miRTarBase - #MIRT074336 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TNRC6A   
Synonyms CAGH26, GW1, GW182, TNRC6
Description trinucleotide repeat containing 6A
Transcript NM_014494   
Expression
Putative miRNA Targets on TNRC6A
3'UTR of TNRC6A
(miRNA target sites are highlighted)
>TNRC6A|NM_014494|3'UTR
   1 CAGTGTAGATGCAGACTCACCGACCGGGACCTCAGACGCGAGGGAAAGGAGCACTAAGTGGGGCTCGCCGCCTGCAGCCA
  81 GGGGCCGCCTGTGGGAACAGCTATTCTCTGCACATTTTCCACTTTGTTTTCCCCAAAACATATCAGTTTGAATACTTGAA
 161 TCATGCAGGCCAATATTATAATGTGAAAAGGTATCTACTCTATTTACACTCCCAAATAGCGCCATACATGCTAAACCGTA
 241 GAGAATGAGCTCGCTTGTGTCTATTCATCATGTTTAGCCTTTGGATTCTTTTTTTTTTTTTCCTTCTATTCCTCCCCAAC
 321 CCCCCCCCCCGCCCCTTTTTTTCTCTCTTGCAAAACCATTTTTTGGGCTGATAACGTATGAGCTTTTCCCTTTGCACTGA
 401 ATGATGTTCTCTCCGTCTCATCGGCAGTATGGGGGGCAGCTGTCCCAGTGTCAATGTTTACTCAAGGGTGTTCTTAGGAG
 481 GCGTGCGCTCTCTACTATGCCTTGATGTTGCCTACCTTATTGTGGTATCGTGGAGTTTAAAAGATCAAGTTAGGATGCTG
 561 ACTTAGGATTATTAATGAAAGTGTTGCACCAGTTTTTTCATGTTGTAAAACTAAAGAATTTCGCTCTGCAGTTTGAAAAA
 641 CTGTGGCCACAGCTGTGACTTGCAGCCCACCTGCCACCCAGGACGGGCCCTGCACTTTGAATAGGCTTTCCATTTTGTTT
 721 TGGAGGTTCTCACTTTGAACCTTCTTGTTTACAGATTTTTTTGTTTGTTTTTTGAGAAAAAAAAATGTTTACTCTTCCAT
 801 CATTTAAAAAAAATGTAAAAGACAAAAAAAAAATGGAGGATGATTTAAAAGATGCTTTCTATCTCTGGGAAAAAGGAGCA
 881 GCATTTGGCCATGTTCTTTTGTTTTTCTATTCCTGTCCCAAATCAAAGAGCATGGTTCTCAGGAAAACCAGTTCCCCAGT
 961 TTAAAAAAAAAAAAAAAAATTCCTTGTAGTTTCTTAGAGGAAAAAAAGAAAAACCCCAACTTTTAGCACTGATACTACAT
1041 ATTGCTCTGTTAAAGAATTTTCTCTGCCAAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCTGC
1121 TTTCAGATGCTGTCTTTTTATTAGTGAGTGATGATGGTTTGCTAATAATCAATAGGTAATAATTTTTTGTAATCCCATCA
1201 AGTGGCTCCATATGTTTCTGCTCTCTCGTGACTGTGTTAATGTTTAACTGTTGTACCTTAAAGCCGAAATCAGTAACTAT
1281 GCATACTGTAACCAAGGTATTGGGCTTACAGAGTTGTTTGTTGTATAAAGAAAATTTTAAATGTTGTTGCAAACTAACGA
1361 GTTACACCATTTTAAACTTTCTTTCCTCCCCCCTTTTTTTGCCCACAAATGGTATTATAATGCTTGCTTAGTCAAAGAAG
1441 AGAGACTAAACAAGGGTAAAAATTTTAACAGTACAGAATTTGCCATCATATCATTGCCTTGATTCTAACTGTTTGTGTCC
1521 TAAGATGCAAAAGAAGTCAGTGGCTTTTAACTGTTTACAAATAGAATGTGATTGTAAAATGTACAGTTTGGTTGTGTTTG
1601 AATTATGAAATTTCTTCAGATATAATAAACCATGACTTTTTGGCTGCTCAACATTAATTGTCTCCTTTTTGTGAATTTAT
1681 TTGTAGGCTCTTTTTTATAATGAAAGTTTCAAAGTTGCTATGTATGAGGGTTCTCATAGAGCAACCGATTAAAAATCTAA
1761 GCAAATATTTGAACATTTTATCTGAACTCATCACAATTTCACCCTGAAATAATGTGAGAACAATGGGAAACTGTAGCTTG
1841 CTCCTTCCCACCCTCTCTGAGCATCTTTGGGATCTTGTTGCTCAAAACTCTTCTGTGACTTCATCTTCCCCACCATTTGT
1921 GCCCATCTCAAGCCTCAGCAAGAAACCATGTGGAACATGAAGCTTAATGACTTGACAGTGTACTAGTGTTAAACTCTCAT
2001 ACCTCTGTTACAAAGCGAGAAACGCCACACCCGGACTGGCCTTTTCTTCCCCCTTCACGGCCCTCGCTTCTCCCTGCAGG
2081 AGCTCGGGGGCGAAACCTGTGTATGGATTTCAGTGTATGACTTCAGATCATGCTCCAACTTGCCAGGTGTGAGCTAATGT
2161 TGTCGGACACCTTACTATAAGCAAATGTTATTCAGTGCGTTCAATGTATATTGACTTCCATACTGGTTTTTCCAAAAACC
2241 AAAGGTAGCTTTGAAAAACCATGTCTGGAAATGTTTGGAGCGTTAAGCTGATTGACCTTCTGACCTTGGGGCTTTGAGTA
2321 GTATATAATTCATAACTGCGTTAATTGTATTGTTAAAGTGTTTGGGAGTTTTTTGCGCTTGTTATGTGGAAATAAAGTGT
2401 TTGATTTAAAATTTTTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             || |:||  |:||||||| 
Target 5' tctACTCTAT--TTACACTCCc 3'
194 - 213 159.00 -14.20
2
miRNA  3' guUUGUGGUAAC-AGUGUGAGGu 5'
            :|| :||  | |||::|||| 
Target 5' atGACTTCA--GATCATGCTCCa 3'
2117 - 2137 124.00 -13.80
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ::||:| |||:| ||||: 
Target 5' agtGTACTAGTGTTAAACTCTc 3'
1977 - 1998 123.00 -12.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30133739 3 COSMIC
COSN26640182 23 COSMIC
COSN30104763 28 COSMIC
COSN30505010 36 COSMIC
COSN13661912 39 COSMIC
COSN26644775 41 COSMIC
COSN31554333 65 COSMIC
COSN30503522 79 COSMIC
COSN32052917 85 COSMIC
COSN13661913 87 COSMIC
COSN26999352 88 COSMIC
COSN31595426 90 COSMIC
COSN16357193 101 COSMIC
COSN28841103 135 COSMIC
COSN31609355 253 COSMIC
COSN20112785 302 COSMIC
COSN28764158 314 COSMIC
COSN28741179 319 COSMIC
COSN28201856 320 COSMIC
COSN32062117 331 COSMIC
COSN31489885 400 COSMIC
COSN30264726 455 COSMIC
COSN18723483 483 COSMIC
COSN31568063 539 COSMIC
COSN30164829 636 COSMIC
COSN31531085 656 COSMIC
COSN31514805 674 COSMIC
COSN29467725 686 COSMIC
COSN31544911 742 COSMIC
COSN4764850 759 COSMIC
COSN26641120 764 COSMIC
COSN29520813 786 COSMIC
COSN20112786 834 COSMIC
COSN29087179 834 COSMIC
COSN20112788 980 COSMIC
COSN21217512 1127 COSMIC
COSN31584939 1267 COSMIC
COSN31578808 1315 COSMIC
COSN4764851 1338 COSMIC
COSN31538589 1345 COSMIC
COSN28707833 1393 COSMIC
COSN29862008 1401 COSMIC
COSN15843887 1469 COSMIC
COSN30158089 1525 COSMIC
COSN31485454 1610 COSMIC
COSN9644646 1716 COSMIC
COSN31480798 1860 COSMIC
COSN8600964 2004 COSMIC
COSN26249795 2068 COSMIC
COSN31482383 2100 COSMIC
COSN30543619 2106 COSMIC
COSN31520214 2199 COSMIC
COSN31544906 2241 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779177144 3 dbSNP
rs369775152 10 dbSNP
rs745470864 14 dbSNP
rs1270162234 15 dbSNP
rs1023970521 19 dbSNP
rs769330280 19 dbSNP
rs1332568239 20 dbSNP
rs374024750 21 dbSNP
rs16974119 22 dbSNP
rs980334569 23 dbSNP
rs746587478 26 dbSNP
rs201911975 27 dbSNP
rs1249311568 29 dbSNP
rs1456919705 37 dbSNP
rs1472753107 38 dbSNP
rs776682705 39 dbSNP
rs761484749 40 dbSNP
rs2303083 41 dbSNP
rs772893765 53 dbSNP
rs1262410290 54 dbSNP
rs1194061681 55 dbSNP
rs1448523272 57 dbSNP
rs1264052557 58 dbSNP
rs1355723935 60 dbSNP
rs908259934 60 dbSNP
rs1273937127 63 dbSNP
rs755389115 67 dbSNP
rs1178746567 68 dbSNP
rs1400927151 70 dbSNP
rs939862013 71 dbSNP
rs1385910230 79 dbSNP
rs1051658542 87 dbSNP
rs889777251 88 dbSNP
rs1463630403 91 dbSNP
rs919879189 92 dbSNP
rs942733243 104 dbSNP
rs1476262573 124 dbSNP
rs575497066 132 dbSNP
rs894481097 137 dbSNP
rs544392597 144 dbSNP
rs1172596956 145 dbSNP
rs1253892723 174 dbSNP
rs1014650402 183 dbSNP
rs904469402 190 dbSNP
rs1456507383 193 dbSNP
rs1257917848 194 dbSNP
rs531083358 198 dbSNP
rs1031494838 199 dbSNP
rs1273489577 205 dbSNP
rs1233010164 210 dbSNP
rs1371220917 214 dbSNP
rs1327503262 215 dbSNP
rs1373273486 221 dbSNP
rs1446212425 238 dbSNP
rs564258009 239 dbSNP
rs1399770712 248 dbSNP
rs1171732037 253 dbSNP
rs533190289 254 dbSNP
rs1395850221 256 dbSNP
rs1195751774 258 dbSNP
rs1437896123 261 dbSNP
rs1013986683 262 dbSNP
rs1033139033 268 dbSNP
rs1440009295 271 dbSNP
rs1277152639 286 dbSNP
rs1200166898 288 dbSNP
rs11335420 289 dbSNP
rs1237593304 289 dbSNP
rs1349064112 289 dbSNP
rs1375477054 290 dbSNP
rs1186400777 300 dbSNP
rs893270640 300 dbSNP
rs865915359 302 dbSNP
rs1357319424 303 dbSNP
rs1396688562 303 dbSNP
rs1374591517 304 dbSNP
rs1391307471 307 dbSNP
rs1307776778 308 dbSNP
rs1350104018 309 dbSNP
rs1056420243 311 dbSNP
rs1235153044 312 dbSNP
rs1279817104 313 dbSNP
rs1177809167 314 dbSNP
rs892440438 314 dbSNP
rs1346003910 316 dbSNP
rs200245697 318 dbSNP
rs1010087111 319 dbSNP
rs1402582098 319 dbSNP
rs1284561404 320 dbSNP
rs867798764 320 dbSNP
rs879222639 320 dbSNP
rs66925397 321 dbSNP
rs1206269601 322 dbSNP
rs878994148 322 dbSNP
rs1163153307 323 dbSNP
rs1260258273 323 dbSNP
rs1191907780 324 dbSNP
rs1251671369 324 dbSNP
rs1480222810 325 dbSNP
rs1175393120 326 dbSNP
rs1276230290 327 dbSNP
rs1288580366 327 dbSNP
rs1362463970 328 dbSNP
rs1433203814 329 dbSNP
rs1325246613 330 dbSNP
rs1462061800 330 dbSNP
rs1169181841 331 dbSNP
rs55802473 331 dbSNP
rs112183094 332 dbSNP
rs1192489844 336 dbSNP
rs1392815798 337 dbSNP
rs1411293353 338 dbSNP
rs1043624 346 dbSNP
rs1487331040 346 dbSNP
rs1043625 348 dbSNP
rs1024503036 358 dbSNP
rs1469426321 365 dbSNP
rs1170779300 366 dbSNP
rs1218008638 369 dbSNP
rs1307828716 373 dbSNP
rs1297516608 374 dbSNP
rs1355453287 374 dbSNP
rs760479079 376 dbSNP
rs1461831405 377 dbSNP
rs878866995 381 dbSNP
rs1001217039 395 dbSNP
rs1017156606 397 dbSNP
rs1302957628 403 dbSNP
rs1441655141 408 dbSNP
rs1373854047 415 dbSNP
rs546715936 416 dbSNP
rs973430665 420 dbSNP
rs918762935 421 dbSNP
rs779105071 424 dbSNP
rs576408519 431 dbSNP
rs1355459542 432 dbSNP
rs1302768802 436 dbSNP
rs1431804843 438 dbSNP
rs748894948 443 dbSNP
rs955755328 444 dbSNP
rs986891322 446 dbSNP
rs1394035647 450 dbSNP
rs1193935849 454 dbSNP
rs911319646 455 dbSNP
rs1216538980 461 dbSNP
rs942681028 471 dbSNP
rs150174727 472 dbSNP
rs1043710560 475 dbSNP
rs560234888 482 dbSNP
rs748479348 483 dbSNP
rs986856173 484 dbSNP
rs925320403 486 dbSNP
rs935916126 487 dbSNP
rs1306676095 488 dbSNP
rs1202224529 490 dbSNP
rs768415036 491 dbSNP
rs961113049 493 dbSNP
rs1274921731 495 dbSNP
rs1053470297 501 dbSNP
rs1300428240 505 dbSNP
rs973937835 515 dbSNP
rs1375291052 516 dbSNP
rs1173839740 522 dbSNP
rs891612633 528 dbSNP
rs1212451751 530 dbSNP
rs1378122104 531 dbSNP
rs774123661 532 dbSNP
rs1419159061 545 dbSNP
rs1250582823 546 dbSNP
rs1252509111 550 dbSNP
rs1180107051 554 dbSNP
rs919767756 561 dbSNP
rs1280835270 562 dbSNP
rs1045459530 572 dbSNP
rs1350267630 576 dbSNP
rs905612639 577 dbSNP
rs1001166125 579 dbSNP
rs1238343129 587 dbSNP
rs1476136599 592 dbSNP
rs1016604529 593 dbSNP
rs1186712229 596 dbSNP
rs962411048 600 dbSNP
rs1309777551 601 dbSNP
rs990772995 602 dbSNP
rs1355198123 603 dbSNP
rs1313814681 624 dbSNP
rs994414411 625 dbSNP
rs1417043104 627 dbSNP
rs1358160109 642 dbSNP
rs1418388093 650 dbSNP
rs1453838739 671 dbSNP
rs917798146 685 dbSNP
rs1428236724 686 dbSNP
rs1168997978 688 dbSNP
rs528845451 690 dbSNP
rs1474869754 694 dbSNP
rs548967496 699 dbSNP
rs950109451 702 dbSNP
rs772615375 713 dbSNP
rs1487190785 718 dbSNP
rs1397236345 728 dbSNP
rs1045691501 730 dbSNP
rs1204839267 737 dbSNP
rs1462418602 738 dbSNP
rs1351449665 742 dbSNP
rs1325899374 748 dbSNP
rs10055 749 dbSNP
rs1242727201 756 dbSNP
rs1348185379 760 dbSNP
rs138636233 775 dbSNP
rs1054429219 777 dbSNP
rs1235463688 777 dbSNP
rs1294450392 777 dbSNP
rs1382476630 777 dbSNP
rs934753446 777 dbSNP
rs955539099 778 dbSNP
rs893323279 790 dbSNP
rs1270953756 803 dbSNP
rs1476713169 806 dbSNP
rs997395454 806 dbSNP
rs1372326954 808 dbSNP
rs1278892086 816 dbSNP
rs193262905 817 dbSNP
rs1294908218 822 dbSNP
rs1447748229 824 dbSNP
rs1468102165 824 dbSNP
rs35671423 824 dbSNP
rs397829930 824 dbSNP
rs879188852 824 dbSNP
rs1335300558 825 dbSNP
rs1274340571 826 dbSNP
rs1216171426 837 dbSNP
rs1337822459 841 dbSNP
rs1228645980 855 dbSNP
rs911268276 856 dbSNP
rs1439451872 861 dbSNP
rs185042220 862 dbSNP
rs1394663434 865 dbSNP
rs1327798740 868 dbSNP
rs1287689755 874 dbSNP
rs1464042197 875 dbSNP
rs891351489 892 dbSNP
rs551689737 900 dbSNP
rs1168241207 904 dbSNP
rs1448181302 914 dbSNP
rs1374943373 926 dbSNP
rs1192052129 932 dbSNP
rs964105251 934 dbSNP
rs1215907557 958 dbSNP
rs1241098031 959 dbSNP
rs1253750783 960 dbSNP
rs116438855 963 dbSNP
rs1233158764 963 dbSNP
rs1304927273 963 dbSNP
rs1371061099 963 dbSNP
rs35913858 963 dbSNP
rs397855166 963 dbSNP
rs72532675 963 dbSNP
rs869109492 963 dbSNP
rs1443973774 964 dbSNP
rs1484689270 966 dbSNP
rs1335026341 978 dbSNP
rs1189706489 980 dbSNP
rs1411435639 981 dbSNP
rs1399884866 985 dbSNP
rs1007431921 994 dbSNP
rs571483770 998 dbSNP
rs1434391880 1001 dbSNP
rs1395946878 1009 dbSNP
rs36060292 1009 dbSNP
rs1195537307 1020 dbSNP
rs1468673016 1024 dbSNP
rs1232754449 1028 dbSNP
rs1420460636 1033 dbSNP
rs979524988 1035 dbSNP
rs773704200 1052 dbSNP
rs1015259110 1068 dbSNP
rs1348102276 1069 dbSNP
rs201286178 1069 dbSNP
rs960999801 1069 dbSNP
rs925267973 1070 dbSNP
rs935357786 1076 dbSNP
rs1349402290 1078 dbSNP
rs3088119 1079 dbSNP
rs1280061563 1081 dbSNP
rs1053012958 1082 dbSNP
rs1353308819 1086 dbSNP
rs80182361 1087 dbSNP
rs949325592 1094 dbSNP
rs949873439 1095 dbSNP
rs553837294 1097 dbSNP
rs1399015013 1113 dbSNP
rs1407396849 1118 dbSNP
rs1159627021 1121 dbSNP
rs934638250 1122 dbSNP
rs905730506 1127 dbSNP
rs1187594811 1129 dbSNP
rs1054481936 1130 dbSNP
rs1486210117 1130 dbSNP
rs893197533 1135 dbSNP
rs1001284153 1141 dbSNP
rs770506862 1143 dbSNP
rs1398381340 1144 dbSNP
rs539021916 1145 dbSNP
rs1355820914 1149 dbSNP
rs1050344747 1157 dbSNP
rs1037812917 1163 dbSNP
rs898153033 1166 dbSNP
rs1413973224 1167 dbSNP
rs1282307294 1168 dbSNP
rs1292606364 1173 dbSNP
rs1352763474 1177 dbSNP
rs1357201992 1180 dbSNP
rs1304809600 1181 dbSNP
rs1428941427 1190 dbSNP
rs868060435 1192 dbSNP
rs1008493554 1193 dbSNP
rs760639252 1200 dbSNP
rs1458888549 1208 dbSNP
rs1025872658 1209 dbSNP
rs1164901670 1215 dbSNP
rs1475736868 1224 dbSNP
rs189025884 1228 dbSNP
rs1008362925 1229 dbSNP
rs1474849791 1241 dbSNP
rs1212555989 1242 dbSNP
rs1018393872 1258 dbSNP
rs964203326 1265 dbSNP
rs1257839390 1266 dbSNP
rs995144566 1267 dbSNP
rs1486182883 1272 dbSNP
rs1187710977 1276 dbSNP
rs979473104 1284 dbSNP
rs1293113046 1294 dbSNP
rs765241966 1294 dbSNP
rs191600386 1298 dbSNP
rs1361449008 1299 dbSNP
rs988548091 1320 dbSNP
rs1271002663 1324 dbSNP
rs868193337 1326 dbSNP
rs1026764020 1342 dbSNP
rs79620110 1344 dbSNP
rs77976341 1345 dbSNP
rs76813619 1346 dbSNP
rs1417980432 1350 dbSNP
rs959365363 1359 dbSNP
rs949999100 1360 dbSNP
rs1168730341 1364 dbSNP
rs1175716637 1365 dbSNP
rs981397617 1370 dbSNP
rs927095140 1380 dbSNP
rs1413875062 1386 dbSNP
rs1452031872 1387 dbSNP
rs1251884340 1388 dbSNP
rs1331951228 1388 dbSNP
rs937188457 1388 dbSNP
rs1025222558 1389 dbSNP
rs1469729596 1390 dbSNP
rs1038099680 1393 dbSNP
rs1273940023 1394 dbSNP
rs1307915253 1394 dbSNP
rs35836582 1394 dbSNP
rs970546130 1395 dbSNP
rs1278940799 1401 dbSNP
rs1368857721 1402 dbSNP
rs1302689379 1407 dbSNP
rs977996672 1408 dbSNP
rs1373975437 1413 dbSNP
rs1235901186 1418 dbSNP
rs898257964 1419 dbSNP
rs1355517260 1428 dbSNP
rs1346721124 1445 dbSNP
rs1432423160 1449 dbSNP
rs923830155 1456 dbSNP
rs576394480 1462 dbSNP
rs956068707 1470 dbSNP
rs1200171330 1472 dbSNP
rs929619405 1474 dbSNP
rs1480834616 1476 dbSNP
rs1234453386 1477 dbSNP
rs184118898 1479 dbSNP
rs1208482486 1481 dbSNP
rs1345910110 1486 dbSNP
rs1279916649 1489 dbSNP
rs1439978852 1490 dbSNP
rs1314067826 1493 dbSNP
rs1305447370 1498 dbSNP
rs551106658 1505 dbSNP
rs745330343 1505 dbSNP
rs990088164 1506 dbSNP
rs914699235 1511 dbSNP
rs1413360103 1516 dbSNP
rs1374426911 1528 dbSNP
rs188128492 1529 dbSNP
rs1467105435 1531 dbSNP
rs890831582 1538 dbSNP
rs1361631637 1541 dbSNP
rs752758385 1545 dbSNP
rs1158272973 1554 dbSNP
rs1195591684 1556 dbSNP
rs1395846010 1566 dbSNP
rs369706946 1567 dbSNP
rs1018509781 1570 dbSNP
rs1185479729 1575 dbSNP
rs577904467 1577 dbSNP
rs1257046007 1580 dbSNP
rs1171094173 1581 dbSNP
rs1001006648 1582 dbSNP
rs1484272608 1586 dbSNP
rs1259094537 1591 dbSNP
rs1238432731 1592 dbSNP
rs1254576901 1595 dbSNP
rs1318009435 1595 dbSNP
rs1398333611 1597 dbSNP
rs763086256 1600 dbSNP
rs912726818 1601 dbSNP
rs1313109035 1602 dbSNP
rs540438858 1624 dbSNP
rs1328057259 1627 dbSNP
rs1287711695 1628 dbSNP
rs1037302188 1630 dbSNP
rs988275384 1633 dbSNP
rs1162764718 1639 dbSNP
rs867034602 1640 dbSNP
rs995195575 1647 dbSNP
rs1418387312 1650 dbSNP
rs1025392096 1652 dbSNP
rs1048533370 1653 dbSNP
rs1303510028 1665 dbSNP
rs1259956439 1674 dbSNP
rs1425718331 1674 dbSNP
rs1204585074 1676 dbSNP
rs764190009 1701 dbSNP
rs1270544261 1703 dbSNP
rs894929421 1707 dbSNP
rs559946325 1713 dbSNP
rs181078542 1738 dbSNP
rs186087349 1745 dbSNP
rs927210752 1746 dbSNP
rs999302180 1747 dbSNP
rs190211962 1748 dbSNP
rs957943606 1755 dbSNP
rs1366786657 1761 dbSNP
rs937134435 1766 dbSNP
rs531231431 1772 dbSNP
rs767953715 1779 dbSNP
rs973905177 1780 dbSNP
rs919653203 1783 dbSNP
rs1164742472 1787 dbSNP
rs954032781 1795 dbSNP
rs551653455 1797 dbSNP
rs929708337 1802 dbSNP
rs1450165106 1804 dbSNP
rs1250045572 1808 dbSNP
rs1257912741 1813 dbSNP
rs141990413 1824 dbSNP
rs1046833720 1829 dbSNP
rs985968369 1831 dbSNP
rs912200437 1832 dbSNP
rs534084985 1837 dbSNP
rs943719294 1854 dbSNP
rs1211953285 1856 dbSNP
rs912621448 1877 dbSNP
rs1250379287 1886 dbSNP
rs1228768420 1889 dbSNP
rs547586241 1892 dbSNP
rs1300550772 1908 dbSNP
rs1439522197 1910 dbSNP
rs1253689036 1933 dbSNP
rs1432721363 1937 dbSNP
rs944218049 1939 dbSNP
rs1389433601 1946 dbSNP
rs1395594813 1947 dbSNP
rs900094758 1964 dbSNP
rs1454602530 1970 dbSNP
rs778941746 1971 dbSNP
rs1430583523 1979 dbSNP
rs1054352714 1980 dbSNP
rs1171802186 1983 dbSNP
rs1453894137 1995 dbSNP
rs918883359 1997 dbSNP
rs1201695252 2004 dbSNP
rs74015711 2013 dbSNP
rs1010049554 2017 dbSNP
rs879110567 2018 dbSNP
rs1277780139 2024 dbSNP
rs1326565656 2025 dbSNP
rs756705994 2025 dbSNP
rs1276545028 2030 dbSNP
rs1002226022 2033 dbSNP
rs1034228659 2034 dbSNP
rs1411464524 2042 dbSNP
rs1372588567 2044 dbSNP
rs1311344241 2045 dbSNP
rs1319826413 2049 dbSNP
rs1046598573 2052 dbSNP
rs1174812412 2058 dbSNP
rs1469000729 2059 dbSNP
rs958620645 2060 dbSNP
rs1363729406 2062 dbSNP
rs1183293171 2066 dbSNP
rs1326671550 2067 dbSNP
rs906271272 2073 dbSNP
rs1280057997 2079 dbSNP
rs999354569 2082 dbSNP
rs1030783889 2087 dbSNP
rs536766085 2092 dbSNP
rs1011241283 2093 dbSNP
rs1353371676 2099 dbSNP
rs1291662241 2100 dbSNP
rs919753426 2102 dbSNP
rs951273652 2106 dbSNP
rs1028888050 2117 dbSNP
rs954198787 2125 dbSNP
rs556411473 2131 dbSNP
rs576382001 2132 dbSNP
rs201860970 2139 dbSNP
rs1416224219 2142 dbSNP
rs1187698419 2150 dbSNP
rs1208159015 2158 dbSNP
rs1472885192 2158 dbSNP
rs912332484 2165 dbSNP
rs557866811 2166 dbSNP
rs1020141264 2167 dbSNP
rs943668363 2170 dbSNP
rs1445964771 2176 dbSNP
rs748807150 2178 dbSNP
rs1210585543 2189 dbSNP
rs539078650 2199 dbSNP
rs1272246284 2200 dbSNP
rs763085702 2202 dbSNP
rs146301282 2205 dbSNP
rs868243154 2207 dbSNP
rs1054065308 2218 dbSNP
rs1476094545 2218 dbSNP
rs892616522 2225 dbSNP
rs1165511560 2232 dbSNP
rs867028679 2236 dbSNP
rs1009753061 2240 dbSNP
rs1459234854 2245 dbSNP
rs1046897220 2259 dbSNP
rs578002884 2263 dbSNP
rs1164470514 2274 dbSNP
rs540403665 2281 dbSNP
rs1002171897 2283 dbSNP
rs553951215 2284 dbSNP
rs1474792352 2309 dbSNP
rs1455882908 2317 dbSNP
rs182444420 2326 dbSNP
rs1467028526 2328 dbSNP
rs576336798 2333 dbSNP
rs916823819 2334 dbSNP
rs947733138 2337 dbSNP
rs778408080 2340 dbSNP
rs747858867 2341 dbSNP
rs771725778 2350 dbSNP
rs772996631 2355 dbSNP
rs770332920 2359 dbSNP
rs906325421 2360 dbSNP
rs542683022 2363 dbSNP
rs1437409643 2364 dbSNP
rs1338855621 2366 dbSNP
rs1293510254 2367 dbSNP
rs1052093331 2369 dbSNP
rs951265383 2372 dbSNP
rs562488289 2377 dbSNP
rs1294396439 2378 dbSNP
rs531196991 2386 dbSNP
rs1010712481 2387 dbSNP
rs1029354482 2398 dbSNP
rs1242618088 2409 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             || |:||  |:||||||| 
Target 5' ucuACUCUAU--UUACACUCCc 3'
3 - 22
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000395799.3 | 3UTR | UAUCUACUCUAUUUACACUCCCAAAUAGCGCCAUACAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*