848294 51 dbSNP
rs376863588 60 dbSNP
rs144498669 65 dbSNP
rs1447391607 75 dbSNP
rs754200086 77 dbSNP
rs148396060 78 dbSNP
rs901349952 89 dbSNP
rs1431460955 90 dbSNP
rs529488033 94 dbSNP
rs1179381342 95 dbSNP
rs1049857095 123 dbSNP
rs1236953090 124 dbSNP
rs889755436 133 dbSNP
rs1483789953 141 dbSNP
rs1256170965 142 dbSNP
rs1209021860 146 dbSNP
rs994098955 147 dbSNP
rs779335848 153 dbSNP
rs1240318128 160 dbSNP
rs1022276593 163 dbSNP
rs1306999983 164 dbSNP
rs1287374062 178 dbSNP
rs1397502690 185 dbSNP
rs1402673570 190 dbSNP
rs1302442959 204 dbSNP
rs1488228386 210 dbSNP
rs968602951 215 dbSNP
rs1214572444 217 dbSNP
rs1259761136 218 dbSNP
rs527399744 219 dbSNP
rs1424717357 224 dbSNP
rs1187184735 225 dbSNP
rs540982386 227 dbSNP
rs1471694056 228 dbSNP
rs1160162831 232 dbSNP
rs754409961 235 dbSNP
rs1216619879 237 dbSNP
rs1361121035 241 dbSNP
rs1352355690 242 dbSNP
rs1283740023 243 dbSNP
rs980473094 246 dbSNP
rs1034458727 248 dbSNP
rs1418966294 257 dbSNP
rs1296239507 270 dbSNP
rs959900580 278 dbSNP
rs957414206 338 dbSNP
rs992960547 339 dbSNP
rs1396096678 341 dbSNP
rs764891549 346 dbSNP
rs1165109979 347 dbSNP
rs990346385 350 dbSNP
rs1368458957 354 dbSNP
rs1163121310 359 dbSNP
rs1430671992 366 dbSNP
rs1264812111 374 dbSNP
rs913384669 377 dbSNP
rs1311592738 378 dbSNP
rs1022701010 388 dbSNP
rs1338269415 388 dbSNP
rs1260368695 394 dbSNP
rs559449630 394 dbSNP
rs1356957938 397 dbSNP
rs563966573 399 dbSNP
rs1319762192 402 dbSNP
rs976353456 403 dbSNP
rs1279027903 406 dbSNP
rs923483497 407 dbSNP
rs1353411095 413 dbSNP
rs1338775742 414 dbSNP
rs1325590111 420 dbSNP
rs533261736 423 dbSNP
rs1390567095 424 dbSNP
rs973012760 427 dbSNP
rs779121854 428 dbSNP
rs1467468816 434 dbSNP
rs1258279668 448 dbSNP
rs1424827939 451 dbSNP
rs1170464767 457 dbSNP
rs1477279062 467 dbSNP
rs922738577 470 dbSNP
rs933672396 477 dbSNP
rs1049836322 483 dbSNP
rs188848084 491 dbSNP
rs1208019947 492 dbSNP
rs1459065347 495 dbSNP
rs61285729 497 dbSNP
rs113895916 498 dbSNP
rs1316295494 504 dbSNP
rs55988214 512 dbSNP
rs1233989964 514 dbSNP
rs1330622616 515 dbSNP
rs1322102763 517 dbSNP
rs998688180 534 dbSNP
rs1401724205 535 dbSNP
rs1331082667 542 dbSNP
rs1464397225 543 dbSNP
rs994375420 558 dbSNP
rs1045654749 564 dbSNP
rs1031604420 566 dbSNP
rs1156843556 568 dbSNP
rs895751902 571 dbSNP
rs1478045792 575 dbSNP
rs566123341 577 dbSNP
rs1376541652 578 dbSNP
rs554059687 579 dbSNP
rs1379242596 586 dbSNP
rs1014071873 594 dbSNP
rs1466111289 601 dbSNP
rs1023261719 603 dbSNP
rs1456290548 605 dbSNP
rs1280944452 607 dbSNP
rs115677127 611 dbSNP
rs1273133696 619 dbSNP
rs1242478475 634 dbSNP
rs868127562 636 dbSNP
rs551746191 637 dbSNP
rs1378289581 638 dbSNP
rs983880439 639 dbSNP
rs1016571797 641 dbSNP
rs1348671808 641 dbSNP
rs571560482 641 dbSNP
rs576920055 641 dbSNP
rs74698168 641 dbSNP
rs961051774 641 dbSNP
rs973367042 641 dbSNP
rs1448600429 644 dbSNP
rs922865671 649 dbSNP
rs75046173 654 dbSNP
rs1331573388 656 dbSNP
rs1376711955 659 dbSNP
rs1238410961 660 dbSNP
rs1304067743 663 dbSNP
rs1177964281 667 dbSNP
rs1468376464 673 dbSNP
rs1238958187 675 dbSNP
rs1188060564 676 dbSNP
rs1442047222 677 dbSNP
rs1278540861 680 dbSNP
rs1218808885 688 dbSNP
rs373432668 689 dbSNP
rs934258793 693 dbSNP
rs1285879591 701 dbSNP
rs1313227030 702 dbSNP
rs1232662285 703 dbSNP
rs1254274787 708 dbSNP
rs985644131 710 dbSNP
rs1285139149 711 dbSNP
rs1447841946 712 dbSNP
rs571577472 713 dbSNP
rs1339441243 715 dbSNP
rs1310713030 716 dbSNP
rs1401253095 722 dbSNP
rs911424585 737 dbSNP
rs946766724 740 dbSNP
rs77394285 741 dbSNP
rs957465129 746 dbSNP
rs1011664921 749 dbSNP
rs902497718 751 dbSNP
rs1237790106 757 dbSNP
rs935335478 758 dbSNP
rs1056892515 764 dbSNP
rs552626224 765 dbSNP
rs967546082 766 dbSNP
rs1196156543 770 dbSNP
rs1269414134 774 dbSNP
rs1433654413 776 dbSNP
rs1262537068 780 dbSNP
rs1175247634 785 dbSNP
rs1375468669 789 dbSNP
rs1324023328 790 dbSNP
rs771004936 791 dbSNP
rs1228052663 796 dbSNP
rs1354719227 798 dbSNP
rs976616081 801 dbSNP
rs1466727887 819 dbSNP
rs1022770550 822 dbSNP
rs397959609 823 dbSNP
rs57898806 823 dbSNP
rs774381298 823 dbSNP
rs905697753 823 dbSNP
rs557197460 824 dbSNP
rs961144378 825 dbSNP
rs985169518 826 dbSNP
rs1184784887 827 dbSNP
rs570874348 828 dbSNP
rs536401071 829 dbSNP
rs553301570 830 dbSNP
rs1221525325 833 dbSNP
rs1467559068 851 dbSNP
rs1260376615 853 dbSNP
rs1038095521 856 dbSNP
rs11852012 876 dbSNP
rs572097805 880 dbSNP
rs772251108 881 dbSNP
rs564731014 886 dbSNP
rs1219696253 889 dbSNP
rs929845760 890 dbSNP
rs1294415171 896 dbSNP
rs1045946045 904 dbSNP
rs1386753056 909 dbSNP
rs907147969 912 dbSNP
rs1001840898 925 dbSNP
rs1299777600 926 dbSNP
rs1055843412 933 dbSNP
rs893134126 938 dbSNP
rs1320170415 942 dbSNP
rs1219270197 951 dbSNP
rs1011548393 957 dbSNP
rs979455387 957 dbSNP
rs924010865 964 dbSNP
rs1257674578 966 dbSNP
rs1316254465 967 dbSNP
rs1425924433 971 dbSNP
rs567457185 975 dbSNP
rs1199592244 979 dbSNP
rs1453105192 979 dbSNP
rs1457610734 990 dbSNP
rs1267045847 996 dbSNP
rs144404139 997 dbSNP
rs147834292 998 dbSNP
rs997706384 999 dbSNP
rs1301343410 1000 dbSNP
rs1233009029 1004 dbSNP
rs1030901070 1006 dbSNP
rs190996926 1008 dbSNP
rs949959319 1016 dbSNP
rs1447179786 1028 dbSNP
rs1044353623 1033 dbSNP
rs1266666045 1034 dbSNP
rs543459285 1035 dbSNP
rs905666753 1041 dbSNP
rs1193671438 1042 dbSNP
rs1175446745 1053 dbSNP
rs1005377298 1054 dbSNP
rs1422507845 1056 dbSNP
rs563548658 1058 dbSNP
rs529210661 1059 dbSNP
rs986341480 1060 dbSNP
rs896900093 1073 dbSNP
rs1248829610 1075 dbSNP
rs994356049 1090 dbSNP
rs1029297119 1091 dbSNP
rs141342265 1096 dbSNP
rs962358278 1097 dbSNP
rs1292306721 1100 dbSNP
rs973688358 1102 dbSNP
rs1240750414 1108 dbSNP
rs1018493330 1118 dbSNP
rs918350294 1120 dbSNP
rs1397634006 1122 dbSNP
rs1380077046 1125 dbSNP
rs929703360 1129 dbSNP
rs1400725680 1130 dbSNP
rs1362503799 1134 dbSNP
rs1412962102 1134 dbSNP
rs760874965 1145 dbSNP
rs1159378783 1151 dbSNP
rs1419613315 1159 dbSNP
rs988966187 1159 dbSNP
rs1167262156 1160 dbSNP
rs1424768820 1164 dbSNP
rs559327942 1169 dbSNP
rs981322356 1175 dbSNP
rs764310069 1179 dbSNP
rs1313702633 1180 dbSNP
rs1264681996 1188 dbSNP
rs528561914 1194 dbSNP
rs1216782890 1195 dbSNP
rs1485502696 1197 dbSNP
rs1258898490 1204 dbSNP
rs556603498 1209 dbSNP
rs796396763 1210 dbSNP
rs1055728309 1219 dbSNP
rs1322130151 1220 dbSNP
rs1292862602 1227 dbSNP
rs1220480020 1237 dbSNP
rs1231661063 1240 dbSNP
rs1342675820 1244 dbSNP
rs1298878510 1249 dbSNP
rs893019473 1260 dbSNP
rs1383358989 1269 dbSNP
rs1295820851 1272 dbSNP
rs992655947 1276 dbSNP
rs1417550403 1277 dbSNP
rs1163290977 1285 dbSNP
rs1489207114 1292 dbSNP
rs947386160 1293 dbSNP
rs1193672923 1297 dbSNP
rs1261894589 1301 dbSNP
rs755894648 1304 dbSNP
rs1259516272 1306 dbSNP
rs374054928 1309 dbSNP
rs1211598580 1310 dbSNP
rs1488793708 1311 dbSNP
rs1474121780 1317 dbSNP
rs1041709323 1318 dbSNP
rs1320186266 1325 dbSNP
rs917902001 1325 dbSNP
rs1226713841 1331 dbSNP
rs1414001978 1332 dbSNP
rs903294811 1335 dbSNP
rs997988995 1336 dbSNP
rs1030536378 1340 dbSNP
rs1303546824 1342 dbSNP
rs948063667 1344 dbSNP
rs1363032641 1354 dbSNP
rs1420888447 1356 dbSNP
rs1467519301 1362 dbSNP
rs1401954427 1363 dbSNP
rs1298092837 1364 dbSNP
rs1358776566 1370 dbSNP
rs1370812834 1372 dbSNP
rs1450283863 1373 dbSNP
rs1045120911 1375 dbSNP
rs1252303389 1395 dbSNP
rs566474513 1401 dbSNP
rs927175007 1402 dbSNP
rs1458941375 1406 dbSNP
rs1258906287 1411 dbSNP
rs1195410806 1418 dbSNP
rs747553439 1425 dbSNP
rs941296798 1431 dbSNP
rs1038202055 1433 dbSNP
rs771404279 1438 dbSNP
rs896987552 1439 dbSNP
rs889293011 1440 dbSNP
rs929699736 1443 dbSNP
rs1449397361 1448 dbSNP
rs551617182 1458 dbSNP
rs1378628964 1464 dbSNP
rs1227563340 1470 dbSNP
rs1312584374 1473 dbSNP
rs1051306122 1474 dbSNP
rs1355552960 1478 dbSNP
rs1191698032 1480 dbSNP
rs1394347904 1480 dbSNP
rs1408996613 1480 dbSNP
rs878876008 1480 dbSNP
rs890766618 1480 dbSNP
rs1240835160 1486 dbSNP
rs1233218369 1488 dbSNP
rs1180898175 1496 dbSNP
rs1285211305 1498 dbSNP
rs1017937063 1502 dbSNP
rs571422778 1505 dbSNP
rs1201056060 1512 dbSNP
rs1007645054 1513 dbSNP
rs1278766617 1515 dbSNP
rs537018070 1520 dbSNP
rs138177498 1522 dbSNP
rs957110547 1528 dbSNP
rs1440472510 1531 dbSNP
rs1333564191 1536 dbSNP
rs1335804555 1536 dbSNP
rs973739161 1538 dbSNP
rs1414819866 1544 dbSNP
rs550563162 1548 dbSNP
rs1181347186 1556 dbSNP
rs1382596057 1557 dbSNP
rs1440697064 1558 dbSNP
rs1158636802 1561 dbSNP
rs1406347371 1563 dbSNP
rs992227776 1572 dbSNP
rs1025467488 1578 dbSNP
rs969524100 1579 dbSNP
rs1408717813 1584 dbSNP
rs757572010 1603 dbSNP
rs1334871090 1606 dbSNP
rs1468425315 1615 dbSNP
rs765768023 1623 dbSNP
rs1188960206 1625 dbSNP
rs183307463 1626 dbSNP
rs1333576466 1632 dbSNP
rs1255465812 1639 dbSNP
rs1378919870 1644 dbSNP
rs1447226325 1645 dbSNP
rs973988559 1653 dbSNP
rs569133211 1654 dbSNP
rs1284197391 1666 dbSNP
rs1348408659 1668 dbSNP
rs928370548 1676 dbSNP
rs763669428 1683 dbSNP
rs937173012 1697 dbSNP
rs1285195495 1703 dbSNP
rs1233497554 1704 dbSNP
rs991296919 1707 dbSNP
rs1310540259 1708 dbSNP
rs1401316747 1710 dbSNP
rs929809359 1713 dbSNP
rs1317590177 1722 dbSNP
rs111732133 1724 dbSNP
rs1415655686 1735 dbSNP
rs536589557 1742 dbSNP
rs1165443776 1744 dbSNP
rs1474996594 1748 dbSNP
rs1415957472 1756 dbSNP
rs1195861452 1759 dbSNP
rs947271912 1761 dbSNP
rs942488949 1762 dbSNP
rs1416778103 1763 dbSNP
rs1453881951 1765 dbSNP
rs113017711 1772 dbSNP
rs573385998 1773 dbSNP
rs1458505305 1782 dbSNP
rs1333621078 1800 dbSNP
rs1178338268 1804 dbSNP
rs1219885779 1805 dbSNP
rs903534247 1809 dbSNP
rs758919853 1819 dbSNP
rs374933791 1820 dbSNP
rs147049900 1821 dbSNP
rs1351606956 1825 dbSNP
rs1052285616 1827 dbSNP
rs1014153896 1829 dbSNP
rs1392493535 1830 dbSNP
rs889185581 1832 dbSNP
rs1410778563 1833 dbSNP
rs557537618 1835 dbSNP
rs7144745 1839 dbSNP
rs899450148 1852 dbSNP
rs980860013 1858 dbSNP
rs993709621 1861 dbSNP
rs761370224 1863 dbSNP
rs1254184158 1865 dbSNP
rs1327887655 1867 dbSNP
rs1193335136 1868 dbSNP
rs1467435981 1870 dbSNP
rs1270844223 1879 dbSNP
rs1016234401 1880 dbSNP
rs1307765508 1883 dbSNP
rs1025342792 1891 dbSNP
rs1271667544 1894 dbSNP
rs543397988 1895 dbSNP
rs1212361164 1912 dbSNP
rs536541448 1937 dbSNP
rs973986501 1946 dbSNP
rs981091563 1950 dbSNP
rs1366363416 1954 dbSNP
rs1333172701 1956 dbSNP
rs1462673012 1959 dbSNP
rs1035865587 1972 dbSNP
rs958413942 1980 dbSNP
rs1221094845 1986 dbSNP
rs1416258278 1986 dbSNP
rs991347798 1991 dbSNP
rs914389344 1999 dbSNP
rs1173600176 2009 dbSNP
rs1259594377 2010 dbSNP
rs1318120206 2013 dbSNP
rs1240390196 2015 dbSNP
rs57900832 2021 dbSNP
rs1178198376 2027 dbSNP
rs1198437451 2031 dbSNP
rs987032318 2038 dbSNP
rs968659452 2040 dbSNP
rs1271386959 2049 dbSNP
rs977732440 2052 dbSNP
rs1453649416 2056 dbSNP
rs1201762862 2060 dbSNP
rs1349459429 2077 dbSNP
rs1280471995 2080 dbSNP
rs912407444 2088 dbSNP
rs1246620589 2092 dbSNP
rs755722895 2094 dbSNP
rs563311125 2095 dbSNP
rs924515417 2097 dbSNP
rs933338009 2101 dbSNP
rs1051741271 2104 dbSNP
rs1195887356 2109 dbSNP
rs368414268 2111 dbSNP
rs1376113224 2133 dbSNP
rs373581589 2135 dbSNP
rs936327997 2137 dbSNP
rs1433391493 2141 dbSNP
rs910658537 2143 dbSNP
rs542581644 2145 dbSNP
rs1418882580 2148 dbSNP
rs1052131428 2149 dbSNP
rs892709286 2156 dbSNP
rs749116739 2157 dbSNP
rs1257586326 2162 dbSNP
rs1465349012 2164 dbSNP
rs1209611622 2166 dbSNP
rs899332528 2171 dbSNP
rs1394153218 2180 dbSNP
rs1406865431 2185 dbSNP
rs1324143081 2189 dbSNP
rs559481514 2190 dbSNP
rs1239441261 2192 dbSNP
rs1364817956 2200 dbSNP
rs1402591427 2201 dbSNP
rs1316154396 2206 dbSNP
rs1304651911 2207 dbSNP
rs1279483744 2224 dbSNP
rs1340572101 2250 dbSNP
rs993592677 2251 dbSNP
rs1413021094 2269 dbSNP
rs1226290161 2286 dbSNP
rs1268036190 2287 dbSNP
rs1358970064 2290 dbSNP
rs1048449996 2292 dbSNP
rs528238161 2293 dbSNP
rs1343777347 2300 dbSNP
rs551574511 2301 dbSNP
rs1289833705 2302 dbSNP
rs1418127435 2303 dbSNP
rs1186530101 2316 dbSNP
rs1489989718 2317 dbSNP
rs1219410020 2320 dbSNP
rs145261679 2326 dbSNP
rs1205616251 2337 dbSNP
rs1035348515 2341 dbSNP
rs1258730178 2342 dbSNP
rs1477534360 2350 dbSNP
rs958465787 2351 dbSNP
rs1370359698 2353 dbSNP
rs770806971 2357 dbSNP
rs374571599 2358 dbSNP
rs1021499630 2369 dbSNP
rs554614999 2370 dbSNP
rs1016369016 2371 dbSNP
rs1422721516 2374 dbSNP
rs977260282 2375 dbSNP
rs745841254 2382 dbSNP
rs1381145725 2383 dbSNP
rs954638310 2385 dbSNP
rs1315798243 2388 dbSNP
rs1341822419 2393 dbSNP
rs987902312 2397 dbSNP
rs910551671 2404 dbSNP
rs772042871 2405 dbSNP
rs1374271472 2408 dbSNP
rs993885712 2410 dbSNP
rs1427850205 2422 dbSNP
rs1314854766 2427 dbSNP
rs1172107676 2431 dbSNP
rs1195205583 2436 dbSNP
rs1026353111 2439 dbSNP
rs1272358940 2445 dbSNP
rs1212029770 2448 dbSNP
rs530921058 2449 dbSNP
rs1287354373 2466 dbSNP
rs550552904 2468 dbSNP
rs1203399046 2476 dbSNP
rs768889562 2479 dbSNP
rs1258572646 2490 dbSNP
rs143252667 2491 dbSNP
rs975245542 2497 dbSNP
rs1324357405 2508 dbSNP
rs906807303 2512 dbSNP
rs1398273680 2520 dbSNP
rs1167927070 2523 dbSNP
rs1461058913 2527 dbSNP
rs1003778167 2531 dbSNP
rs1057238882 2532 dbSNP
rs118002636 2535 dbSNP
rs1384423366 2538 dbSNP
rs1012551500 2555 dbSNP
rs550811965 2568 dbSNP
rs1252129976 2569 dbSNP
rs913575190 2570 dbSNP
rs765643094 2573 dbSNP
rs1160439828 2574 dbSNP
rs1251530977 2577 dbSNP
rs904247360 2579 dbSNP
rs1380771006 2583 dbSNP
rs1337565598 2585 dbSNP
rs1046662379 2587 dbSNP
rs999124577 2595 dbSNP
rs1235639803 2605 dbSNP
rs1347866435 2609 dbSNP
rs1452431579 2620 dbSNP
rs1031486753 2625 dbSNP
rs954829028 2637 dbSNP
rs905332880 2640 dbSNP
rs1241637938 2649 dbSNP
rs540087523 2650 dbSNP
rs1329158027 2653 dbSNP
rs1403697644 2682 dbSNP
rs114044897 2697 dbSNP
rs1368132323 2701 dbSNP
rs558586736 2702 dbSNP
rs964685488 2703 dbSNP
rs1435250615 2719 dbSNP
rs899244546 2732 dbSNP
rs1381115948 2746 dbSNP
rs570647484 2753 dbSNP
rs1364557224 2756 dbSNP
rs1181324465 2759 dbSNP
rs1211773702 2760 dbSNP
rs1449385572 2760 dbSNP
rs1482226150 2760 dbSNP
rs993605527 2768 dbSNP
rs1278834637 2770 dbSNP
rs371266511 2775 dbSNP
rs920691929 2776 dbSNP
rs1237859111 2779 dbSNP
rs559111921 2780 dbSNP
rs984048334 2782 dbSNP
rs928150227 2787 dbSNP
rs1294517093 2808 dbSNP
rs112173040 2820 dbSNP
rs1374720441 2822 dbSNP
rs537187826 2827 dbSNP
rs1332148567 2828 dbSNP
rs371552020 2829 dbSNP
rs142289572 2835 dbSNP
rs763433414 2836 dbSNP
rs1241515263 2845 dbSNP
rs963956127 2853 dbSNP
rs367936982 2856 dbSNP
rs187509495 2859 dbSNP
rs957991824 2867 dbSNP
rs904298288 2870 dbSNP
rs1218525172 2878 dbSNP
rs1448133710 2880 dbSNP
rs1238746270 2882 dbSNP
rs2111703 2883 dbSNP
rs573093813 2890 dbSNP
rs1179534700 2892 dbSNP
rs1031957326 2899 dbSNP
rs913532394 2899 dbSNP
rs1233318665 2902 dbSNP
rs1354233222 2903 dbSNP
rs1281972837 2906 dbSNP
rs1432796078 2912 dbSNP
rs1327022163 2913 dbSNP
rs890304332 2919 dbSNP
rs1009108031 2922 dbSNP
rs1403365714 2927 dbSNP
rs926843848 2932 dbSNP
rs1017493800 2936 dbSNP
rs12889449 2937 dbSNP
rs964569416 2941 dbSNP
rs868650052 2943 dbSNP
rs1475986882 2946 dbSNP
rs12888542 2954 dbSNP
rs1242054434 2964 dbSNP
rs1373022103 2972 dbSNP
rs973403846 2973 dbSNP
rs1304039163 2974 dbSNP
rs1254062436 2977 dbSNP
rs1027592695 2981 dbSNP
rs12888557 2985 dbSNP
rs191339313 2988 dbSNP
rs1222919974 2995 dbSNP
rs983546779 2997 dbSNP
rs1287130221 3006 dbSNP
rs564780055 3007 dbSNP
rs530909781 3009 dbSNP
rs1320220388 3013 dbSNP
rs778557003 3016 dbSNP
rs544327993 3019 dbSNP
rs182417056 3041 dbSNP
rs1326391954 3045 dbSNP
rs1251715813 3049 dbSNP
rs1440436036 3051 dbSNP
rs1480185099 3058 dbSNP
rs1348360158 3061 dbSNP
rs1001152739 3062 dbSNP
rs1167225269 3062 dbSNP
rs1193476798 3062 dbSNP
rs1254008402 3062 dbSNP
rs1410625178 3062 dbSNP
rs1456003074 3062 dbSNP
rs1487916378 3062 dbSNP
rs536482699 3062 dbSNP
rs5809677 3062 dbSNP
rs1244635411 3064 dbSNP
rs545985507 3072 dbSNP
rs1269310839 3076 dbSNP
rs1480483175 3077 dbSNP
rs1198022662 3078 dbSNP
rs1226057479 3078 dbSNP
rs1303786191 3079 dbSNP
rs1426801126 3079 dbSNP
rs1437121490 3080 dbSNP
rs1469758211 3080 dbSNP
rs530011608 3080 dbSNP
rs890567040 3080 dbSNP
rs1173342994 3081 dbSNP
rs1478625453 3081 dbSNP
rs1431825204 3082 dbSNP
rs1170906661 3084 dbSNP
rs866137651 3090 dbSNP
rs946934905 3092 dbSNP
rs1250412490 3095 dbSNP
rs996725674 3106 dbSNP
rs1391997708 3111 dbSNP
rs1032094747 3116 dbSNP
rs1209111203 3129 dbSNP
rs1404443981 3140 dbSNP
rs546997199 3148 dbSNP
rs1308943251 3150 dbSNP
rs904181745 3152 dbSNP
rs1224527237 3153 dbSNP
rs1312840965 3154 dbSNP
rs57728072 3154 dbSNP
rs879704829 3154 dbSNP
rs934288028 3154 dbSNP
rs1465020889 3155 dbSNP
rs1347301801 3157 dbSNP
rs1229111643 3169 dbSNP
rs1342420377 3171 dbSNP
rs1219550224 3172 dbSNP
rs988264443 3172 dbSNP
rs1410782568 3174 dbSNP
rs1295110977 3175 dbSNP
rs748990018 3175 dbSNP
rs1475918677 3177 dbSNP
rs1020688753 3178 dbSNP
rs1306720119 3179 dbSNP
rs1181185192 3185 dbSNP
rs1202104707 3187 dbSNP
rs970906121 3192 dbSNP
rs567008542 3205 dbSNP
rs8014107 3206 dbSNP
rs755600054 3213 dbSNP
rs1008697262 3217 dbSNP
rs1266498586 3222 dbSNP
rs1235172641 3224 dbSNP
rs187852558 3233 dbSNP
rs1312163095 3236 dbSNP
rs1394791665 3254 dbSNP
rs900449549 3255 dbSNP
rs994710391 3268 dbSNP
rs1289753529 3276 dbSNP
rs1488980498 3278 dbSNP
rs1186799697 3290 dbSNP
rs1156461019 3292 dbSNP
rs1462733629 3301 dbSNP
rs1349780433 3305 dbSNP
rs1417934465 3308 dbSNP
rs192680421 3309 dbSNP
rs920732980 3320 dbSNP
rs1263781700 3321 dbSNP
rs777598403 3328 dbSNP
rs1048388344 3329 dbSNP
rs1246010417 3338 dbSNP
rs1215768552 3340 dbSNP
rs890545088 3346 dbSNP
rs537126268 3348 dbSNP
rs557056873 3349 dbSNP
rs1264937931 3359 dbSNP
rs184977089 3362 dbSNP
rs1309725343 3367 dbSNP
rs1424637694 3369 dbSNP
rs1296955842 3370 dbSNP
rs1038978948 3381 dbSNP
rs900511725 3383 dbSNP
rs1301832699 3390 dbSNP
rs753584263 3395 dbSNP
rs1032231104 3400 dbSNP
rs756947423 3406 dbSNP
rs778919788 3411 dbSNP
rs1391008054 3414 dbSNP
rs893740884 3432 dbSNP
rs567375196 3433 dbSNP
rs991012410 3435 dbSNP
rs112155477 3442 dbSNP
rs745610737 3444 dbSNP
rs535824369 3456 dbSNP
rs1388078962 3475 dbSNP
rs1195345831 3477 dbSNP
rs1469026936 3479 dbSNP
rs1057500 3484 dbSNP
rs924149620 3488 dbSNP
rs1208092265 3494 dbSNP
rs1481639448 3500 dbSNP
rs1252013115 3504 dbSNP
rs1314673509 3505 dbSNP
rs1228292486 3508 dbSNP
rs1359846199 3511 dbSNP
rs779994858 3515 dbSNP
rs1245235842 3516 dbSNP
rs1235498498 3518 dbSNP
rs1289483665 3528 dbSNP
rs573044834 3530 dbSNP
rs747093714 3535 dbSNP
rs190266186 3536 dbSNP
rs1308175571 3543 dbSNP
rs1429028152 3551 dbSNP
rs1241190062 3553 dbSNP
rs1368639341 3566 dbSNP
rs533252647 3570 dbSNP
rs1175224511 3585 dbSNP
rs1478249477 3605 dbSNP
rs61978905 3612 dbSNP
rs944441531 3614 dbSNP
rs1183213913 3623 dbSNP
rs1196993560 3629 dbSNP
rs1421165446 3631 dbSNP
rs1251327579 3634 dbSNP
rs762084439 3636 dbSNP
rs777380997 3636 dbSNP
rs575131182 3643 dbSNP
rs1482326884 3656 dbSNP
rs1244207964 3669 dbSNP
rs1283116137 3678 dbSNP
rs1211995512 3681 dbSNP
rs1444386276 3688 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUAC-ACGACGAu 5'
               ||: || || ||||||| 
Target 5' --cucACU-UUCUGAUGCUGCUu 3'
1 - 20
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000341162.4 | 3UTR | CUCACUUUCUGAUGCUGCUUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.308 9.1e-4 0.277 2.6e-3 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.632 1.4e-3 0.785 2.1e-5 20 Click to see details
GSE19783 ER- ER- breast cancer 0.292 4.5e-3 0.225 2.3e-2 79 Click to see details
GSE21032 Prostate cancer 0.251 1.1e-2 0.252 1.1e-2 83 Click to see details
GSE38226 Liver fibrosis 0.421 2.9e-2 0.340 6.6e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.493 4.3e-2 -0.500 4.1e-2 13 Click to see details
GSE19350 CNS germ cell tumors 0.484 5.5e-2 0.028 4.7e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.342 7.0e-2 0.383 4.8e-2 20 Click to see details
GSE14794 Lymphoblastoid cells 0.151 7.8e-2 0.174 5.0e-2 90 Click to see details
GSE21687 Ependynoma primary tumors 0.179 7.8e-2 0.165 9.6e-2 64 Click to see details
GSE17498 Multiple myeloma 0.208 9.9e-2 0.065 3.5e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.26 1.1e-1 -0.302 7.6e-2 24 Click to see details
GSE17306 Multiple myeloma 0.171 1.2e-1 0.131 1.8e-1 49 Click to see details
GSE32688 Pancreatic cancer 0.137 2.3e-1 0.389 1.4e-2 32 Click to see details
GSE28544 Breast cancer 0.126 2.8e-1 0.404 2.5e-2 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.094 3.3e-1 0.058 4.0e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.08 3.5e-1 -0.191 1.8e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.069 4.0e-1 -0.050 4.3e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.014 4.7e-1 0.039 4.3e-1 25 Click to see details
GSE21849 B cell lymphoma 0.002 5.0e-1 0.085 3.3e-1 29 Click to see details
GSE21849 B cell lymphoma 0.002 5.0e-1 0.085 3.3e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.429 0 -0.530 0 59 Click to see details
STAD -0.528 0 -0.571 0 32 Click to see details
LIHC -0.268 0.03 -0.218 0.07 49 Click to see details
KIRP -0.243 0.09 -0.224 0.11 32 Click to see details
HNSC 0.163 0.15 0.141 0.19 42 Click to see details
KICH 0.214 0.15 0.294 0.08 25 Click to see details
PRAD -0.135 0.17 -0.214 0.07 50 Click to see details
LUAD -0.28 0.19 -0.343 0.14 12 Click to see details
BLCA -0.192 0.22 -0.222 0.19 18 Click to see details
ESCA -0.19 0.29 0.009 0.49 11 Click to see details
LUSC -0.092 0.29 -0.055 0.37 38 Click to see details
COAD -0.222 0.3 -0.405 0.16 8 Click to see details
BRCA -0.058 0.3 -0.058 0.3 84 Click to see details
PAAD 0.388 0.31 0.200 0.4 4 Click to see details
KIRC 0.06 0.31 0.032 0.4 68 Click to see details
CHOL -0.142 0.36 0.050 0.45 9 Click to see details
PCPG -0.332 0.39 -0.500 0.33 3 Click to see details
UCEC -0.013 0.48 -0.123 0.31 19 Click to see details
CESC 0.05 0.48 -0.500 0.33 3 Click to see details
CESC 0.05 0.48 -0.500 0.33 3 Click to see details
CESC 0.05 0.48 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*