miRTarBase - #MIRT074530 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PAGR1   
Synonyms C16orf53, GAS, PA1
Description PAXIP1 associated glutamate rich protein 1
Transcript NM_024516   
Expression
Putative miRNA Targets on PAGR1
3'UTR of PAGR1
(miRNA target sites are highlighted)
>PAGR1|NM_024516|3'UTR
   1 TTCCCACTGCTCCTGCCTCTAGGGTGCAGTGTCCGTACCTGCTGGAGCCTGGGCCCTCCTTCCCCAGCCCAGACATTGAG
  81 AAACTTGGGAAGAAGAGAGAAACCTCAAGCTCCCAAACAGCACGTTGCGGGAAAGAGGAAGAGAGAGTGTGAGTGTGTGT
 161 GTGTGTTTTTTCTATTGAACACCTGTAGAGTGTGTGTGTGTGTTTTCTATTGAACACCTATAGAGAGAGTGTGTGTGTTT
 241 TCTATTGAACATCTATATAGAGAGAGTGTGTGAGTGTGTGTTTTCTATTGAACACCTATTCAGAGACCTGGACTGAATTT
 321 TCTGAGTCTGAAATAAAAGATGCAGAGCTATCATCTCTTAAAAGGAGGGGCTGTAGCTGTAGCTCAACAGTTAGGCCCCA
 401 CTTGAAGGGAGAGGCAGAATTGTACTCACCCAGATTGGAAAATGAAAGCCAGATGGGTAGAGGTGCCCTCAGTTAGCACC
 481 TGTCCCATCTCGGGCCCTCCAACTCCTCCCAGTCCCACTCCAGTGCAGCCAGCTGGCTCCAAGGTAGAAACCCATGAGCA
 561 CTCAGGGAGCAGTGTGCCTTCAGCTGCAGCAGAAGCAGCCCGGAGGATAAAATGAGAACCAGCTGCACACGGGCCCTTTA
 641 ACTCCCAAGCCCCACCCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCAT
 721 CTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATGTGAGTACATTGTACTAGCCCCCCAAACCCCAAATCAGGGGCAG
 801 ATCTTTGTATCCCTTGAGGCTCTCTTTAGTCCTGTCTTGCTTTGAAGGGCCTTGCTTCTGCTGGGGCAGGGAAAACATGT
 881 CTGAATCAGAGTGGGGAAGGAGGATGGGTGGTGGCTTTGCTTTTGGAGGTTTCACTTTCCAATAGTTGGGAGTCTTCTGG
 961 GTTTTGAAGTAAAGGCAGATTAACACCAACACCGGTCCCCCACCCCCCTGCAACTCTCAGGCCTCTCTCTGACTTCAGGG
1041 TCCCACCTGGGAAATCAGGTGGGGAACCTTACAGGGTCATTCAGACCCCATCTTAGCCCTAGATCGGTGCTTGCTCTACT
1121 CACCTGCACTGTCCTGGGGACCTGGGCTCTGGCCTGTCACCTTGAGCTCCAAGAATGTGACCTGTACCCATTCAGGCCCC
1201 TTAACTCTGACAGATGAGGGTTTCTTACTCCTCCATGCAGGGCTGGGCCAGCTGTTGGTCTCAGTCGATCATTCAGGAAG
1281 TCATTAGCAGAGTGATTTCCAGAAGGCGTAGAATTTAGTGACCAAGGTTCTTTCCTTTTTGGGAGGAGAAAGTGAAAACT
1361 AGGATGCTCAGCTGGACCCACCAGCCTGAGATTCTGGGGATTTTAGAGCTGTCCCTTGGGGAGCCAAGCACTTGGGGGTG
1441 GAGGTGATAGCGAGGCTGATGGCCCCTGTGTTCTCAGCTCTCTGCCTGGGTAGCCCCTGGGTGATGGGGGAGAGGCCAGC
1521 TGTCACGTGGGGTATCAGGTGGCTCTGCCAGAAACTCCCTTGGCACACAGAGCACTGGGTCGGCCCTCGGGTGTGGCTGT
1601 TTGGGCAGGACAGCCCTCTGTATGTAGCCTTGAGCAGGTAGGGGGGCCACCTTGAGTGGGTGGCCCAGAGACAGCCTCAG
1681 GGCTCCAAGGTAACGGGGTGCTCAGGTTATCTTGGGTGCTGCCCTCCCAGGTTCTGGGGGAGCAGAGGCTGGGCGCTGGC
1761 CCAACTTACAGGAAACACTCACCTTTGAACTGCCATTAGCACCATCTGGGCAGTACACAGCCCCACCCAGGTCCTCTAGT
1841 TCTTGTTCTCGGCTTAGAATCTTTGTGTTTCTGCCTGAGAAGCCACTGCCTCCTAGTTTGTGGTCTCTACAGTTATAGCC
1921 AGGTTGGACTTCCGGCTCCGTCCTTTGATAACTGTGTGCTCTTGGGCAAATTTCTTAACTTGCAGGTTCTTGTGAGGATA
2001 ACATGAGTTAATTGAGGGCACTTAACACTACCTGGCACAGATTAAGCTCATCTGAAGTGGGAGCTGTTACTTAGGGGCGT
2081 TTGCCTAGAACACAGGGTCCAGAGGCTCTCTCCCGGAAACTTAGACCCAGTGAGTCAGAAGTGAGGCCTGCAAAAAGCAG
2161 CAGGAGTGGGGTTAAGAATTCCAGCCTAGGGCTGGATGCGGTGGCTCAGGCCTGTAATCCCAGTACTTTGGGAGGCCCGA
2241 ATGGGAGGATGGCTTGAGGCCAGGAGTTCCAGACCAGCCTGAGCAACATAGCGAGACCCTGTCTCTGTTTGTGTGTGTGT
2321 GGTTGGGGTTTTGTTTTTTTTTTTTTTTTAAAGAATTATAGCTCAGTCCTATGATTAGGCAAGTTGAGAAAATATTGATG
2401 AAGATCAGGGGTGCTGAAGCCTGGTTCCTGGGGTCGCTTCTGATCTAGGCGGTTCTTGCCTCTGGTGACTGGTGTTAATT
2481 GGCAGGAGTGGGAGGAGGGAGGACAAGTGGAAGTCTAGGCTGGCTGAGCTGTTCTGTCTCGAAAAGTTCCTAAAACTGTG
2561 CTGCTTTAAAAAAAAAAAAAGTAATTTATGAGACACATTCTCAATTTCCATTAATCATCTCCTAAAGGGGGTAAACCAGG
2641 AAGCCGCTGGGTGAAAACAGGCTGTTGGCAATTCCTGAGTCATGTGACCCATTCTCTAAAGACTAGAATATTTAACTTAA
2721 ATCAGTGAGAAACTCTGTGAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||| |    ||||||||| 
Target 5' ccTAAAAC----TGTGCTGCTt 3'
2549 - 2566 154.00 -12.90
2
miRNA  3' guGUUUGGU--AAUACACGACGau 5'
            ||::::|  ||: |||||||  
Target 5' ctCAGGTTATCTTGGGTGCTGCcc 3'
1701 - 1724 142.00 -16.00
3
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            ::|: |:|| || ||| ||| 
Target 5' tcTGAGGCGTT-TGTTGCAGCTa 3'
720 - 741 123.00 -9.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30179059 20 COSMIC
COSN8601078 28 COSMIC
COSN30453595 49 COSMIC
COSN30160033 59 COSMIC
COSN30107150 166 COSMIC
COSN26157580 346 COSMIC
COSN24472116 655 COSMIC
COSN9645427 672 COSMIC
COSN29889898 723 COSMIC
COSN9645428 750 COSMIC
COSN21371108 1037 COSMIC
COSN4765054 1324 COSMIC
COSN9645429 1529 COSMIC
COSN7304040 1734 COSMIC
COSN32055575 1854 COSMIC
COSN27205320 2350 COSMIC
COSN27262594 2350 COSMIC
COSN21147887 2646 COSMIC
COSN32150935 2707 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751301423 6 dbSNP
rs761086468 8 dbSNP
rs1160711791 9 dbSNP
rs764479298 11 dbSNP
rs754176635 13 dbSNP
rs201692748 16 dbSNP
rs976712251 18 dbSNP
rs750513297 19 dbSNP
rs1454829372 23 dbSNP
rs1406886258 25 dbSNP
rs758531223 27 dbSNP
rs780235528 29 dbSNP
rs1456266176 32 dbSNP
rs572116724 35 dbSNP
rs546095977 36 dbSNP
rs747913019 39 dbSNP
rs769709582 42 dbSNP
rs557754421 43 dbSNP
rs1185018219 49 dbSNP
rs1461544110 55 dbSNP
rs1168906108 58 dbSNP
rs576414153 66 dbSNP
rs1207341337 68 dbSNP
rs1448224533 69 dbSNP
rs1053973931 77 dbSNP
rs915434441 79 dbSNP
rs1204507363 85 dbSNP
rs1351208849 91 dbSNP
rs1316952941 94 dbSNP
rs866158125 102 dbSNP
rs552666837 111 dbSNP
rs1167122520 124 dbSNP
rs748692670 125 dbSNP
rs1445831239 129 dbSNP
rs906272325 130 dbSNP
rs1350554568 133 dbSNP
rs1456711476 135 dbSNP
rs1359022052 136 dbSNP
rs944614831 139 dbSNP
rs549866532 144 dbSNP
rs1412536017 145 dbSNP
rs1435693494 145 dbSNP
rs1283420424 147 dbSNP
rs1376643077 148 dbSNP
rs1192815834 149 dbSNP
rs756230640 149 dbSNP
rs1222883213 150 dbSNP
rs571350489 150 dbSNP
rs1289380257 153 dbSNP
rs921883878 153 dbSNP
rs931772433 153 dbSNP
rs1054295809 157 dbSNP
rs1434787979 160 dbSNP
rs1290070702 165 dbSNP
rs534291982 166 dbSNP
rs893220947 166 dbSNP
rs541491881 168 dbSNP
rs1027515663 175 dbSNP
rs1425645214 186 dbSNP
rs1002894063 190 dbSNP
rs907225413 190 dbSNP
rs950614248 193 dbSNP
rs1411344983 199 dbSNP
rs778045235 201 dbSNP
rs1476564952 210 dbSNP
rs1270879581 211 dbSNP
rs1200103958 215 dbSNP
rs1034987476 219 dbSNP
rs1466672554 219 dbSNP
rs1244800152 221 dbSNP
rs577399475 222 dbSNP
rs894736167 222 dbSNP
rs1218019172 227 dbSNP
rs1258959181 227 dbSNP
rs1316176282 228 dbSNP
rs1027194799 229 dbSNP
rs1406144491 229 dbSNP
rs951792815 229 dbSNP
rs983195880 230 dbSNP
rs559920424 231 dbSNP
rs1183822551 234 dbSNP
rs1418930406 236 dbSNP
rs1354699370 239 dbSNP
rs965810960 244 dbSNP
rs1169528814 246 dbSNP
rs965661758 248 dbSNP
rs1472379144 249 dbSNP
rs1463573120 251 dbSNP
rs975780652 252 dbSNP
rs1177028785 253 dbSNP
rs1390883669 253 dbSNP
rs1422781516 254 dbSNP
rs35939759 254 dbSNP
rs747095564 259 dbSNP
rs953358536 259 dbSNP
rs921240859 261 dbSNP
rs1333369891 262 dbSNP
rs1198274057 263 dbSNP
rs183384567 265 dbSNP
rs111407513 266 dbSNP
rs113822254 266 dbSNP
rs1234599241 268 dbSNP
rs954007806 269 dbSNP
rs202155418 272 dbSNP
rs946095234 274 dbSNP
rs989757815 278 dbSNP
rs928716812 280 dbSNP
rs1349549878 288 dbSNP
rs1226159861 289 dbSNP
rs533346488 290 dbSNP
rs1289716671 305 dbSNP
rs1055802683 306 dbSNP
rs915468613 309 dbSNP
rs894717395 312 dbSNP
rs995809514 320 dbSNP
rs1161241788 336 dbSNP
rs771122791 338 dbSNP
rs1329185469 344 dbSNP
rs1178223878 348 dbSNP
rs1438140634 348 dbSNP
rs1245032930 358 dbSNP
rs1206255231 362 dbSNP
rs1278457211 370 dbSNP
rs1048533763 371 dbSNP
rs887302166 381 dbSNP
rs945604648 386 dbSNP
rs1258626995 387 dbSNP
rs1472409459 389 dbSNP
rs1180233972 390 dbSNP
rs1237485283 397 dbSNP
rs776916030 410 dbSNP
rs1014590978 415 dbSNP
rs965824537 421 dbSNP
rs1414304397 423 dbSNP
rs927742196 426 dbSNP
rs1290533494 430 dbSNP
rs1454282124 432 dbSNP
rs997586928 433 dbSNP
rs1156676544 437 dbSNP
rs939068937 439 dbSNP
rs1028690195 445 dbSNP
rs953403674 456 dbSNP
rs759618831 458 dbSNP
rs552077949 460 dbSNP
rs778208468 468 dbSNP
rs1488935527 471 dbSNP
rs1423050069 480 dbSNP
rs1285942438 483 dbSNP
rs1214813780 493 dbSNP
rs1362076599 494 dbSNP
rs894843900 500 dbSNP
rs967173555 503 dbSNP
rs930304430 507 dbSNP
rs1313305538 510 dbSNP
rs1369676024 512 dbSNP
rs1407638102 513 dbSNP
rs977260748 522 dbSNP
rs1400522228 523 dbSNP
rs1049007348 527 dbSNP
rs1339691882 530 dbSNP
rs560108238 534 dbSNP
rs886317504 537 dbSNP
rs1296271990 538 dbSNP
rs147339196 541 dbSNP
rs12149514 543 dbSNP
rs1365990940 548 dbSNP
rs1164029680 551 dbSNP
rs1019165988 552 dbSNP
rs1056191876 554 dbSNP
rs754119223 555 dbSNP
rs1350575128 556 dbSNP
rs901278028 562 dbSNP
rs931541723 568 dbSNP
rs1192153749 569 dbSNP
rs1231977166 575 dbSNP
rs1272558099 584 dbSNP
rs1490936605 584 dbSNP
rs1048604604 589 dbSNP
rs1208865483 590 dbSNP
rs531247075 593 dbSNP
rs1353893995 597 dbSNP
rs1252716758 599 dbSNP
rs554018160 602 dbSNP
rs1028396789 603 dbSNP
rs954058078 607 dbSNP
rs1331444660 611 dbSNP
rs148374749 615 dbSNP
rs1400060447 631 dbSNP
rs989477208 632 dbSNP
rs1333648968 634 dbSNP
rs34103897 635 dbSNP
rs953050627 637 dbSNP
rs1169123818 642 dbSNP
rs879083511 655 dbSNP
rs1254163425 656 dbSNP
rs1378560808 658 dbSNP
rs375274574 660 dbSNP
rs142617284 668 dbSNP
rs914105523 668 dbSNP
rs536569858 671 dbSNP
rs535194601 672 dbSNP
rs1252179673 673 dbSNP
rs978296185 677 dbSNP
rs1198908669 679 dbSNP
rs928097874 683 dbSNP
rs192491449 684 dbSNP
rs764007765 685 dbSNP
rs990563414 697 dbSNP
rs916329613 698 dbSNP
rs751098688 701 dbSNP
rs565903622 705 dbSNP
rs1049173460 710 dbSNP
rs1311711030 713 dbSNP
rs886372279 722 dbSNP
rs960388894 725 dbSNP
rs569135765 728 dbSNP
rs28362601 729 dbSNP
rs28362602 733 dbSNP
rs1477216688 737 dbSNP
rs984087103 738 dbSNP
rs761393970 740 dbSNP
rs901700860 741 dbSNP
rs770852164 742 dbSNP
rs1028448841 743 dbSNP
rs1304731007 744 dbSNP
rs889835117 747 dbSNP
rs1341898777 750 dbSNP
rs1277765715 751 dbSNP
rs940309609 752 dbSNP
rs1226732656 753 dbSNP
rs1352535685 753 dbSNP
rs1277190378 754 dbSNP
rs1241128444 763 dbSNP
rs1376360828 765 dbSNP
rs1010919275 766 dbSNP
rs1307355664 771 dbSNP
rs1041181828 775 dbSNP
rs1340375917 775 dbSNP
rs1450252772 775 dbSNP
rs901364705 776 dbSNP
rs1362843933 781 dbSNP
rs376946061 781 dbSNP
rs1159693662 786 dbSNP
rs1419482662 790 dbSNP
rs1050154052 793 dbSNP
rs1183256275 794 dbSNP
rs1472826091 796 dbSNP
rs1453344860 800 dbSNP
rs888870431 801 dbSNP
rs1185324415 804 dbSNP
rs1448721315 808 dbSNP
rs1286667173 809 dbSNP
rs1011208643 819 dbSNP
rs1351276920 825 dbSNP
rs1021340810 828 dbSNP
rs766882805 832 dbSNP
rs750115980 852 dbSNP
rs1283746038 854 dbSNP
rs1446448294 857 dbSNP
rs903095638 861 dbSNP
rs1299371705 865 dbSNP
rs998801876 868 dbSNP
rs1194194358 871 dbSNP
rs1359078860 871 dbSNP
rs1166427130 877 dbSNP
rs1405661939 879 dbSNP
rs978778961 885 dbSNP
rs1035915737 888 dbSNP
rs1035271582 891 dbSNP
rs959878129 892 dbSNP
rs991747023 897 dbSNP
rs960900564 899 dbSNP
rs1192884158 906 dbSNP
rs1487174436 921 dbSNP
rs1023018174 939 dbSNP
rs1224046550 946 dbSNP
rs200860909 947 dbSNP
rs373174085 954 dbSNP
rs576397425 958 dbSNP
rs984075787 962 dbSNP
rs908577430 970 dbSNP
rs940256260 971 dbSNP
rs1161044548 972 dbSNP
rs1279361478 974 dbSNP
rs1392273679 976 dbSNP
rs1338895748 977 dbSNP
rs543700012 980 dbSNP
rs1295712912 988 dbSNP
rs1437645877 990 dbSNP
rs990910023 991 dbSNP
rs188100885 994 dbSNP
rs1321212516 995 dbSNP
rs1319294896 1001 dbSNP
rs916341304 1002 dbSNP
rs932801506 1003 dbSNP
rs1169837859 1004 dbSNP
rs951772197 1008 dbSNP
rs945439492 1009 dbSNP
rs907559026 1012 dbSNP
rs940354650 1013 dbSNP
rs1040726482 1015 dbSNP
rs923178603 1017 dbSNP
rs1459118805 1021 dbSNP
rs1258868696 1022 dbSNP
rs781639765 1023 dbSNP
rs1263838056 1027 dbSNP
rs998541741 1030 dbSNP
rs1304056186 1031 dbSNP
rs1220136839 1035 dbSNP
rs574056628 1037 dbSNP
rs1035586384 1040 dbSNP
rs931804155 1046 dbSNP
rs1448586429 1048 dbSNP
rs1400386610 1050 dbSNP
rs895732106 1055 dbSNP
rs1358732942 1056 dbSNP
rs9923649 1064 dbSNP
rs191783168 1065 dbSNP
rs1011383521 1068 dbSNP
rs1432359858 1073 dbSNP
rs1005613802 1081 dbSNP
rs1191978061 1090 dbSNP
rs1043798434 1091 dbSNP
rs1239030865 1095 dbSNP
rs769355783 1103 dbSNP
rs902547978 1104 dbSNP
rs1262194738 1105 dbSNP
rs999532088 1106 dbSNP
rs1035684513 1107 dbSNP
rs960912616 1108 dbSNP
rs961330662 1111 dbSNP
rs977166334 1115 dbSNP
rs1012385079 1117 dbSNP
rs1380769240 1122 dbSNP
rs1303323392 1126 dbSNP
rs759028345 1129 dbSNP
rs1023737121 1142 dbSNP
rs954482375 1145 dbSNP
rs985639248 1150 dbSNP
rs1420085067 1153 dbSNP
rs952198075 1155 dbSNP
rs915442642 1159 dbSNP
rs1157831287 1165 dbSNP
rs984974667 1167 dbSNP
rs947101916 1168 dbSNP
rs778336749 1171 dbSNP
rs962051795 1188 dbSNP
rs1219167303 1201 dbSNP
rs1354912690 1205 dbSNP
rs934282929 1212 dbSNP
rs1057206098 1213 dbSNP
rs1386143257 1217 dbSNP
rs1312879546 1218 dbSNP
rs975733216 1221 dbSNP
rs1394959449 1228 dbSNP
rs1395881593 1229 dbSNP
rs371957150 1231 dbSNP
rs1357656825 1235 dbSNP
rs1434845375 1236 dbSNP
rs1359718945 1239 dbSNP
rs931856664 1246 dbSNP
rs1050269370 1250 dbSNP
rs533620068 1254 dbSNP
rs914431878 1258 dbSNP
rs1370257497 1259 dbSNP
rs1411938924 1263 dbSNP
rs1423325278 1267 dbSNP
rs539740237 1268 dbSNP
rs75060591 1269 dbSNP
rs902558749 1276 dbSNP
rs1005353665 1283 dbSNP
rs1262996558 1291 dbSNP
rs999943039 1295 dbSNP
rs78193656 1306 dbSNP
rs549234731 1308 dbSNP
rs1012479433 1309 dbSNP
rs1485814095 1309 dbSNP
rs1023830717 1310 dbSNP
rs1180949587 1312 dbSNP
rs774969276 1313 dbSNP
rs1316033137 1314 dbSNP
rs771055518 1315 dbSNP
rs1393068415 1317 dbSNP
rs1159191732 1318 dbSNP
rs1364939812 1324 dbSNP
rs1030110767 1328 dbSNP
rs1173446089 1334 dbSNP
rs1006384890 1335 dbSNP
rs1465961869 1341 dbSNP
rs1423554722 1349 dbSNP
rs986141204 1356 dbSNP
rs184229320 1362 dbSNP
rs1015088738 1367 dbSNP
rs961784592 1368 dbSNP
rs915516395 1373 dbSNP
rs1267551260 1378 dbSNP
rs976165639 1380 dbSNP
rs1301497986 1389 dbSNP
rs1466726259 1395 dbSNP
rs978265930 1403 dbSNP
rs781082934 1426 dbSNP
rs953006701 1427 dbSNP
rs1268352008 1430 dbSNP
rs1235096525 1431 dbSNP
rs1307588464 1432 dbSNP
rs1302223858 1436 dbSNP
rs1056784805 1439 dbSNP
rs1392355327 1442 dbSNP
rs1348710146 1445 dbSNP
rs1225599818 1449 dbSNP
rs762719348 1452 dbSNP
rs746120209 1453 dbSNP
rs1311579729 1458 dbSNP
rs1044261798 1463 dbSNP
rs1452251183 1464 dbSNP
rs1239634643 1468 dbSNP
rs768460479 1469 dbSNP
rs947212349 1493 dbSNP
rs888369878 1495 dbSNP
rs1456956921 1498 dbSNP
rs1348260101 1500 dbSNP
rs567731333 1501 dbSNP
rs1005302839 1506 dbSNP
rs367857034 1506 dbSNP
rs1202159175 1508 dbSNP
rs1345420178 1510 dbSNP
rs1255247194 1527 dbSNP
rs1204010536 1528 dbSNP
rs1036864756 1533 dbSNP
rs769981195 1548 dbSNP
rs1447544506 1550 dbSNP
rs1335299683 1552 dbSNP
rs1327400164 1555 dbSNP
rs1416717040 1555 dbSNP
rs1177328296 1559 dbSNP
rs1173343272 1560 dbSNP
rs935407574 1564 dbSNP
rs1266019299 1565 dbSNP
rs775322581 1567 dbSNP
rs998705650 1569 dbSNP
rs762733901 1571 dbSNP
rs1230722822 1573 dbSNP
rs768375761 1574 dbSNP
rs1442871176 1579 dbSNP
rs948047942 1582 dbSNP
rs1208409002 1583 dbSNP
rs528844233 1583 dbSNP
rs1435654854 1585 dbSNP
rs1355611929 1588 dbSNP
rs1045326749 1589 dbSNP
rs558661906 1590 dbSNP
rs1350040393 1591 dbSNP
rs887995115 1600 dbSNP
rs1328885795 1601 dbSNP
rs547499735 1603 dbSNP
rs978255905 1609 dbSNP
rs1298854602 1610 dbSNP
rs1031201836 1612 dbSNP
rs955796031 1614 dbSNP
rs565637672 1617 dbSNP
rs1298401958 1619 dbSNP
rs1405356244 1619 dbSNP
rs917017284 1619 dbSNP
rs576877456 1621 dbSNP
rs1472857313 1623 dbSNP
rs1417012612 1624 dbSNP
rs767090611 1628 dbSNP
rs1227466553 1631 dbSNP
rs1217607206 1635 dbSNP
rs139344689 1636 dbSNP
rs909800832 1640 dbSNP
rs997290717 1640 dbSNP
rs941315875 1645 dbSNP
rs1232048363 1651 dbSNP
rs1030072694 1652 dbSNP
rs551296349 1661 dbSNP
rs985754959 1667 dbSNP
rs1021562035 1670 dbSNP
rs1204727734 1673 dbSNP
rs889887826 1679 dbSNP
rs1162687066 1685 dbSNP
rs569821107 1687 dbSNP
rs968636174 1689 dbSNP
rs1022346762 1695 dbSNP
rs1185657291 1696 dbSNP
rs1467773896 1701 dbSNP
rs1240532861 1706 dbSNP
rs1224104225 1709 dbSNP
rs1468946495 1712 dbSNP
rs977678456 1716 dbSNP
rs1272683455 1717 dbSNP
rs1212357445 1718 dbSNP
rs1320554645 1719 dbSNP
rs1279416010 1722 dbSNP
rs1214313815 1724 dbSNP
rs537365225 1730 dbSNP
rs1276230799 1735 dbSNP
rs1436828056 1749 dbSNP
rs1487185585 1753 dbSNP
rs1466744177 1754 dbSNP
rs749865519 1755 dbSNP
rs1192312860 1763 dbSNP
rs938502667 1765 dbSNP
rs1427062037 1768 dbSNP
rs992239646 1768 dbSNP
rs904090324 1770 dbSNP
rs1252629813 1777 dbSNP
rs917996790 1779 dbSNP
rs1459171472 1780 dbSNP
rs555667451 1783 dbSNP
rs774849208 1784 dbSNP
rs961129364 1787 dbSNP
rs1045008972 1791 dbSNP
rs12149746 1799 dbSNP
rs558025480 1800 dbSNP
rs1188379376 1803 dbSNP
rs766114072 1815 dbSNP
rs1037002987 1819 dbSNP
rs898022816 1822 dbSNP
rs1024434340 1823 dbSNP
rs1300831512 1825 dbSNP
rs1411891310 1828 dbSNP
rs534703771 1830 dbSNP
rs1297513257 1831 dbSNP
rs1440003342 1832 dbSNP
rs1176429940 1834 dbSNP
rs553472172 1838 dbSNP
rs979730174 1843 dbSNP
rs1394665038 1845 dbSNP
rs1051512935 1852 dbSNP
rs1349378984 1862 dbSNP
rs1441600665 1862 dbSNP
rs1251410727 1875 dbSNP
rs112549897 1876 dbSNP
rs545434646 1880 dbSNP
rs1479906676 1885 dbSNP
rs1007247134 1889 dbSNP
rs758836885 1894 dbSNP
rs1371703676 1899 dbSNP
rs1434243748 1901 dbSNP
rs918525567 1906 dbSNP
rs563560179 1909 dbSNP
rs1316968975 1910 dbSNP
rs1363752554 1912 dbSNP
rs1221574988 1916 dbSNP
rs1381199282 1917 dbSNP
rs1303393238 1920 dbSNP
rs933785973 1925 dbSNP
rs998814399 1933 dbSNP
rs777941165 1934 dbSNP
rs1311483828 1935 dbSNP
rs1421826268 1936 dbSNP
rs752128297 1939 dbSNP
rs1319546926 1940 dbSNP
rs575396825 1941 dbSNP
rs188964304 1944 dbSNP
rs889868587 1949 dbSNP
rs1273242474 1950 dbSNP
rs770370845 1953 dbSNP
rs992578627 1953 dbSNP
rs918008185 1955 dbSNP
rs969414310 1969 dbSNP
rs1485950400 1974 dbSNP
rs1259794431 1976 dbSNP
rs1212991329 1979 dbSNP
rs980756954 1985 dbSNP
rs1293812717 1993 dbSNP
rs1232664955 1998 dbSNP
rs566656583 1999 dbSNP
rs1043725285 2003 dbSNP
rs903830588 2004 dbSNP
rs1476558693 2005 dbSNP
rs999537713 2018 dbSNP
rs1385880556 2021 dbSNP
rs909236643 2028 dbSNP
rs942013228 2033 dbSNP
rs1036650461 2061 dbSNP
rs1053080630 2062 dbSNP
rs919464366 2064 dbSNP
rs750944233 2067 dbSNP
rs933483352 2080 dbSNP
rs561225818 2088 dbSNP
rs192300272 2089 dbSNP
rs1370105815 2095 dbSNP
rs184858965 2109 dbSNP
rs559264344 2113 dbSNP
rs1196223321 2114 dbSNP
rs1043186896 2115 dbSNP
rs532890028 2116 dbSNP
rs551429703 2119 dbSNP
rs1489169303 2122 dbSNP
rs1273343399 2125 dbSNP
rs533903453 2126 dbSNP
rs1212530901 2144 dbSNP
rs1332516187 2145 dbSNP
rs1259941282 2151 dbSNP
rs1346750142 2154 dbSNP
rs1325680614 2157 dbSNP
rs1295095969 2161 dbSNP
rs970198389 2166 dbSNP
rs1380800572 2168 dbSNP
rs1431288962 2172 dbSNP
rs1001263439 2177 dbSNP
rs1460995126 2182 dbSNP
rs569882941 2184 dbSNP
rs745935032 2189 dbSNP
rs1031588085 2190 dbSNP
rs1016657986 2191 dbSNP
rs959911652 2193 dbSNP
rs1014054862 2196 dbSNP
rs1372928575 2197 dbSNP
rs1022727597 2200 dbSNP
rs537228295 2201 dbSNP
rs1253256191 2203 dbSNP
rs1192408051 2204 dbSNP
rs189411077 2208 dbSNP
rs969845118 2210 dbSNP
rs1234711431 2218 dbSNP
rs1239901363 2221 dbSNP
rs1293404463 2230 dbSNP
rs1196358644 2232 dbSNP
rs3178910 2239 dbSNP
rs780260488 2240 dbSNP
rs749456660 2242 dbSNP
rs534876639 2250 dbSNP
rs1440229076 2262 dbSNP
rs1368939466 2264 dbSNP
rs1282854322 2270 dbSNP
rs972440607 2281 dbSNP
rs1331446328 2283 dbSNP
rs1392553069 2284 dbSNP
rs1396419782 2288 dbSNP
rs1449227488 2288 dbSNP
rs1217018466 2293 dbSNP
rs1237231992 2294 dbSNP
rs1436995623 2294 dbSNP
rs1172669071 2306 dbSNP
rs774836639 2306 dbSNP
rs1190271079 2308 dbSNP
rs1043802741 2310 dbSNP
rs1437090494 2310 dbSNP
rs181008451 2310 dbSNP
rs942526961 2310 dbSNP
rs1418679498 2311 dbSNP
rs1472266448 2324 dbSNP
rs933537276 2328 dbSNP
rs1156888698 2329 dbSNP
rs1281283761 2329 dbSNP
rs925365322 2330 dbSNP
rs1335637709 2333 dbSNP
rs1410145996 2333 dbSNP
rs1158578414 2334 dbSNP
rs1301177083 2334 dbSNP
rs1409710285 2334 dbSNP
rs201002535 2334 dbSNP
rs758990672 2334 dbSNP
rs77789265 2334 dbSNP
rs1052484378 2336 dbSNP
rs1361950165 2338 dbSNP
rs896723412 2338 dbSNP
rs1045623025 2339 dbSNP
rs79709976 2339 dbSNP
rs8061634 2340 dbSNP
rs1401191986 2341 dbSNP
rs1205748148 2344 dbSNP
rs1350097217 2346 dbSNP
rs1278271921 2347 dbSNP
rs1006359609 2350 dbSNP
rs1356499197 2350 dbSNP
rs1333303448 2351 dbSNP
rs1357170668 2359 dbSNP
rs1346546668 2363 dbSNP
rs186421319 2369 dbSNP
rs1313040204 2370 dbSNP
rs1349494893 2372 dbSNP
rs114645044 2373 dbSNP
rs1475457847 2376 dbSNP
rs1280764931 2378 dbSNP
rs1185472280 2394 dbSNP
rs1417100296 2394 dbSNP
rs575461805 2396 dbSNP
rs962440662 2403 dbSNP
rs1194228851 2406 dbSNP
rs1446486550 2407 dbSNP
rs1282328899 2410 dbSNP
rs1057451 2414 dbSNP
rs561289137 2425 dbSNP
rs1224789146 2437 dbSNP
rs1273127485 2439 dbSNP
rs1231797339 2441 dbSNP
rs1364570647 2446 dbSNP
rs1278390665 2451 dbSNP
rs771878611 2452 dbSNP
rs573469949 2453 dbSNP
rs1461530490 2461 dbSNP
rs1393589154 2463 dbSNP
rs1162757506 2466 dbSNP
rs755164361 2476 dbSNP
rs772833341 2483 dbSNP
rs1042853236 2502 dbSNP
rs540874262 2505 dbSNP
rs1246437858 2508 dbSNP
rs1195522455 2513 dbSNP
rs1468986834 2520 dbSNP
rs955460153 2522 dbSNP
rs986708630 2530 dbSNP
rs1274075066 2535 dbSNP
rs1214366473 2537 dbSNP
rs1179803836 2541 dbSNP
rs1440965088 2542 dbSNP
rs1369676166 2553 dbSNP
rs1323793933 2559 dbSNP
rs911141081 2567 dbSNP
rs1258753833 2568 dbSNP
rs1394628913 2568 dbSNP
rs1454744294 2568 dbSNP
rs375351603 2568 dbSNP
rs529186812 2568 dbSNP
rs530979533 2568 dbSNP
rs532842644 2568 dbSNP
rs58807414 2568 dbSNP
rs796745076 2568 dbSNP
rs1481875803 2577 dbSNP
rs904229934 2578 dbSNP
rs1204218665 2580 dbSNP
rs1234637988 2580 dbSNP
rs1482302236 2584 dbSNP
rs1281996509 2593 dbSNP
rs1470488057 2595 dbSNP
rs1300541241 2597 dbSNP
rs1346514661 2597 dbSNP
rs1171878929 2600 dbSNP
rs1224979616 2604 dbSNP
rs189455120 2606 dbSNP
rs979260956 2610 dbSNP
rs925355465 2611 dbSNP
rs1436430683 2619 dbSNP
rs1053169161 2621 dbSNP
rs1314987886 2630 dbSNP
rs1435501380 2632 dbSNP
rs1375087448 2633 dbSNP
rs1173987081 2637 dbSNP
rs1057452 2640 dbSNP
rs1014148289 2646 dbSNP
rs776435315 2647 dbSNP
rs1045292485 2648 dbSNP
rs942165207 2653 dbSNP
rs1485106167 2665 dbSNP
rs113346199 2672 dbSNP
rs372509975 2676 dbSNP
rs1217255464 2690 dbSNP
rs1443582952 2692 dbSNP
rs898244329 2695 dbSNP
rs1022823842 2697 dbSNP
rs1237034502 2712 dbSNP
rs1226557405 2715 dbSNP
rs1357298242 2717 dbSNP
rs993962270 2717 dbSNP
rs1281465984 2723 dbSNP
rs1025831985 2725 dbSNP
rs534218131 2733 dbSNP
rs761466903 2736 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||| |    ||||||||| 
Target 5' ccUAAAAC----UGUGCUGCUu 3'
4 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000320330.6 | 3UTR | GUUCCUAAAACUGUGCUGCUUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000320330.6 | 3UTR | UUCCUAAAACUGUGCUGCUUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000320330.6 | 3UTR | UUCCUAAAACUGUGCUGCUUUAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*