miRTarBase - #MIRT075273 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol VPS4A   
Synonyms SKD1, SKD1A, SKD2, VPS4, VPS4-1
Description vacuolar protein sorting 4 homolog A
Transcript NM_013245   
Putative miRNA Targets on VPS4A
3'UTR of VPS4A
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            | ||  ||||  ||||||| 
Target 5' ccCTAA--ATTA-ATGCTGCTt 3'
286 - 304 151.00 -9.60
             :|| ||    |||||||  
Target 5' ggaGAAGCA-GCCGTGCTGCca 3'
372 - 392 126.00 -11.50
miRNA  3' guguuugguaauacaCGACGAu 5'
Target 5' -------------aaGCTGCTt 3'
1 - 9 120.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30523048 11 COSMIC
COSN30151864 14 COSMIC
COSN26563611 23 COSMIC
COSN30513196 43 COSMIC
COSN31552055 66 COSMIC
COSN7269298 133 COSMIC
COSN31605949 134 COSMIC
COSN9441033 186 COSMIC
COSN31575539 224 COSMIC
COSN22130537 278 COSMIC
COSN16485525 540 COSMIC
COSN29360022 635 COSMIC
COSN23216636 1260 COSMIC
COSN22363068 1545 COSMIC
COSN1707068 1607 COSMIC
COSN20923364 1675 COSMIC
COSN25525767 1736 COSMIC
COSN49958 2047 COSMIC
COSN9651625 2332 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781497327 3 dbSNP
rs574134904 5 dbSNP
rs769990140 7 dbSNP
rs774386992 8 dbSNP
rs752367615 16 dbSNP
rs374643844 17 dbSNP
rs539898670 21 dbSNP
rs746416214 21 dbSNP
rs907775197 22 dbSNP
rs771995634 23 dbSNP
rs772909486 25 dbSNP
rs1432200519 29 dbSNP
rs760392264 32 dbSNP
rs766029964 36 dbSNP
rs1388937519 37 dbSNP
rs758853124 37 dbSNP
rs116767947 42 dbSNP
rs1473248389 44 dbSNP
rs759118405 45 dbSNP
rs764625263 47 dbSNP
rs1203910904 48 dbSNP
rs753299394 49 dbSNP
rs1180081701 51 dbSNP
rs868855113 52 dbSNP
rs1337789225 54 dbSNP
rs544747473 67 dbSNP
rs557032749 72 dbSNP
rs901654462 80 dbSNP
rs998681209 81 dbSNP
rs1287452030 85 dbSNP
rs1339688173 86 dbSNP
rs575706611 86 dbSNP
rs542815490 91 dbSNP
rs745927550 92 dbSNP
rs1000152283 98 dbSNP
rs1033245357 99 dbSNP
rs907773699 100 dbSNP
rs540629320 114 dbSNP
rs1226211609 116 dbSNP
rs1294795770 116 dbSNP
rs1010457429 118 dbSNP
rs973241865 121 dbSNP
rs1204298657 124 dbSNP
rs1244894748 131 dbSNP
rs1024911318 132 dbSNP
rs560314246 133 dbSNP
rs573241189 134 dbSNP
rs1157166764 144 dbSNP
rs1475886409 148 dbSNP
rs1412725082 151 dbSNP
rs760790452 152 dbSNP
rs1471116892 160 dbSNP
rs758034732 164 dbSNP
rs1451914908 172 dbSNP
rs980266924 173 dbSNP
rs1423225787 174 dbSNP
rs1233410316 175 dbSNP
rs865828638 177 dbSNP
rs16958753 179 dbSNP
rs562193676 181 dbSNP
rs904664571 185 dbSNP
rs907509965 187 dbSNP
rs1373562140 190 dbSNP
rs1433290936 192 dbSNP
rs940622490 193 dbSNP
rs996339215 194 dbSNP
rs532561716 199 dbSNP
rs756359605 199 dbSNP
rs1432524871 201 dbSNP
rs1161421901 202 dbSNP
rs1040254136 203 dbSNP
rs1424574629 209 dbSNP
rs1171885724 211 dbSNP
rs751094543 217 dbSNP
rs1464140390 218 dbSNP
rs1248313355 221 dbSNP
rs1217528559 222 dbSNP
rs374298689 225 dbSNP
rs931827754 226 dbSNP
rs1277305722 229 dbSNP
rs1220261534 236 dbSNP
rs1049842148 249 dbSNP
rs1264870338 250 dbSNP
rs1295853788 252 dbSNP
rs1327035470 256 dbSNP
rs1207842449 257 dbSNP
rs1284752049 258 dbSNP
rs373089255 258 dbSNP
rs1290801974 261 dbSNP
rs1447783777 262 dbSNP
rs889852964 263 dbSNP
rs11548445 264 dbSNP
rs1491119265 264 dbSNP
rs1390595807 265 dbSNP
rs1482079449 265 dbSNP
rs1491571092 265 dbSNP
rs768997456 266 dbSNP
rs973294045 272 dbSNP
rs530575855 273 dbSNP
rs1027915254 276 dbSNP
rs891773756 278 dbSNP
rs1200262696 293 dbSNP
rs969235733 293 dbSNP
rs16958754 303 dbSNP
rs1226762259 314 dbSNP
rs1378788089 315 dbSNP
rs567559483 316 dbSNP
rs190048746 320 dbSNP
rs1284826669 321 dbSNP
rs546936117 322 dbSNP
rs1024527133 328 dbSNP
rs1368819310 330 dbSNP
rs907399950 331 dbSNP
rs1001700872 338 dbSNP
rs1158865996 340 dbSNP
rs927400289 342 dbSNP
rs1354843782 347 dbSNP
rs1172343048 354 dbSNP
rs938720444 355 dbSNP
rs1034128863 361 dbSNP
rs571119971 362 dbSNP
rs984514983 363 dbSNP
rs1204987561 364 dbSNP
rs529489461 369 dbSNP
rs946318037 370 dbSNP
rs1043282598 371 dbSNP
rs1284693224 377 dbSNP
rs1014599586 378 dbSNP
rs1348531467 381 dbSNP
rs148649560 384 dbSNP
rs976437269 385 dbSNP
rs556732670 387 dbSNP
rs923208684 388 dbSNP
rs931829526 390 dbSNP
rs753910724 398 dbSNP
rs1299638530 399 dbSNP
rs1456243278 404 dbSNP
rs890199732 406 dbSNP
rs1165144961 412 dbSNP
rs1462693170 413 dbSNP
rs985915886 417 dbSNP
rs1207857342 418 dbSNP
rs1190009054 428 dbSNP
rs1488338291 431 dbSNP
rs1247665237 433 dbSNP
rs749749289 434 dbSNP
rs79793182 435 dbSNP
rs1229132570 439 dbSNP
rs113745190 445 dbSNP
rs1271207051 446 dbSNP
rs1232486914 449 dbSNP
rs1366557349 451 dbSNP
rs554776574 459 dbSNP
rs1442627260 460 dbSNP
rs140117270 473 dbSNP
rs1157728081 477 dbSNP
rs1453797181 482 dbSNP
rs891800636 483 dbSNP
rs540499226 484 dbSNP
rs969668668 485 dbSNP
rs980623523 489 dbSNP
rs569484364 492 dbSNP
rs565588216 500 dbSNP
rs960115326 505 dbSNP
rs1046443228 506 dbSNP
rs1471331978 507 dbSNP
rs907434016 509 dbSNP
rs913246664 518 dbSNP
rs769177036 519 dbSNP
rs1311589502 520 dbSNP
rs1303864273 527 dbSNP
rs1236266296 530 dbSNP
rs1034534252 533 dbSNP
rs887905759 539 dbSNP
rs1362800646 541 dbSNP
rs1382443820 544 dbSNP
rs946035174 544 dbSNP
rs1304417300 549 dbSNP
rs979446779 553 dbSNP
rs779375705 555 dbSNP
rs1465977188 556 dbSNP
rs1396252655 562 dbSNP
rs932174455 563 dbSNP
rs1307549633 564 dbSNP
rs1050623539 565 dbSNP
rs912041153 566 dbSNP
rs944453367 572 dbSNP
rs1036101554 574 dbSNP
rs1276457497 575 dbSNP
rs1200007963 576 dbSNP
rs1283425128 576 dbSNP
rs1281009712 578 dbSNP
rs1014666616 584 dbSNP
rs577123765 588 dbSNP
rs1049485964 590 dbSNP
rs975753118 592 dbSNP
rs544597285 594 dbSNP
rs779599493 595 dbSNP
rs953311546 600 dbSNP
rs1428384194 602 dbSNP
rs746182720 604 dbSNP
rs1195321927 615 dbSNP
rs1251818286 617 dbSNP
rs1440095651 619 dbSNP
rs960497010 621 dbSNP
rs112064500 622 dbSNP
rs1186899651 623 dbSNP
rs1014319848 624 dbSNP
rs182699507 626 dbSNP
rs562841033 637 dbSNP
rs1444859219 638 dbSNP
rs530260252 639 dbSNP
rs967821707 647 dbSNP
rs1196200110 654 dbSNP
rs978776080 655 dbSNP
rs925911194 657 dbSNP
rs148340997 664 dbSNP
rs1461001830 671 dbSNP
rs1355466250 675 dbSNP
rs1294611402 678 dbSNP
rs1298284781 679 dbSNP
rs1408522508 680 dbSNP
rs925121750 681 dbSNP
rs1398508743 682 dbSNP
rs1394272026 684 dbSNP
rs1389048919 685 dbSNP
rs1162823929 690 dbSNP
rs1335830575 690 dbSNP
rs936475234 693 dbSNP
rs1471552080 694 dbSNP
rs990229100 694 dbSNP
rs986761062 696 dbSNP
rs879706300 704 dbSNP
rs12258 705 dbSNP
rs772099788 707 dbSNP
rs1212616984 709 dbSNP
rs946063161 714 dbSNP
rs772224184 716 dbSNP
rs1226079583 719 dbSNP
rs907173984 730 dbSNP
rs937579215 738 dbSNP
rs1329657183 740 dbSNP
rs1226739701 743 dbSNP
rs1441915134 746 dbSNP
rs1397011382 747 dbSNP
rs1252014447 755 dbSNP
rs1056023239 756 dbSNP
rs887977980 757 dbSNP
rs1408849015 765 dbSNP
rs1159006853 768 dbSNP
rs1048725990 776 dbSNP
rs904831815 787 dbSNP
rs561034241 788 dbSNP
rs1185837111 789 dbSNP
rs1445874655 797 dbSNP
rs1036543335 798 dbSNP
rs145223739 799 dbSNP
rs1179009051 800 dbSNP
rs997648882 802 dbSNP
rs1030019792 815 dbSNP
rs1225963447 822 dbSNP
rs1343580069 823 dbSNP
rs1303094901 824 dbSNP
rs1235540507 826 dbSNP
rs953012150 832 dbSNP
rs1007440711 835 dbSNP
rs1373676073 841 dbSNP
rs1009352652 843 dbSNP
rs1020360031 846 dbSNP
rs1170512396 847 dbSNP
rs371480240 850 dbSNP
rs967495569 850 dbSNP
rs1320434766 857 dbSNP
rs1402369674 860 dbSNP
rs1400026139 868 dbSNP
rs1032214469 869 dbSNP
rs957905916 879 dbSNP
rs187328936 884 dbSNP
rs571519085 886 dbSNP
rs913336016 888 dbSNP
rs967507101 892 dbSNP
rs981894016 893 dbSNP
rs1033028361 904 dbSNP
rs775651848 907 dbSNP
rs1242193110 909 dbSNP
rs1175543488 910 dbSNP
rs1406755489 912 dbSNP
rs1454339123 913 dbSNP
rs953491136 913 dbSNP
rs986404651 914 dbSNP
rs146886282 917 dbSNP
rs1212268344 919 dbSNP
rs75216754 929 dbSNP
rs550591178 941 dbSNP
rs1056096313 943 dbSNP
rs1295876604 947 dbSNP
rs568843038 949 dbSNP
rs551505028 953 dbSNP
rs1271971073 955 dbSNP
rs909443606 961 dbSNP
rs942202990 965 dbSNP
rs1036542782 966 dbSNP
rs919386786 967 dbSNP
rs930431084 969 dbSNP
rs1328206311 972 dbSNP
rs984917299 973 dbSNP
rs897966944 974 dbSNP
rs191424403 975 dbSNP
rs1419853557 981 dbSNP
rs1187925837 986 dbSNP
rs937653802 988 dbSNP
rs1324923163 990 dbSNP
rs1189197348 991 dbSNP
rs371691474 994 dbSNP
rs1272926938 995 dbSNP
rs571633098 998 dbSNP
rs1308274008 1003 dbSNP
rs76730569 1003 dbSNP
rs1226850707 1006 dbSNP
rs888817082 1009 dbSNP
rs9931847 1010 dbSNP
rs1415322997 1012 dbSNP
rs1357336838 1016 dbSNP
rs1032244212 1018 dbSNP
rs1186816615 1020 dbSNP
rs577516670 1021 dbSNP
rs1172002136 1032 dbSNP
rs903656528 1032 dbSNP
rs1416505896 1034 dbSNP
rs529380077 1035 dbSNP
rs544273353 1036 dbSNP
rs1429868051 1040 dbSNP
rs970932195 1045 dbSNP
rs59177504 1051 dbSNP
rs1177154442 1052 dbSNP
rs1156666174 1054 dbSNP
rs889162747 1054 dbSNP
rs1234963558 1055 dbSNP
rs1219572815 1056 dbSNP
rs1334526341 1062 dbSNP
rs981582811 1065 dbSNP
rs928700345 1066 dbSNP
rs958716835 1070 dbSNP
rs991473537 1071 dbSNP
rs760725845 1072 dbSNP
rs1373716829 1073 dbSNP
rs1289607295 1075 dbSNP
rs942318508 1077 dbSNP
rs1387444083 1081 dbSNP
rs35628469 1082 dbSNP
rs1403138494 1085 dbSNP
rs919442433 1085 dbSNP
rs933478714 1086 dbSNP
rs1325968174 1087 dbSNP
rs1462511201 1088 dbSNP
rs1361589151 1090 dbSNP
rs1346673757 1094 dbSNP
rs1051562701 1095 dbSNP
rs138277158 1096 dbSNP
rs542307409 1097 dbSNP
rs984577708 1098 dbSNP
rs1053398322 1102 dbSNP
rs184472996 1105 dbSNP
rs1463547844 1110 dbSNP
rs1216980979 1114 dbSNP
rs1293812814 1118 dbSNP
rs1260234832 1119 dbSNP
rs528245428 1119 dbSNP
rs867055378 1121 dbSNP
rs867281541 1122 dbSNP
rs937712950 1123 dbSNP
rs1317515295 1124 dbSNP
rs367830721 1129 dbSNP
rs991794378 1129 dbSNP
rs1231870608 1130 dbSNP
rs1021282224 1138 dbSNP
rs868279597 1139 dbSNP
rs945312529 1140 dbSNP
rs1382064998 1141 dbSNP
rs1003767446 1145 dbSNP
rs1035804239 1150 dbSNP
rs958787771 1153 dbSNP
rs3852690 1155 dbSNP
rs1016277207 1156 dbSNP
rs1396074214 1158 dbSNP
rs1195670658 1159 dbSNP
rs963675750 1163 dbSNP
rs201158777 1164 dbSNP
rs972378849 1165 dbSNP
rs919500538 1166 dbSNP
rs1179841287 1175 dbSNP
rs1404842232 1176 dbSNP
rs554354819 1178 dbSNP
rs567754470 1179 dbSNP
rs1280794819 1190 dbSNP
rs910692394 1191 dbSNP
rs943125309 1192 dbSNP
rs1053434749 1193 dbSNP
rs1347153806 1194 dbSNP
rs759419372 1196 dbSNP
rs765137485 1197 dbSNP
rs752525305 1198 dbSNP
rs1018976106 1199 dbSNP
rs762800055 1200 dbSNP
rs1376432099 1202 dbSNP
rs550284180 1202 dbSNP
rs901817759 1203 dbSNP
rs1373285560 1212 dbSNP
rs1460628335 1217 dbSNP
rs1372768449 1222 dbSNP
rs371397787 1223 dbSNP
rs568484289 1224 dbSNP
rs1309662982 1225 dbSNP
rs1255492152 1226 dbSNP
rs1042329281 1228 dbSNP
rs1485335522 1230 dbSNP
rs1257958343 1232 dbSNP
rs1202019616 1234 dbSNP
rs1337232839 1237 dbSNP
rs1250376777 1239 dbSNP
rs906428062 1242 dbSNP
rs1290969850 1245 dbSNP
rs1414705052 1246 dbSNP
rs1003431480 1248 dbSNP
rs1033529424 1252 dbSNP
rs1490680465 1254 dbSNP
rs894944250 1255 dbSNP
rs1202435510 1262 dbSNP
rs1013016860 1271 dbSNP
rs1480942467 1275 dbSNP
rs1016351153 1276 dbSNP
rs529657324 1277 dbSNP
rs143300744 1281 dbSNP
rs756726346 1282 dbSNP
rs1435797148 1285 dbSNP
rs991845260 1285 dbSNP
rs972456847 1286 dbSNP
rs1196008316 1289 dbSNP
rs1026597417 1293 dbSNP
rs1270699384 1296 dbSNP
rs955142005 1298 dbSNP
rs987659538 1303 dbSNP
rs910728348 1307 dbSNP
rs1426278525 1318 dbSNP
rs1335485265 1319 dbSNP
rs1426579251 1322 dbSNP
rs1168471698 1341 dbSNP
rs1392602098 1342 dbSNP
rs1325506452 1344 dbSNP
rs113671952 1349 dbSNP
rs534123317 1350 dbSNP
rs1300258807 1353 dbSNP
rs914955902 1356 dbSNP
rs945089068 1357 dbSNP
rs1212712896 1360 dbSNP
rs1468481961 1363 dbSNP
rs559148995 1367 dbSNP
rs1334786189 1371 dbSNP
rs927625874 1373 dbSNP
rs555519773 1374 dbSNP
rs1055016443 1376 dbSNP
rs1280469979 1377 dbSNP
rs1242709970 1379 dbSNP
rs1361189899 1381 dbSNP
rs895016540 1382 dbSNP
rs1351677181 1390 dbSNP
rs1005388713 1398 dbSNP
rs1307994290 1401 dbSNP
rs188998142 1402 dbSNP
rs1037814612 1403 dbSNP
rs193115835 1404 dbSNP
rs1040467419 1410 dbSNP
rs901866684 1415 dbSNP
rs1243937944 1416 dbSNP
rs1454487775 1420 dbSNP
rs1247942670 1422 dbSNP
rs1446719959 1423 dbSNP
rs1235297042 1424 dbSNP
rs1268474050 1424 dbSNP
rs1327131391 1424 dbSNP
rs1370059931 1424 dbSNP
rs1430051987 1424 dbSNP
rs765941939 1424 dbSNP
rs988848062 1424 dbSNP
rs77601707 1426 dbSNP
rs538560336 1427 dbSNP
rs1048007328 1434 dbSNP
rs1373375149 1438 dbSNP
rs1166214165 1439 dbSNP
rs993567834 1439 dbSNP
rs1434916377 1440 dbSNP
rs556592520 1441 dbSNP
rs1196453636 1442 dbSNP
rs1242207512 1442 dbSNP
rs1026753066 1443 dbSNP
rs574842724 1450 dbSNP
rs1212112373 1452 dbSNP
rs542244259 1457 dbSNP
rs1271094991 1460 dbSNP
rs959502920 1464 dbSNP
rs185173796 1476 dbSNP
rs964871821 1479 dbSNP
rs989592781 1482 dbSNP
rs1312022334 1486 dbSNP
rs8054382 1489 dbSNP
rs762776965 1497 dbSNP
rs188951811 1499 dbSNP
rs1409070481 1501 dbSNP
rs755594508 1508 dbSNP
rs74197901 1509 dbSNP
rs1055086904 1512 dbSNP
rs916484464 1517 dbSNP
rs1484402155 1524 dbSNP
rs532228180 1526 dbSNP
rs1204072656 1527 dbSNP
rs1260040025 1531 dbSNP
rs544462314 1532 dbSNP
rs985367952 1533 dbSNP
rs1322779205 1536 dbSNP
rs1228835794 1538 dbSNP
rs1381055162 1539 dbSNP
rs1296305604 1542 dbSNP
rs1440990877 1543 dbSNP
rs1400645252 1545 dbSNP
rs1204031147 1547 dbSNP
rs748528593 1551 dbSNP
rs896963955 1552 dbSNP
rs772473561 1556 dbSNP
rs1166031572 1557 dbSNP
rs943831927 1565 dbSNP
rs993992039 1566 dbSNP
rs1047799601 1567 dbSNP
rs890496767 1568 dbSNP
rs1440528287 1569 dbSNP
rs1008834461 1577 dbSNP
rs1240205048 1581 dbSNP
rs1212089600 1582 dbSNP
rs923340599 1584 dbSNP
rs1222211457 1585 dbSNP
rs1241757892 1591 dbSNP
rs1475753636 1600 dbSNP
rs1304575016 1602 dbSNP
rs929370893 1603 dbSNP
rs1195972015 1604 dbSNP
rs1017839947 1612 dbSNP
rs1393074590 1613 dbSNP
rs1293671471 1615 dbSNP
rs1480425207 1619 dbSNP
rs964943039 1628 dbSNP
rs1006896804 1629 dbSNP
rs1159046813 1634 dbSNP
rs1055364794 1636 dbSNP
rs562453880 1638 dbSNP
rs373049190 1643 dbSNP
rs966867394 1646 dbSNP
rs1280758180 1656 dbSNP
rs1025065964 1660 dbSNP
rs1484949442 1670 dbSNP
rs978281793 1671 dbSNP
rs1258854264 1673 dbSNP
rs927735555 1674 dbSNP
rs1223975684 1675 dbSNP
rs777873276 1678 dbSNP
rs1348352172 1679 dbSNP
rs866495635 1683 dbSNP
rs1387956500 1684 dbSNP
rs1359289848 1687 dbSNP
rs747213754 1692 dbSNP
rs1283876884 1693 dbSNP
rs957716888 1698 dbSNP
rs1172209405 1703 dbSNP
rs76901399 1710 dbSNP
rs1218917263 1711 dbSNP
rs1266788805 1712 dbSNP
rs985803160 1720 dbSNP
rs770936410 1721 dbSNP
rs1261149220 1724 dbSNP
rs973978345 1728 dbSNP
rs1488613434 1730 dbSNP
rs918449625 1735 dbSNP
rs547828774 1745 dbSNP
rs1208520346 1749 dbSNP
rs1344062034 1752 dbSNP
rs72795273 1765 dbSNP
rs890526387 1768 dbSNP
rs539837568 1769 dbSNP
rs1294318303 1771 dbSNP
rs1219752215 1774 dbSNP
rs1342990479 1775 dbSNP
rs944762302 1778 dbSNP
rs1414512396 1780 dbSNP
rs1039027688 1782 dbSNP
rs1403365872 1783 dbSNP
rs527418725 1789 dbSNP
rs1011580954 1790 dbSNP
rs1372572211 1792 dbSNP
rs1171520375 1795 dbSNP
rs1478092190 1802 dbSNP
rs1022539948 1806 dbSNP
rs1441564942 1807 dbSNP
rs918383777 1813 dbSNP
rs1408300760 1819 dbSNP
rs1256845928 1832 dbSNP
rs1218660878 1835 dbSNP
rs1319431053 1838 dbSNP
rs902722664 1839 dbSNP
rs112393306 1843 dbSNP
rs1402029105 1844 dbSNP
rs1300755392 1846 dbSNP
rs1364489758 1857 dbSNP
rs552476162 1860 dbSNP
rs1332320804 1866 dbSNP
rs78897721 1876 dbSNP
rs909232807 1880 dbSNP
rs1034798255 1893 dbSNP
rs1304931660 1898 dbSNP
rs538062681 1901 dbSNP
rs990546196 1909 dbSNP
rs1189419928 1910 dbSNP
rs1055338894 1913 dbSNP
rs1237153139 1915 dbSNP
rs1198891449 1930 dbSNP
rs77484954 1934 dbSNP
rs143722027 1937 dbSNP
rs949599928 1944 dbSNP
rs537219898 1952 dbSNP
rs962338552 1954 dbSNP
rs535837951 1957 dbSNP
rs1376666324 1961 dbSNP
rs999713454 1965 dbSNP
rs918492804 1966 dbSNP
rs1032075886 1973 dbSNP
rs554242319 1977 dbSNP
rs1325355004 1978 dbSNP
rs1404675275 1985 dbSNP
rs893500141 1990 dbSNP
rs572549027 1998 dbSNP
rs1006548117 2012 dbSNP
rs1017919133 2014 dbSNP
rs1379472041 2024 dbSNP
rs1490223123 2024 dbSNP
rs1441240146 2027 dbSNP
rs1250559206 2028 dbSNP
rs1223284721 2034 dbSNP
rs769785518 2036 dbSNP
rs947462657 2042 dbSNP
rs1451696607 2045 dbSNP
rs985580146 2047 dbSNP
rs1292592520 2048 dbSNP
rs1203900068 2050 dbSNP
rs1353364812 2052 dbSNP
rs35318292 2054 dbSNP
rs976641631 2055 dbSNP
rs762667387 2058 dbSNP
rs1274508804 2060 dbSNP
rs1437235550 2062 dbSNP
rs1332913701 2064 dbSNP
rs1398140576 2065 dbSNP
rs912369489 2065 dbSNP
rs951232905 2072 dbSNP
rs1159064356 2073 dbSNP
rs1421113151 2077 dbSNP
rs983981318 2081 dbSNP
rs528963850 2083 dbSNP
rs1039058839 2086 dbSNP
rs900542808 2089 dbSNP
rs942076376 2096 dbSNP
rs1384198654 2097 dbSNP
rs181056288 2098 dbSNP
rs916559898 2099 dbSNP
rs183977234 2105 dbSNP
rs1219184781 2106 dbSNP
rs1164451667 2112 dbSNP
rs1278100516 2112 dbSNP
rs777614599 2117 dbSNP
rs1046620972 2121 dbSNP
rs902706398 2122 dbSNP
rs754220181 2123 dbSNP
rs1394278713 2127 dbSNP
rs542879838 2128 dbSNP
rs562439900 2130 dbSNP
rs1390691315 2136 dbSNP
rs935508870 2137 dbSNP
rs763879597 2138 dbSNP
rs1357215443 2139 dbSNP
rs1053976883 2149 dbSNP
rs1329301659 2157 dbSNP
rs902754503 2158 dbSNP
rs1165691942 2168 dbSNP
rs1337378800 2169 dbSNP
rs773909498 2174 dbSNP
rs1484863163 2175 dbSNP
rs1237329507 2176 dbSNP
rs1000159915 2180 dbSNP
rs893562822 2181 dbSNP
rs116148240 2187 dbSNP
rs1017971124 2190 dbSNP
rs1198030050 2191 dbSNP
rs1318729279 2192 dbSNP
rs1278684434 2196 dbSNP
rs900808679 2199 dbSNP
rs1376680747 2208 dbSNP
rs1246840387 2209 dbSNP
rs1267245017 2215 dbSNP
rs1338027248 2234 dbSNP
rs1195798542 2237 dbSNP
rs767260086 2241 dbSNP
rs998131644 2244 dbSNP
rs188652871 2245 dbSNP
rs1274310427 2247 dbSNP
rs1464591283 2258 dbSNP
rs1400409315 2260 dbSNP
rs1459410980 2262 dbSNP
rs73564405 2264 dbSNP
rs951325056 2272 dbSNP
rs749996841 2273 dbSNP
rs1012011642 2278 dbSNP
rs1023386672 2281 dbSNP
rs1231351783 2285 dbSNP
rs563070205 2290 dbSNP
rs1370776525 2291 dbSNP
rs1461039462 2295 dbSNP
rs1260138214 2297 dbSNP
rs973751113 2299 dbSNP
rs765902829 2301 dbSNP
rs1319896647 2303 dbSNP
rs1288851916 2304 dbSNP
rs1168479471 2314 dbSNP
rs963513403 2318 dbSNP
rs531926104 2327 dbSNP
rs1233676091 2328 dbSNP
rs916610826 2331 dbSNP
rs1335789999 2335 dbSNP
rs951346992 2340 dbSNP
rs1166145444 2344 dbSNP
rs1407365496 2345 dbSNP
rs527311211 2346 dbSNP
rs1382332447 2352 dbSNP
rs1453572928 2359 dbSNP
rs1378864008 2362 dbSNP
rs1315109572 2374 dbSNP
rs1440619833 2384 dbSNP
rs1240068119 2389 dbSNP
rs970686083 2390 dbSNP
rs11642705 2392 dbSNP
rs778148877 2399 dbSNP
rs1323274370 2406 dbSNP
rs924206485 2409 dbSNP
rs1238938588 2412 dbSNP
rs912402148 2413 dbSNP
rs935545815 2418 dbSNP
rs115641250 2421 dbSNP
rs1384522768 2425 dbSNP
rs974839345 2428 dbSNP
rs922003152 2433 dbSNP
rs1294569376 2452 dbSNP
rs370769316 2453 dbSNP
rs531927069 2458 dbSNP
rs550436149 2460 dbSNP
rs1201889124 2461 dbSNP
rs1420513604 2462 dbSNP
rs923914047 2471 dbSNP
rs1382350701 2473 dbSNP
rs180779662 2477 dbSNP
rs1427457266 2480 dbSNP
rs1056698080 2487 dbSNP
rs1193232131 2488 dbSNP
rs1426034831 2499 dbSNP
rs527727753 2500 dbSNP
rs1490832447 2504 dbSNP
rs757510040 2509 dbSNP
rs997843933 2518 dbSNP
rs1488509929 2519 dbSNP
rs1479385810 2521 dbSNP
rs1012402131 2529 dbSNP
rs1406638340 2536 dbSNP
rs1044864511 2537 dbSNP
rs781384149 2539 dbSNP
rs887034048 2540 dbSNP
rs114161397 2545 dbSNP
rs1339156433 2546 dbSNP
rs1025308432 2547 dbSNP
rs1400922212 2553 dbSNP
rs1383034004 2555 dbSNP
rs958520554 2555 dbSNP
rs1012311544 2556 dbSNP
rs142809055 2556 dbSNP
rs746001343 2558 dbSNP
rs1178389958 2561 dbSNP
rs1278869631 2561 dbSNP
rs1342951921 2562 dbSNP
rs1421346558 2565 dbSNP
rs951082224 2568 dbSNP
rs115197062 2570 dbSNP
rs923897328 2571 dbSNP
rs116676358 2576 dbSNP
rs1256050019 2579 dbSNP
rs1235854372 2588 dbSNP
rs990109909 2591 dbSNP
rs1278060703 2592 dbSNP
rs915440273 2593 dbSNP
rs1342770858 2599 dbSNP
rs963871309 2606 dbSNP
rs942827481 2607 dbSNP
rs1395650327 2609 dbSNP
rs539460151 2610 dbSNP
rs867829067 2611 dbSNP
rs1039512153 2617 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
            | ||  ||||  ||||||| 
Target 5' ccCUAA--AUUA-AUGCUGCUu 3'
4 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000254950.11 | 3UTR | UUCCCCUAAAUUAAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000254950.11 | 3UTR | UUCCCCUAAAUUAAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000254950.11 | 3UTR | UUCCCCUAAAUUAAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000254950.11 | 3UTR | UCCCCUAAAUUAAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000254950.11 | 3UTR | UUCCCCUAAAUUAAUGCUGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.358 1.8e-3 -0.257 2.0e-2 64 Click to see details
GSE38226 Liver fibrosis 0.604 1.9e-3 0.421 2.9e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.595 2.8e-3 -0.687 4.1e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.488 6.7e-3 -0.408 2.1e-2 25 Click to see details
GSE21032 Prostate cancer -0.225 2.0e-2 -0.051 3.2e-1 83 Click to see details
GSE42095 Differentiated embryonic stem cells 0.364 4.4e-2 0.258 1.2e-1 23 Click to see details
GSE32688 Pancreatic cancer -0.253 8.1e-2 0.037 4.2e-1 32 Click to see details
GSE27834 Pluripotent stem cells 0.334 1.0e-1 0.285 1.4e-1 16 Click to see details
GSE19536 Breast cancer -0.112 1.3e-1 -0.172 4.4e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.118 1.5e-1 -0.125 1.4e-1 79 Click to see details
GSE28544 Breast cancer -0.196 1.8e-1 -0.343 5.0e-2 24 Click to see details
GSE19350 CNS germ cell tumors -0.246 2.2e-1 -0.168 3.0e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.162 2.5e-1 -0.241 1.5e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.143 2.5e-1 0.195 1.8e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.193 2.6e-1 0.126 3.4e-1 13 Click to see details
GSE14794 Lymphoblastoid cells -0.06 2.9e-1 -0.033 3.8e-1 90 Click to see details
GSE17306 Multiple myeloma -0.065 3.3e-1 -0.002 4.9e-1 49 Click to see details
GSE21849 B cell lymphoma 0.08 3.4e-1 0.066 3.7e-1 29 Click to see details
GSE17498 Multiple myeloma -0.044 3.9e-1 -0.005 4.9e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.022 4.6e-1 0.029 4.5e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.022 4.6e-1 0.029 4.5e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CESC -0.998 0.02 -1.000 0.5 3 Click to see details
HNSC -0.294 0.03 -0.292 0.03 42 Click to see details
KIRP -0.313 0.04 -0.264 0.07 32 Click to see details
LUSC -0.244 0.07 -0.289 0.04 38 Click to see details
BLCA -0.352 0.08 -0.434 0.04 18 Click to see details
KIRC -0.15 0.11 -0.175 0.08 68 Click to see details
THCA -0.127 0.17 -0.056 0.34 59 Click to see details
CHOL -0.348 0.18 -0.583 0.05 9 Click to see details
PAAD -0.641 0.18 -0.800 0.1 4 Click to see details
ESCA 0.274 0.21 0.027 0.47 11 Click to see details
PCPG 0.791 0.21 0.500 0.33 3 Click to see details
PRAD -0.088 0.27 -0.048 0.37 50 Click to see details
KICH -0.108 0.3 -0.225 0.14 25 Click to see details
LIHC 0.055 0.35 0.052 0.36 49 Click to see details
COAD 0.133 0.38 0.286 0.25 8 Click to see details
BRCA 0.024 0.41 0.011 0.46 84 Click to see details
LUAD -0.06 0.43 0.000 0.5 12 Click to see details
UCEC -0.018 0.47 -0.147 0.27 19 Click to see details
STAD 0.001 0.5 0.001 0.5 32 Click to see details
STAD 0.001 0.5 0.001 0.5 32 Click to see details
STAD 0.001 0.5 0.001 0.5 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
Your e-Mail*