miRTarBase - #MIRT090446 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDV3   
Synonyms H41
Description CDV3 homolog
Transcript NM_001134422   
Other Transcripts NM_001134423 , NM_017548   
Expression
Putative miRNA Targets on CDV3
3'UTR of CDV3
(miRNA target sites are highlighted)
>CDV3|NM_001134422|3'UTR
   1 ATGCTACCTGGAATTAAATGACTACATATGGCACATCTACATCTTACTTTAGGGACATGAATTTTTTAAAATAAATAAAA
  81 TGGGAAGAAATGTAAATGACATCAGATGGAAATGTGTTTTTTGGGGTGGCTTTTAGAATAAATCCCAGCCTTTTCACCAC
 161 TTTGAGAGCACAGCTGGCTTGAATTTAAACCTCCACGTGGACTTGCTCCTCTGCTCTGTCTTAAAAAATGTGTAAGGGAC
 241 CTTGGGAGGGCAGTGATTCACCACACTCGAGTTTCTTTACCTGATCTAATCAGATCCACTCCCACAAAATCGATGTGAGG
 321 AGAAATCATTGACTAATGAGTAGAATTTACTTGAATGAGAAAATTGTTACCCTTGTGCATAAAGAGAGAGATGTATTATC
 401 TATTACTTGCTAAAAGTAAGAGTCTTAGGAGGAATGTCATTACACAGCTTTTAACAGTTTTCTTCAAGTTTGTCCTGAAA
 481 TAGGGTCACAGTTAATACTGTTCAGTAGAAGATAGGACCCTAGAGCTTCAATACAGCGTTCTGTGTTTTCTGTTTGAATT
 561 GAAGCCTTAAAATGGTTTGATAAGGATTTTCTATATGCCTCCACTCCTACCCCTCCCCAGGATTCTTCTAAGGGGTGGCT
 641 TTTTTTTAAATTCAAGGACGAATATTTTCAAAAACCCTAGTGAAGAAGAAATATTTACTGATTACATTTCTTTTCCCTTA
 721 GGGATAAAGAAATGGAGAAGAGCTTTGAAGTAGTAAGACACAAAAATAGAGGTAGGGATGAGGTTTCAAAAAACCAGGCC
 801 CTTAAACTTCAGCTAGACAACCAATATGCTGTGCTTGAAAATCAGAAAAGCAGCCACTCACAATACAATTAAGGAATGGG
 881 CTTTGCTAACCCTTCTGAGGTAACTAGACTGCAGCTAACCACCACCAACAGCCATTCATCATCTGATCTCTGCTGGATCT
 961 ACAGACACCGATGCAGACCACTCGATTTCATGACCGGCCCTATTGCACTATGGAAGTTAAAGTGTCACGACTGCTCTATG
1041 CATATTGGATTTAGGGGAATTTTCATTGTTACATAAATGTGTGAACTAGTTTCAACAGTGTTCTTTCATATTTACTCTGC
1121 AAATACAAAAAACCAAAACCTGCAGCCAGTGGTCATTTCAAAATCTTTTTATGTTCAGATACTGAGCCTTCATAAGGGTT
1201 GACTACCTCAGATTTGCTGCACTCATTGTGGACTTCATGTGGATCACAACTTCTGGATAAGAAGATTACAACTATTAAGT
1281 GTCGATGTGAACCTTGCAACCAGCTCTACTGGATTCTTATCAGAAATCCTGCATAAAAAGTCAGCCATCTGGGTTCTGAT
1361 CTGCTGTAAAAGATGAAGATTTAAGTGACCTTAATTAACCTGTCCTGTGCCCTACCCTTAAGGAATACTCTCTGTAGTAG
1441 GCTGTTGTTATATTAGACTTCCTGGAACACACTGCTGAAAAGAACTGATGTGTTCAGATCATCTGTGTAGGGCTGTGATT
1521 TGTAATTTAAACTAATTGTATTCTGAGGTAACCACAAAATAAATTCAACCAAACTGGGGTCCACCAAGTGGGGGAAGGGG
1601 AAGGGAGAGAATAATCTTGGGGGTTTTTTTTTTTTGGTAATTTTTTTATTTGGATAGTGCTTTTTTGTTTTGTTTTTGTT
1681 CTGCATTAAGGCCTTTTTTGCTTTGACTTGAAATAAGTTCTTTGACAGAGCATATTGCTTGGTTAATTAAGTAACCTAAA
1761 GTATGCATTAGGATTGTGAAATGTCTCGTGAGTATGCCAATCCTGAGGGTGGAACCAAATAGCCTTTGATGAAAAGGGCA
1841 GTGGATTCTGGAGGCTCTACTTCAGGTGCTGCTATAATGCCTCATCTAATCAGGACTAAATTGTGTAGGAAACTGCAGTG
1921 GGAAGAATATGCTTTCTGCTCAGGCTAAGAGGGTCACTGATCTGTCCTTAGAAATTCAGAGTAACATGAGCAAAACCTCA
2001 GCTAAAACCCATTTAAGTGGCATGGATTGTGCATGATCTTTGATAAGAATTCCTCATGTACTTGTGCCTAGTTTTTCAAG
2081 GTATTGGCTGTTCTATAGATGCAGTGATTGTCCCAGCTAGCTCTGTTACCAGCCTTTTGGTGTGTCTTTATGTTCATTTG
2161 GAGAGTCAGGGCGAAAGACAGGTGATGTAGCACTTCTGTTTTTAATAATTATTGCTTAAAATACCTATTAATAGTTTTGG
2241 GTCATTTAAAGGGACTTGAGGAAGCTACCCAGGATTACAGAAGAGTGTCCACCTAACAAGATGGTCTGGCAGTTTCCTAG
2321 TTTTGTATCTGGTTCAATAGAAATATGTGAAAGTGGTAATGTCATCATTTGATGCAGAGTCCGGGTTTCTCTATAATAAA
2401 TCCCTTTGCCAAATGCATGAGTTGCAGACTTGCTACTGGCAAGAGTGAAGCAAGTGGGTGAGTAAAACTATTTTGACGTG
2481 GGAGCGTTTTCAGATAGGAGTTTAGTCTTGACGAAAGTGTCCGTGCAGGAATTGGACTCCGAGGAGGGTTACAGTATCTC
2561 CTGACGGGACCTGCCACTCGCATCTGGGCAATGTTGACATTTGAGGTGGCAGGCAGGATGCCTGCCTTCTAATATATTTG
2641 GGTGAGTAACTGAGCCAGCCAAGGGAAGGTTGAATGATTAAATCAGAAATGGGATTCTTGGTAAACTGAAGACTTTTATT
2721 TGGGAATGAAAAACCTTAAAAAAATCTCTTCATCGTTGAACTGTGCATTTTCCCTGCATTTTTTCCCAACAAAATTTTGT
2801 TGGGGGTTATGTTACTGAAGAATGAACAGATGAGTAAGTGGAGGTGTTATGTAAAGGCATATTGTACTCGAAATCTGAAG
2881 ACCTGCAGCAGATTTAAATTACAACTCTTGTTATAACTTTTTAAAAGATTGTGAAAATATCAAAATATAAATGAATCAAG
2961 TTTTAATATACTGTATGATGGGTGGATGAGGCTGTCCATTGTACCATTTGTTTGAATTCTCAGGCATGGTTTGGCAGTGC
3041 AAGAATTCTGTAACATTAACAAATTCAATAAAAAGTAAATATATGGATTTTGGACTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||: | | |||||||| 
Target 5' gctctACT-TCAGGTGCTGCTa 3'
1854 - 1874 152.00 -15.60
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            | | |:   || ||||||  
Target 5' gaCTACCTCAGATTTGCTGCac 3'
1201 - 1222 128.00 -10.10
3
miRNA  3' guguUUGGUAAUACACGACGau 5'
              |||||  || |||||:  
Target 5' agacAACCA--ATATGCTGTgc 3'
815 - 834 126.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31580369 38 COSMIC
COSN31488131 55 COSMIC
COSN31559136 61 COSMIC
COSN20090897 68 COSMIC
COSN30648563 68 COSMIC
COSN31588588 88 COSMIC
COSN30137281 132 COSMIC
COSN26437452 169 COSMIC
COSN31596567 171 COSMIC
COSN20054065 184 COSMIC
COSN30174618 318 COSMIC
COSN31567202 622 COSMIC
COSN31505360 633 COSMIC
COSN28868111 648 COSMIC
COSN30501526 648 COSMIC
COSN30518538 665 COSMIC
COSN30450103 677 COSMIC
COSN30516706 701 COSMIC
COSM3122235 732 COSMIC
COSM7497694 751 COSMIC
COSM6863900 767 COSMIC
COSM9498729 773 COSMIC
COSM3122236 780 COSMIC
COSM5398191 804 COSMIC
COSM6990024 816 COSMIC
COSM445614 823 COSMIC
COSM479450 826 COSMIC
COSM9617931 828 COSMIC
COSM9824903 849 COSMIC
COSM1616943 856 COSMIC
COSM373133 857 COSMIC
COSM9824904 859 COSMIC
COSM9824905 869 COSMIC
COSN30190325 874 COSMIC
COSN31491813 933 COSMIC
COSN30153228 944 COSMIC
COSN30146262 946 COSMIC
COSN507543 949 COSMIC
COSN30144204 953 COSMIC
COSN30148886 957 COSMIC
COSN30527426 969 COSMIC
COSN30512923 970 COSMIC
COSN31605826 985 COSMIC
COSN31492835 992 COSMIC
COSN30158583 1010 COSMIC
COSN30533176 1011 COSMIC
COSN30168156 1037 COSMIC
COSN31584241 1080 COSMIC
COSN24299763 1091 COSMIC
COSN19369096 1141 COSMIC
COSN30024778 1172 COSMIC
COSN24394042 1201 COSMIC
COSN6750674 1460 COSMIC
COSN18751717 1624 COSMIC
COSN20099103 1636 COSMIC
COSN8488286 1649 COSMIC
COSN28779006 1742 COSMIC
COSN26575447 1752 COSMIC
COSN22535773 1862 COSMIC
COSN30159278 1864 COSMIC
COSN30159286 1892 COSMIC
COSN1914701 1930 COSMIC
COSN31537752 1954 COSMIC
COSN7818482 2230 COSMIC
COSN31579233 2242 COSMIC
COSN26482746 2260 COSMIC
COSN31486895 2392 COSMIC
COSN1914702 2393 COSMIC
COSN26508995 2397 COSMIC
COSN21625483 2402 COSMIC
COSN26549527 2476 COSMIC
COSN31569315 2523 COSMIC
COSN1914703 2561 COSMIC
COSN28702081 2570 COSMIC
COSN19437778 2851 COSMIC
COSN23419147 2877 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1201370867 2 dbSNP
rs1374140720 2 dbSNP
rs892733940 3 dbSNP
rs960644898 7 dbSNP
rs991168255 14 dbSNP
rs371114011 15 dbSNP
rs1407638310 19 dbSNP
rs1020385318 20 dbSNP
rs1162417601 20 dbSNP
rs1388360952 23 dbSNP
rs1238901962 25 dbSNP
rs1188017569 28 dbSNP
rs1406979032 29 dbSNP
rs1326523233 30 dbSNP
rs1395236496 32 dbSNP
rs1446142138 41 dbSNP
rs1254805281 44 dbSNP
rs1307260986 46 dbSNP
rs191006976 47 dbSNP
rs1317452773 48 dbSNP
rs780121959 48 dbSNP
rs904250867 51 dbSNP
rs1358715492 58 dbSNP
rs1294182603 60 dbSNP
rs1471849125 68 dbSNP
rs555630070 69 dbSNP
rs745883284 69 dbSNP
rs182089406 72 dbSNP
rs1432021028 73 dbSNP
rs1345186588 85 dbSNP
rs866772563 88 dbSNP
rs1157355573 100 dbSNP
rs1407485937 113 dbSNP
rs568696736 117 dbSNP
rs1332210493 119 dbSNP
rs992702674 126 dbSNP
rs769896429 137 dbSNP
rs1024204740 139 dbSNP
rs145205376 144 dbSNP
rs375680905 145 dbSNP
rs1195304823 146 dbSNP
rs935102445 147 dbSNP
rs1486147588 150 dbSNP
rs1241500135 156 dbSNP
rs962296946 159 dbSNP
rs1453072862 171 dbSNP
rs972059781 172 dbSNP
rs920609196 176 dbSNP
rs1332964037 179 dbSNP
rs537729538 185 dbSNP
rs185919750 194 dbSNP
rs768930081 197 dbSNP
rs368432266 198 dbSNP
rs1040973564 217 dbSNP
rs1395599701 221 dbSNP
rs1290013880 223 dbSNP
rs892690868 223 dbSNP
rs13070423 250 dbSNP
rs13070040 253 dbSNP
rs1460591575 260 dbSNP
rs1351246186 261 dbSNP
rs1415291206 265 dbSNP
rs77613106 269 dbSNP
rs945638437 269 dbSNP
rs1041345551 270 dbSNP
rs1184655124 274 dbSNP
rs1432515021 275 dbSNP
rs1253319617 280 dbSNP
rs13092988 283 dbSNP
rs889782868 287 dbSNP
rs1260288493 291 dbSNP
rs941308194 298 dbSNP
rs1205270222 300 dbSNP
rs1313510447 310 dbSNP
rs867442354 312 dbSNP
rs897219908 313 dbSNP
rs994689656 314 dbSNP
rs1034095872 316 dbSNP
rs13070459 320 dbSNP
rs1034843177 322 dbSNP
rs1303115368 323 dbSNP
rs1391799351 332 dbSNP
rs894255991 332 dbSNP
rs1299488986 337 dbSNP
rs1462195133 341 dbSNP
rs13070184 343 dbSNP
rs13070621 344 dbSNP
rs1353351468 349 dbSNP
rs1167707111 351 dbSNP
rs1436496915 353 dbSNP
rs1395675286 365 dbSNP
rs1192748463 366 dbSNP
rs1452385256 368 dbSNP
rs896349607 372 dbSNP
rs1482261669 376 dbSNP
rs1177940509 377 dbSNP
rs774726867 378 dbSNP
rs116168356 383 dbSNP
rs1212409018 383 dbSNP
rs1349206324 385 dbSNP
rs961965978 387 dbSNP
rs1232786371 389 dbSNP
rs1379518985 393 dbSNP
rs1308172221 394 dbSNP
rs1233839673 395 dbSNP
rs1391538001 397 dbSNP
rs762218921 399 dbSNP
rs1295930961 403 dbSNP
rs780487553 403 dbSNP
rs967943511 411 dbSNP
rs1171405144 419 dbSNP
rs529507877 421 dbSNP
rs772350934 428 dbSNP
rs78836194 437 dbSNP
rs956441776 444 dbSNP
rs1159650380 446 dbSNP
rs539548510 449 dbSNP
rs1418709007 452 dbSNP
rs1168160810 460 dbSNP
rs976258740 472 dbSNP
rs1486019414 475 dbSNP
rs372848332 482 dbSNP
rs922790316 487 dbSNP
rs6776497 501 dbSNP
rs190687294 502 dbSNP
rs764786890 509 dbSNP
rs752138891 519 dbSNP
rs1315937747 520 dbSNP
rs914057876 523 dbSNP
rs572972563 526 dbSNP
rs35489019 530 dbSNP
rs182819820 532 dbSNP
rs1311750264 534 dbSNP
rs1038367206 538 dbSNP
rs918615052 539 dbSNP
rs930074509 542 dbSNP
rs935632153 542 dbSNP
rs1056985367 544 dbSNP
rs1475668187 546 dbSNP
rs1234436686 553 dbSNP
rs1417167422 556 dbSNP
rs1055500460 571 dbSNP
rs1273327676 572 dbSNP
rs747181679 572 dbSNP
rs763691235 585 dbSNP
rs1263103486 586 dbSNP
rs1204884022 589 dbSNP
rs894203642 603 dbSNP
rs1339576461 610 dbSNP
rs896578833 612 dbSNP
rs1275465881 613 dbSNP
rs780122321 620 dbSNP
rs367780376 626 dbSNP
rs1044895312 630 dbSNP
rs188339131 637 dbSNP
rs1451451839 640 dbSNP
rs191289423 645 dbSNP
rs532826204 648 dbSNP
rs182764695 660 dbSNP
rs34062652 661 dbSNP
rs1187946274 665 dbSNP
rs1315746003 666 dbSNP
rs764303933 675 dbSNP
rs748872084 677 dbSNP
rs774248494 678 dbSNP
rs1274363553 679 dbSNP
rs1456881884 683 dbSNP
rs745662704 686 dbSNP
rs1239524266 699 dbSNP
rs772082054 704 dbSNP
rs1327671077 707 dbSNP
rs775558972 718 dbSNP
rs760735101 733 dbSNP
rs1394093812 744 dbSNP
rs371435315 752 dbSNP
rs761889207 754 dbSNP
rs1422829351 758 dbSNP
rs1220243523 760 dbSNP
rs765471317 762 dbSNP
rs1329373701 767 dbSNP
rs1405191005 768 dbSNP
rs750714947 770 dbSNP
rs143704956 773 dbSNP
rs766787142 776 dbSNP
rs780900954 780 dbSNP
rs1417015365 786 dbSNP
rs555406885 788 dbSNP
rs753789681 788 dbSNP
rs1017576252 790 dbSNP
rs762393059 792 dbSNP
rs375027959 793 dbSNP
rs770548560 795 dbSNP
rs748862814 796 dbSNP
rs1252516818 797 dbSNP
rs200087138 800 dbSNP
rs186791850 803 dbSNP
rs369849075 805 dbSNP
rs867110975 806 dbSNP
rs1468626193 808 dbSNP
rs1486488672 809 dbSNP
rs151259171 811 dbSNP
rs1262269534 817 dbSNP
rs1476784231 819 dbSNP
rs775468933 821 dbSNP
rs1207736787 824 dbSNP
rs746895696 825 dbSNP
rs1462571075 826 dbSNP
rs768657190 828 dbSNP
rs776530338 829 dbSNP
rs376528402 835 dbSNP
rs765385169 838 dbSNP
rs1340339650 839 dbSNP
rs773409611 843 dbSNP
rs1398641766 844 dbSNP
rs868292209 844 dbSNP
rs766697119 846 dbSNP
rs558085907 851 dbSNP
rs768074322 855 dbSNP
rs1226527493 857 dbSNP
rs1324680817 862 dbSNP
rs201362523 863 dbSNP
rs753229434 864 dbSNP
rs1349577567 866 dbSNP
rs369205277 867 dbSNP
rs756818578 877 dbSNP
rs778635947 880 dbSNP
rs745487433 882 dbSNP
rs369631955 883 dbSNP
rs779662498 887 dbSNP
rs746849502 893 dbSNP
rs768408067 897 dbSNP
rs967276679 901 dbSNP
rs1436782998 903 dbSNP
rs979645900 905 dbSNP
rs1360227157 906 dbSNP
rs781198560 907 dbSNP
rs1371286563 909 dbSNP
rs373292500 912 dbSNP
rs769859013 913 dbSNP
rs1386759030 915 dbSNP
rs376601686 918 dbSNP
rs765608535 918 dbSNP
rs1298523338 919 dbSNP
rs201232734 921 dbSNP
rs1234503078 922 dbSNP
rs771175320 923 dbSNP
rs774513701 924 dbSNP
rs766762181 932 dbSNP
rs1356051037 935 dbSNP
rs915583477 936 dbSNP
rs1292490209 944 dbSNP
rs1469255004 949 dbSNP
rs1208652007 950 dbSNP
rs911405511 950 dbSNP
rs1439202776 962 dbSNP
rs962937875 970 dbSNP
rs974362523 971 dbSNP
rs1339945126 976 dbSNP
rs1282432440 980 dbSNP
rs1234966431 982 dbSNP
rs918583784 984 dbSNP
rs1045883719 985 dbSNP
rs750363080 988 dbSNP
rs1444550205 991 dbSNP
rs1368156672 993 dbSNP
rs554287265 996 dbSNP
rs758109101 997 dbSNP
rs574319565 1003 dbSNP
rs1161193204 1011 dbSNP
rs546131167 1019 dbSNP
rs1461888073 1023 dbSNP
rs1377387569 1029 dbSNP
rs1048894412 1030 dbSNP
rs887672198 1032 dbSNP
rs1007432570 1035 dbSNP
rs1383455698 1037 dbSNP
rs1160723645 1039 dbSNP
rs1470949035 1043 dbSNP
rs1233145915 1050 dbSNP
rs1017523413 1054 dbSNP
rs966431195 1060 dbSNP
rs1318437756 1070 dbSNP
rs1339458094 1073 dbSNP
rs543174339 1074 dbSNP
rs780044047 1081 dbSNP
rs1211438049 1088 dbSNP
rs1347067582 1096 dbSNP
rs112731334 1099 dbSNP
rs1242173874 1112 dbSNP
rs997564785 1123 dbSNP
rs1021437120 1127 dbSNP
rs1217669198 1133 dbSNP
rs966846176 1134 dbSNP
rs759959315 1135 dbSNP
rs1208030405 1136 dbSNP
rs1251175077 1137 dbSNP
rs776824933 1140 dbSNP
rs563062836 1144 dbSNP
rs1194433047 1147 dbSNP
rs979570132 1148 dbSNP
rs111432178 1149 dbSNP
rs531986927 1150 dbSNP
rs1417618884 1155 dbSNP
rs1357379890 1160 dbSNP
rs925463024 1162 dbSNP
rs750845081 1166 dbSNP
rs959573910 1166 dbSNP
rs991079411 1169 dbSNP
rs753248162 1171 dbSNP
rs1395958871 1177 dbSNP
rs895402403 1179 dbSNP
rs779234466 1183 dbSNP
rs1374179018 1187 dbSNP
rs1225165563 1197 dbSNP
rs764820387 1198 dbSNP
rs1157585498 1211 dbSNP
rs1320923395 1215 dbSNP
rs1471414648 1218 dbSNP
rs749972441 1223 dbSNP
rs543876696 1226 dbSNP
rs1468911698 1228 dbSNP
rs1214386707 1230 dbSNP
rs1485291463 1234 dbSNP
rs1255586849 1253 dbSNP
rs1217900536 1259 dbSNP
rs146802459 1265 dbSNP
rs772062248 1266 dbSNP
rs1283307692 1272 dbSNP
rs918972809 1274 dbSNP
rs929089203 1280 dbSNP
rs1293964643 1281 dbSNP
rs532760243 1283 dbSNP
rs1048841534 1284 dbSNP
rs1419743923 1285 dbSNP
rs546314720 1287 dbSNP
rs943238368 1302 dbSNP
rs566212456 1304 dbSNP
rs1396298065 1307 dbSNP
rs1038923470 1308 dbSNP
rs369522989 1309 dbSNP
rs748416836 1316 dbSNP
rs901780386 1321 dbSNP
rs1475701317 1328 dbSNP
rs542208073 1329 dbSNP
rs1409610051 1330 dbSNP
rs1206648288 1331 dbSNP
rs1469978485 1332 dbSNP
rs997910447 1338 dbSNP
rs1020969990 1339 dbSNP
rs1319955385 1350 dbSNP
rs1158577142 1351 dbSNP
rs529091973 1357 dbSNP
rs902574046 1364 dbSNP
rs1361949720 1367 dbSNP
rs1400875890 1375 dbSNP
rs1443621052 1376 dbSNP
rs1032478976 1382 dbSNP
rs1326105696 1390 dbSNP
rs1457105583 1395 dbSNP
rs959521388 1402 dbSNP
rs770230952 1404 dbSNP
rs772457829 1411 dbSNP
rs1389528156 1412 dbSNP
rs1314394676 1417 dbSNP
rs1186413891 1425 dbSNP
rs756184797 1428 dbSNP
rs751684190 1430 dbSNP
rs549131492 1431 dbSNP
rs1193182055 1432 dbSNP
rs1286881004 1433 dbSNP
rs192478312 1435 dbSNP
rs981490488 1438 dbSNP
rs1240407787 1440 dbSNP
rs1265911013 1443 dbSNP
rs1303133365 1445 dbSNP
rs1385869793 1446 dbSNP
rs1365116046 1448 dbSNP
rs755017722 1448 dbSNP
rs1255421097 1451 dbSNP
rs918932506 1452 dbSNP
rs929023140 1453 dbSNP
rs1343030645 1456 dbSNP
rs1436522051 1461 dbSNP
rs1395386840 1462 dbSNP
rs773504653 1468 dbSNP
rs1175181527 1471 dbSNP
rs1202371132 1471 dbSNP
rs6792846 1474 dbSNP
rs771287934 1475 dbSNP
rs1480320923 1480 dbSNP
rs943186100 1483 dbSNP
rs1181123360 1485 dbSNP
rs1486321937 1486 dbSNP
rs375184712 1488 dbSNP
rs1231589417 1498 dbSNP
rs1420730024 1504 dbSNP
rs901726765 1506 dbSNP
rs1182517226 1510 dbSNP
rs1224018300 1513 dbSNP
rs1376563907 1517 dbSNP
rs1464150607 1519 dbSNP
rs768307896 1519 dbSNP
rs1305648141 1528 dbSNP
rs1376059095 1533 dbSNP
rs748369146 1533 dbSNP
rs749160265 1533 dbSNP
rs1175099240 1535 dbSNP
rs902522558 1537 dbSNP
rs1375637874 1541 dbSNP
rs1428731705 1550 dbSNP
rs575476762 1551 dbSNP
rs1160030617 1553 dbSNP
rs140610261 1557 dbSNP
rs184721141 1558 dbSNP
rs1032426376 1566 dbSNP
rs544466399 1569 dbSNP
rs1256115666 1570 dbSNP
rs1392477342 1574 dbSNP
rs1012408643 1575 dbSNP
rs187232999 1576 dbSNP
rs9824964 1583 dbSNP
rs971348313 1590 dbSNP
rs973016030 1591 dbSNP
rs1026349516 1595 dbSNP
rs746357781 1605 dbSNP
rs1203283684 1607 dbSNP
rs950383150 1611 dbSNP
rs984443899 1612 dbSNP
rs943133595 1613 dbSNP
rs1481525210 1616 dbSNP
rs1358084355 1617 dbSNP
rs777809777 1619 dbSNP
rs974960348 1620 dbSNP
rs1386785490 1623 dbSNP
rs1491090316 1623 dbSNP
rs1262865148 1624 dbSNP
rs1491574588 1624 dbSNP
rs36026901 1624 dbSNP
rs377100520 1624 dbSNP
rs74662874 1624 dbSNP
rs796426039 1624 dbSNP
rs200976911 1625 dbSNP
rs1431402723 1626 dbSNP
rs923135006 1629 dbSNP
rs1356366409 1636 dbSNP
rs75206141 1636 dbSNP
rs1194908952 1638 dbSNP
rs1395174797 1641 dbSNP
rs1264354771 1644 dbSNP
rs933200788 1646 dbSNP
rs962868861 1649 dbSNP
rs866625521 1651 dbSNP
rs923894863 1657 dbSNP
rs1434140848 1661 dbSNP
rs1462850684 1663 dbSNP
rs936638983 1665 dbSNP
rs1053816264 1669 dbSNP
rs1462180975 1669 dbSNP
rs145498898 1674 dbSNP
rs765862709 1676 dbSNP
rs761431631 1677 dbSNP
rs1443762266 1679 dbSNP
rs577723642 1691 dbSNP
rs1304165005 1694 dbSNP
rs56260919 1698 dbSNP
rs1226440286 1701 dbSNP
rs1046966692 1702 dbSNP
rs1448002818 1702 dbSNP
rs1298065344 1706 dbSNP
rs1309010875 1707 dbSNP
rs1204913289 1708 dbSNP
rs1195039039 1713 dbSNP
rs1451887893 1714 dbSNP
rs767341961 1721 dbSNP
rs1207599526 1727 dbSNP
rs1341347081 1732 dbSNP
rs1275213036 1735 dbSNP
rs1227598252 1736 dbSNP
rs1339742361 1742 dbSNP
rs1305369939 1748 dbSNP
rs1264666450 1757 dbSNP
rs906692605 1777 dbSNP
rs994782108 1779 dbSNP
rs750116613 1787 dbSNP
rs1025875810 1788 dbSNP
rs952992583 1789 dbSNP
rs1015899932 1790 dbSNP
rs756893281 1801 dbSNP
rs973200916 1809 dbSNP
rs1464096697 1810 dbSNP
rs1186243779 1824 dbSNP
rs1421151649 1839 dbSNP
rs576554207 1843 dbSNP
rs1174719775 1844 dbSNP
rs545893547 1847 dbSNP
rs923048915 1858 dbSNP
rs1196342292 1862 dbSNP
rs954567385 1870 dbSNP
rs753857255 1873 dbSNP
rs6793263 1879 dbSNP
rs532796287 1882 dbSNP
rs1482072652 1884 dbSNP
rs1463467252 1885 dbSNP
rs539806995 1894 dbSNP
rs1219640610 1895 dbSNP
rs1344545596 1901 dbSNP
rs559835421 1915 dbSNP
rs1387966643 1919 dbSNP
rs1433043708 1930 dbSNP
rs1053747664 1931 dbSNP
rs1377848399 1942 dbSNP
rs1408521358 1942 dbSNP
rs1313832627 1944 dbSNP
rs1414220911 1947 dbSNP
rs1362866563 1962 dbSNP
rs916592082 1967 dbSNP
rs1180905444 1986 dbSNP
rs528934666 1986 dbSNP
rs751262995 1986 dbSNP
rs1332498380 1988 dbSNP
rs1235049022 1991 dbSNP
rs948083948 1993 dbSNP
rs1046472325 1994 dbSNP
rs1210766801 1997 dbSNP
rs755073730 1998 dbSNP
rs193176665 2000 dbSNP
rs1441585545 2004 dbSNP
rs548914553 2023 dbSNP
rs1276262499 2024 dbSNP
rs114998237 2032 dbSNP
rs906632330 2034 dbSNP
rs1287785680 2037 dbSNP
rs1357476723 2043 dbSNP
rs994332692 2044 dbSNP
rs1047230246 2051 dbSNP
rs531383345 2053 dbSNP
rs1320770480 2058 dbSNP
rs1402077013 2061 dbSNP
rs1388990064 2062 dbSNP
rs1212974630 2063 dbSNP
rs1005764000 2066 dbSNP
rs964339956 2068 dbSNP
rs1472464661 2071 dbSNP
rs748365552 2072 dbSNP
rs996286711 2074 dbSNP
rs1465487755 2082 dbSNP
rs149222785 2091 dbSNP
rs879225328 2092 dbSNP
rs1267696514 2093 dbSNP
rs1030065245 2096 dbSNP
rs1336962457 2097 dbSNP
rs954645824 2098 dbSNP
rs185283754 2099 dbSNP
rs923788691 2103 dbSNP
rs957906635 2104 dbSNP
rs1364964965 2110 dbSNP
rs1476417876 2114 dbSNP
rs1319412485 2118 dbSNP
rs758611373 2121 dbSNP
rs1432468043 2126 dbSNP
rs1351051310 2135 dbSNP
rs1164931212 2143 dbSNP
rs989388636 2145 dbSNP
rs1166249203 2147 dbSNP
rs1463609047 2150 dbSNP
rs1411826393 2151 dbSNP
rs1169610368 2154 dbSNP
rs1456136844 2156 dbSNP
rs1247192739 2162 dbSNP
rs374056591 2168 dbSNP
rs551734872 2170 dbSNP
rs982548398 2171 dbSNP
rs747290012 2173 dbSNP
rs770724533 2174 dbSNP
rs928040962 2176 dbSNP
rs771362221 2181 dbSNP
rs571533172 2185 dbSNP
rs930067642 2186 dbSNP
rs563581489 2205 dbSNP
rs1229817515 2209 dbSNP
rs1416349917 2209 dbSNP
rs1341829493 2213 dbSNP
rs879154273 2216 dbSNP
rs1295867024 2217 dbSNP
rs1293703504 2228 dbSNP
rs1328319311 2235 dbSNP
rs534207631 2248 dbSNP
rs1047175920 2254 dbSNP
rs1435074520 2264 dbSNP
rs189787702 2268 dbSNP
rs1309707261 2270 dbSNP
rs1222011183 2282 dbSNP
rs888624315 2287 dbSNP
rs1166548492 2293 dbSNP
rs1317045676 2294 dbSNP
rs752385000 2298 dbSNP
rs1208958329 2300 dbSNP
rs941569092 2302 dbSNP
rs1039930979 2322 dbSNP
rs1234687173 2328 dbSNP
rs1206416426 2330 dbSNP
rs567666665 2336 dbSNP
rs995844020 2337 dbSNP
rs771498792 2339 dbSNP
rs1030426269 2347 dbSNP
rs1251567474 2351 dbSNP
rs746424723 2356 dbSNP
rs1218289103 2359 dbSNP
rs1179533259 2360 dbSNP
rs1408792230 2362 dbSNP
rs1289749086 2365 dbSNP
rs536791498 2368 dbSNP
rs1369929796 2370 dbSNP
rs999689090 2371 dbSNP
rs1467357398 2376 dbSNP
rs1377448665 2378 dbSNP
rs1435585713 2380 dbSNP
rs1313193544 2382 dbSNP
rs192788352 2383 dbSNP
rs768143041 2384 dbSNP
rs773918868 2392 dbSNP
rs1439912253 2394 dbSNP
rs777784361 2395 dbSNP
rs1213670005 2404 dbSNP
rs183773037 2415 dbSNP
rs150159691 2419 dbSNP
rs1208978662 2421 dbSNP
rs1310131538 2422 dbSNP
rs138391145 2434 dbSNP
rs376124609 2435 dbSNP
rs1211168673 2443 dbSNP
rs1274365563 2447 dbSNP
rs1379543607 2458 dbSNP
rs1302115719 2459 dbSNP
rs1436490926 2461 dbSNP
rs1391157365 2466 dbSNP
rs1160221007 2467 dbSNP
rs930045133 2469 dbSNP
rs1207222764 2478 dbSNP
rs1234011277 2479 dbSNP
rs1477999727 2481 dbSNP
rs1424963103 2485 dbSNP
rs772938859 2486 dbSNP
rs371248145 2487 dbSNP
rs1396969268 2494 dbSNP
rs1459677097 2497 dbSNP
rs1285018531 2504 dbSNP
rs539846120 2505 dbSNP
rs1168259360 2509 dbSNP
rs1395475291 2512 dbSNP
rs115222502 2513 dbSNP
rs528554670 2514 dbSNP
rs900054871 2523 dbSNP
rs766313551 2524 dbSNP
rs1051396024 2525 dbSNP
rs1372625829 2527 dbSNP
rs890110274 2531 dbSNP
rs548207022 2533 dbSNP
rs1165129082 2537 dbSNP
rs999231467 2539 dbSNP
rs1296482598 2541 dbSNP
rs753800188 2542 dbSNP
rs1337822646 2550 dbSNP
rs1030737037 2554 dbSNP
rs1451669995 2559 dbSNP
rs1249055085 2560 dbSNP
rs893587813 2561 dbSNP
rs878874718 2562 dbSNP
rs1023906228 2564 dbSNP
rs1211166473 2566 dbSNP
rs1451468381 2567 dbSNP
rs1264741613 2569 dbSNP
rs950470609 2570 dbSNP
rs1243700509 2572 dbSNP
rs1343957485 2574 dbSNP
rs969291143 2576 dbSNP
rs1469002398 2580 dbSNP
rs573547894 2581 dbSNP
rs1363346471 2582 dbSNP
rs1325571208 2585 dbSNP
rs1387388174 2592 dbSNP
rs1371511849 2602 dbSNP
rs1432178382 2612 dbSNP
rs1391165409 2614 dbSNP
rs1476527582 2618 dbSNP
rs1034980582 2620 dbSNP
rs1169373728 2622 dbSNP
rs755020561 2623 dbSNP
rs1370942269 2630 dbSNP
rs1419970499 2631 dbSNP
rs951459698 2632 dbSNP
rs542735937 2635 dbSNP
rs562428311 2636 dbSNP
rs1484026612 2637 dbSNP
rs1396010948 2641 dbSNP
rs753818803 2647 dbSNP
rs975530186 2649 dbSNP
rs921435977 2651 dbSNP
rs765400728 2675 dbSNP
rs1330531499 2680 dbSNP
rs560757748 2685 dbSNP
rs1324258454 2690 dbSNP
rs1412206323 2691 dbSNP
rs562088572 2708 dbSNP
rs1271128935 2712 dbSNP
rs763034996 2714 dbSNP
rs924912579 2717 dbSNP
rs1173898529 2721 dbSNP
rs1231974801 2725 dbSNP
rs9850362 2728 dbSNP
rs1336148491 2729 dbSNP
rs1196709463 2735 dbSNP
rs1208130017 2738 dbSNP
rs1473512546 2738 dbSNP
rs1259761675 2755 dbSNP
rs565179457 2756 dbSNP
rs1181396835 2762 dbSNP
rs1448891231 2762 dbSNP
rs78606932 2764 dbSNP
rs751850899 2766 dbSNP
rs1344651225 2768 dbSNP
rs1261313688 2772 dbSNP
rs1010662191 2773 dbSNP
rs1162668469 2774 dbSNP
rs1044869192 2779 dbSNP
rs547702862 2785 dbSNP
rs1342631201 2791 dbSNP
rs1335337169 2793 dbSNP
rs1414656215 2797 dbSNP
rs1461904592 2798 dbSNP
rs567696302 2801 dbSNP
rs867810953 2806 dbSNP
rs1003418673 2818 dbSNP
rs536233525 2821 dbSNP
rs551217442 2831 dbSNP
rs1383542331 2833 dbSNP
rs1188062251 2836 dbSNP
rs1318619183 2837 dbSNP
rs1241487964 2839 dbSNP
rs1355190017 2843 dbSNP
rs1210834939 2849 dbSNP
rs1329857346 2851 dbSNP
rs1413279259 2858 dbSNP
rs1222546809 2859 dbSNP
rs1359135487 2864 dbSNP
rs1285120964 2867 dbSNP
rs550286285 2868 dbSNP
rs1035332550 2870 dbSNP
rs570021735 2871 dbSNP
rs1004141614 2877 dbSNP
rs1436838985 2882 dbSNP
rs1356598606 2883 dbSNP
rs1228324664 2888 dbSNP
rs1259035815 2889 dbSNP
rs757596420 2895 dbSNP
rs56006314 2896 dbSNP
rs1205924891 2899 dbSNP
rs1415929948 2900 dbSNP
rs538870483 2901 dbSNP
rs962730758 2902 dbSNP
rs1484833664 2903 dbSNP
rs1383157523 2906 dbSNP
rs1185472495 2907 dbSNP
rs1213783583 2908 dbSNP
rs1259357666 2908 dbSNP
rs1465557386 2908 dbSNP
rs975478039 2911 dbSNP
rs1291156316 2913 dbSNP
rs1181064419 2915 dbSNP
rs1300351032 2915 dbSNP
rs1230143701 2917 dbSNP
rs1361532696 2919 dbSNP
rs1365542537 2921 dbSNP
rs1454930867 2922 dbSNP
rs921397222 2924 dbSNP
rs955708413 2940 dbSNP
rs1324048989 2941 dbSNP
rs1170302929 2942 dbSNP
rs558680025 2942 dbSNP
rs1432491644 2949 dbSNP
rs570960274 2950 dbSNP
rs1185020414 2951 dbSNP
rs1479014984 2957 dbSNP
rs1376516789 2958 dbSNP
rs1221472439 2960 dbSNP
rs1391308639 2970 dbSNP
rs1277185719 2972 dbSNP
rs1305557589 2980 dbSNP
rs924828078 2981 dbSNP
rs146958403 2986 dbSNP
rs1212459618 2991 dbSNP
rs934916393 2992 dbSNP
rs1274983073 2997 dbSNP
rs1404230178 2999 dbSNP
rs1239817167 3007 dbSNP
rs1052059506 3011 dbSNP
rs914917466 3011 dbSNP
rs746371810 3020 dbSNP
rs946397509 3022 dbSNP
rs1045214937 3023 dbSNP
rs1416448071 3027 dbSNP
rs1345927618 3030 dbSNP
rs904966803 3041 dbSNP
rs1213370307 3043 dbSNP
rs1479727118 3049 dbSNP
rs1254547511 3053 dbSNP
rs1183568683 3055 dbSNP
rs1282176772 3061 dbSNP
rs1482901668 3074 dbSNP
rs1485902279 3074 dbSNP
rs1201986493 3076 dbSNP
rs1278671806 3079 dbSNP
rs1313635091 3079 dbSNP
rs1195125166 3083 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.576 3.1e-3 -0.312 8.4e-2 21 Click to see details
GSE21849 B cell lymphoma 0.431 9.8e-3 0.477 4.4e-3 29 Click to see details
GSE17306 Multiple myeloma -0.315 1.4e-2 -0.427 1.1e-3 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.339 4.9e-2 -0.152 2.3e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.186 5.0e-2 -0.089 2.2e-1 79 Click to see details
GSE19536 Breast cancer -0.165 5.0e-2 -0.097 1.7e-1 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.341 5.6e-2 0.346 5.3e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.317 6.6e-2 0.328 5.9e-2 24 Click to see details
GSE21032 Prostate cancer 0.163 7.0e-2 0.104 1.7e-1 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.334 7.5e-2 0.279 1.2e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.158 1.1e-1 -0.236 3.0e-2 64 Click to see details
GSE28260 Renal cortex and medulla -0.307 1.5e-1 -0.236 2.2e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.246 1.8e-1 -0.112 3.4e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer 0.21 1.9e-1 0.263 1.3e-1 20 Click to see details
GSE28544 Breast cancer 0.162 2.2e-1 0.250 1.2e-1 24 Click to see details
GSE17498 Multiple myeloma -0.111 2.5e-1 -0.247 6.2e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.125 2.8e-1 0.260 1.0e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.097 3.0e-1 0.237 9.6e-2 32 Click to see details
GSE14794 Lymphoblastoid cells -0.05 3.2e-1 0.017 4.4e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.082 4.0e-1 0.056 4.3e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.082 4.0e-1 0.056 4.3e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.379 0.01 0.340 0.01 42 Click to see details
BRCA 0.258 0.01 0.297 0 84 Click to see details
KIRC 0.281 0.01 0.229 0.03 68 Click to see details
THCA -0.212 0.05 -0.163 0.11 59 Click to see details
LUAD 0.468 0.06 0.322 0.15 12 Click to see details
LIHC -0.215 0.07 -0.059 0.34 49 Click to see details
PAAD 0.848 0.08 0.200 0.4 4 Click to see details
CESC -0.94 0.11 -1.000 0.5 3 Click to see details
KICH 0.235 0.13 0.175 0.2 25 Click to see details
CHOL -0.38 0.16 -0.367 0.17 9 Click to see details
BLCA 0.25 0.16 0.228 0.18 18 Click to see details
ESCA -0.327 0.16 -0.509 0.05 11 Click to see details
KIRP -0.173 0.17 -0.253 0.08 32 Click to see details
PCPG 0.563 0.31 0.500 0.33 3 Click to see details
LUSC -0.043 0.4 0.005 0.49 38 Click to see details
PRAD -0.029 0.42 0.055 0.35 50 Click to see details
STAD 0.036 0.42 0.049 0.39 32 Click to see details
UCEC 0.039 0.44 -0.202 0.2 19 Click to see details
COAD 0.053 0.45 -0.143 0.37 8 Click to see details
COAD 0.053 0.45 -0.143 0.37 8 Click to see details
COAD 0.053 0.45 -0.143 0.37 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1