miRTarBase - #MIRT090688 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol U2SURP   
Synonyms SR140, fSAPa
Description U2 snRNP associated SURP domain containing
Transcript NM_001080415   
Expression
Putative miRNA Targets on U2SURP
3'UTR of U2SURP
(miRNA target sites are highlighted)
>U2SURP|NM_001080415|3'UTR
   1 CGTAAATTTTTAAGATGCTGTCACTTATTGGAAATGCGATTTGTTTTGTGCCTGAACGGTCTGTTTTTTAAAAAAACAAA
  81 AAATCAAATGAAAGAGCATTCCTGGGGTTTTTTGTTTGTTTGTGTATGCATGTGTAAACTCATGAGCAACTGCATCTGTA
 161 GATCTGTCATTGTTTTATATTGTGTAAATTACTTTCATTGTGGCTATTTCTCAAGATGAAATTTTTATTGTTCTAATGGA
 241 TTTCATCAGAAATGTGTATAATGGATCTGCTGACAGTAGTAGTATTTTGTTTTAGGATGTTGTGACTTAGCAAAAATAAT
 321 ACAGATGTCTTCCCCCCTTTTGTAGCTTTGACAATTTGAATTAGATTTCAAATAAAATCTGAACAGAAAACTATAATGTT
 401 GTTTTTTTGCCCCACCGGTGATATTAAGTCCCTTAAAGTCCTACTGAGTTTCACACTACTGTTGTGCTTCTTATACCTGA
 481 TGCACTTTATAAGCCCCAGTGTTCAAGTAGCTTAAGTTTTATATTTACTAAGATGACTATCCAAATTAAGGGACCTGAGA
 561 CTCCTATTTGGTGGTTTGCTAACCATTTGCTTTTGATAAGTTTCTCTTGGGTAATACTAATACCCAGATATCAAAGACTA
 641 GGTAGATATGGCATGGCGTTTTGTTAGTGGAATGCCTGGCTAAAACATTTTTTTCACAGAAGCAATATGATTTCCATACA
 721 TCCAACCCATGTTCTGAGCAACTACTTACTTTTAGGGGGAAATTAAATATCTTTTCATTTCCTCTTCTATTATGAAAGAA
 801 GTTTATTTGTAAAACAAATTTTCTAACAAGGTTTGGCCATAGAATTCTCTTGTATGATCGTTGACCTTTTATAATCTTCT
 881 GTAGGCTATCTTTCAAACACTGGCATCAGAATATTTTTTATAAGTTTGTGTTTAAACAGCTTAGTTGGTCCCCCCCCACT
 961 CCCAAGAGACTTGGGTTTAGTTATAGCTTTAAGTAAAATTTAAAAATAAAATGTTTTTCAGGAAACTTCGTATCTAATGG
1041 TTTGTAAATTCAAGGTGCAAAAAGTTGATTTAAACCATTTGCAGAGTTGAACTCTATTATGAAAATAAATTTGCTACGGT
1121 ATGAGGAAGAAATAAAACTTGTGTAATGTTGGTCATAATACTGCTATAAATATAATAAAGGGTTATGTAGAATTGAACTG
1201 ACACTATTATTTGTGAATCTTGATTTCAGTTTTTTATGTAGGCACTTCATACACTGGTTTGATGGGTTTTTTTTTTCCTC
1281 CCTAAAAGAGAAAGTAGAAAACTATTCTAACAATGGATTATTTTGATTTAGCTTGCTTTTTAAAAAAATCTTTTCAACTT
1361 GTTTTACTTAATCTTGCCTAGTCACAAAATAAGATGTGCACCCATGGTTTGGAGAGTTCCTATATTAGCTGAGCAGTGAG
1441 ATACACTATTTCCAAACGGTGCACACCTACAGTAGCTTTGGAAATGAGCCAATCACTGTTTTACTTAATGGTTCTTATCA
1521 GCATGCAAATATTGCTTGAAAGTTATTTCCTTATTCACTGTTTTGTTAGTCCATTTTGTTAGGAAACATTAATTCCTAAA
1601 AATTTGTTCAGAATAATTAAAAGTGAACATTTGGTGCTGATACTCAAAAACCTACAAATGTAGCCATTTAAAAAGTAACA
1681 TGTTTTTCTCCCCTGCTCATTGCCTGGGAGAATGGAATTTTATATAACTACCTTTCTTTGCAAAAATAACGGTCGTGTCG
1761 AGTTGGTGGTGATTTTGGCATTCCATCTTGCACTGGTTTCTAGTATAGGCTTAGAAATAATTGGTCAGGTAATAATCTTT
1841 CCAGTCAAGTTGCAAGGGATGCTTATTTCTCTTCAAAAAAAGACATCCTGCGGGATTGAGTAGAAAATTTTAGGTCAGTT
1921 TTGGGTGCTTATTTGTAATATTTTTCCTACTACATTGGAGTTTAGCAGTTCTTTTTTTCTGGATCCAGATACAAGTGTCA
2001 TGGTTTATCTTACAGTGGGTGAAACTGACTTTCTTTTGGTTGGGTGGGTGAGGATTTCTTAGGCCTGATAGAATATATAT
2081 TCTGTGAAGTTTGTTAATGTACATATTAGATTGTATTGGATTTTTTTTTCTTGAATTGCAAATGGTATTATTAGATAGGT
2161 TATTTCCAGTTTTACTTCATGACAAATTACCTAGAGTAAACCTACTTAATACTCCCATGGATTCTATGAAAGTTTAATGG
2241 GATCAGAAATTGGTGACTTATAAGGGGGAAGATATTCTACCATATTTTTATAATAGCTTATTATTCATGTTTCTTGTCTG
2321 AAGGACACTCAAGTTACAGAGCAAAATTTCTATAGGTTGACTAGAATGTTCATAAGCATGGTCTTCCAGTTGCAGGAAAG
2401 ATCATGTTCTATCTGTGGACACTTACTGTCCTCTACCACAGCTACGTGCCAGAGTTGTTTTCCACAGTTCTTATAAAGGG
2481 CATGACTTAGGCTCTTTACCCTCCAACTTAATGTTTATACACAGGGATTGTTTACTAGGTTAATGACATTTAACTCCCCT
2561 CTCTTCTGTAGGTGAGAGAAAATAAGTAAGTCTTGATCTGTTTCTTACCAAAGAGAGACAGACCTATGATGGAAAATGAT
2641 CACGTCTCTGAATTTTTTCTTTAACGTTATAGTTCCTTATTACAGATAGTAAGCATATGGGAATTTCTGAGCTATAACAT
2721 GTTGAGAAGTTAGAAATTAAAACTAACACAACAAAAGGCGCTGAATCAAAAGATCTTTGCTTTTATTTGGCTCAGAATGT
2801 TTTTGGCTTTTCTGCTAAAGATGGCAGAAATTACTCTACACAGACCTGATTTTTCTTTATTGCAGACCATTCTTGTGGGC
2881 TTACCCTGAGACTTTTATCCCAATTAGTGAATCTTGGAGGGAATACTTGCTTATTTATGACTTAGGTATTTCCCCCCAAA
2961 CTTTAATATTCTTGAGCACTTGAAAATACTTTTGAGAAATTTTAACTGTGATTAAATTTAGGTTTATTAGAAATATTCTG
3041 TACACATTTGCCTCCATGGTGGCGTAAGTTCTGAAAAATTATATGACCGTGACAATAGTTTATCATCATCATTATTGTTA
3121 TTCAAAATAAGGGTAAATAAATCTCTGTATTGCCAAAGTGACTTAAACTGTTCTGATGACCACACAGTGTGATTTCTTTA
3201 GCAGAGAAAGTTGGTTTTAAAAATAAATAGTACCACTTTTCTAAGACTGTACAGTTTACAAATAAGGTTTTTTTCTTTGT
3281 TGTTTTCCTCTTCTATTAAGTTTTAGTGAAAAGCCTAATTACAGAAAATTGTGCAGATACTAGTGAAGATACTAGTATAA
3361 GTTTAAAGGAACACGTGACTGTAAAATCTCACATTTACAAAGTGCTTGATCTCTTCATATTTCACACGCATGTTTTAGAA
3441 TAGATTTTAGGGAGTGTTTAATTCATTATCCTTTTGACTTAAAATTTTTGTTACCAACTTCCTAGGACTTAGATAATATA
3521 TAAATAAGTACAAATCCCAGGGGAAGTGTTGTGATGCTAGACTAAAAGGTGGGAATGTGCTGCTGTTCCGTGAGCCTTGT
3601 TCCATTGTTGAAAATTTGATGCCTCAGTGTTTATTCAGTACCACCTCATGGAGCTTCAATGTAAATGGATTATATGTATA
3681 ATTGGTAATTTGTATAGTTTTGTAGATTGTAGATTAAATGCACTCATCATGTCACATGTAATTGTGCTTGGAGTATTTGT
3761 GTTTTATTCTTTTACTTCAACGGGTTCTTGTCTGTTACATCTCTGGTGATTTGAAATATCAGGAAAGACAGTTTGTCAGA
3841 AATGAGAATAATATAGTTGAAATCAGTTGGGCTAAAATATTCTACAGCAAGACAATTTCTTTTGGGTGAACTGATTCTAT
3921 AATTTACTTACTTTTAATGTAAGGATTAGATTTATTGTTGAGCTGCTTTCCAGATCAGACTGTCACTTTATAGTTTTTCT
4001 ACATAAAGATTATATAGTTGCAAACAAAGGTTGTGAAATTTCCCTTTTGTTGTTTTTGACTTTTAATTAATAAAAGTACA
4081 TTGTTTTCATAGCAAACTTAGACTGTCCATGTAATTTTCTCCATATTGTTTTTCCGATGCAAGCCCAGTTAATAATTAGT
4161 TTTTTAGCAGCTTTCTCTCAAGTGAAATAAGTGATGTGACATGTTTATCAGTTATGGCTAAAATGTTACACTTTACATGT
4241 TTAAACTATAATCATATGTTTTCATGCTAGATGGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA---AUACACGACGAu 5'
            :|||  :|    |||||||||| 
Target 5' acTAAAAGGTGGGAATGTGCTGCTg 3'
3561 - 3585 156.00 -16.40
2
miRNA  3' guGUUUGGUAAU-ACACGACGAu 5'
            || ||:| |: |||||| || 
Target 5' ttCACACTACTGTTGTGCTTCTt 3'
450 - 472 136.00 -12.30
3
miRNA  3' guGUUU-GGUAAU-ACACGACGAu 5'
            :|:| ::|||: || |||||| 
Target 5' atTAGATTTATTGTTGAGCTGCTt 3'
3945 - 3968 132.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30116290 2 COSMIC
COSN30757047 12 COSMIC
COSN30466091 23 COSMIC
COSN30112393 31 COSMIC
COSN30512783 31 COSMIC
COSN28884359 38 COSMIC
COSN31526470 64 COSMIC
COSN7822056 71 COSMIC
COSN30129578 77 COSMIC
COSN30118111 84 COSMIC
COSN30532073 86 COSMIC
COSN30529388 94 COSMIC
COSN31554546 102 COSMIC
COSN31566575 182 COSMIC
COSN31526484 229 COSMIC
COSN28640915 248 COSMIC
COSN26552549 300 COSMIC
COSN22330544 318 COSMIC
COSN6733463 361 COSMIC
COSN16840929 394 COSMIC
COSN31480485 536 COSMIC
COSN31549449 565 COSMIC
COSN31548580 777 COSMIC
COSN20099183 958 COSMIC
COSN31514007 996 COSMIC
COSN31526478 1030 COSMIC
COSN32064421 1182 COSMIC
COSN7822057 1220 COSMIC
COSN32057049 1267 COSMIC
COSN23988138 1268 COSMIC
COSN28941150 1277 COSMIC
COSN29561058 1277 COSMIC
COSN31570142 1348 COSMIC
COSN20099187 1439 COSMIC
COSN31526498 1691 COSMIC
COSN31487412 1711 COSMIC
COSN31514680 1754 COSMIC
COSN32177616 1888 COSMIC
COSN21466439 1953 COSMIC
COSN1917792 2008 COSMIC
COSN21932659 2077 COSMIC
COSN29284477 2115 COSMIC
COSN15662119 2217 COSMIC
COSN7822058 2234 COSMIC
COSN32065002 2296 COSMIC
COSN8908382 2404 COSMIC
COSN5145723 2414 COSMIC
COSN17690172 2653 COSMIC
COSN31546580 2660 COSMIC
COSN30173461 2727 COSMIC
COSN31482360 2839 COSMIC
COSN31482576 2857 COSMIC
COSN16275852 3291 COSMIC
COSN20733950 3301 COSMIC
COSN30053897 3312 COSMIC
COSN30538957 3352 COSMIC
COSN27859856 3485 COSMIC
COSN31489933 3637 COSMIC
COSN1917793 3679 COSMIC
COSN29907843 3691 COSMIC
COSN20956316 3763 COSMIC
COSN31602931 3782 COSMIC
COSN17795911 3826 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778410944 2 dbSNP
rs754417273 3 dbSNP
rs1198706349 8 dbSNP
rs1305094372 9 dbSNP
rs1399503990 11 dbSNP
rs1161881663 16 dbSNP
rs757529854 21 dbSNP
rs201223643 24 dbSNP
rs373003796 25 dbSNP
rs746239161 29 dbSNP
rs768236928 35 dbSNP
rs780824150 37 dbSNP
rs376933947 38 dbSNP
rs201644832 39 dbSNP
rs1224920245 40 dbSNP
rs1414333816 41 dbSNP
rs746927386 44 dbSNP
rs557697843 58 dbSNP
rs1008267346 59 dbSNP
rs1261187792 64 dbSNP
rs544101182 70 dbSNP
rs1216739127 71 dbSNP
rs1489046648 78 dbSNP
rs1195640538 86 dbSNP
rs1214697925 89 dbSNP
rs1322689586 96 dbSNP
rs964024590 97 dbSNP
rs1231931620 102 dbSNP
rs1355403910 106 dbSNP
rs973935365 108 dbSNP
rs1401888259 109 dbSNP
rs1449862708 111 dbSNP
rs1288494816 114 dbSNP
rs1458665607 127 dbSNP
rs1350187055 128 dbSNP
rs1166847502 130 dbSNP
rs1459768458 134 dbSNP
rs1021554298 140 dbSNP
rs1194354729 142 dbSNP
rs903212365 143 dbSNP
rs999047824 147 dbSNP
rs1393176785 150 dbSNP
rs576050433 175 dbSNP
rs951275761 176 dbSNP
rs1172619713 183 dbSNP
rs1383673625 185 dbSNP
rs1380133691 190 dbSNP
rs35706965 196 dbSNP
rs1334657146 207 dbSNP
rs1319889746 208 dbSNP
rs1035977001 211 dbSNP
rs147882033 213 dbSNP
rs960480321 215 dbSNP
rs561558310 216 dbSNP
rs542069458 217 dbSNP
rs1327627665 234 dbSNP
rs1393523805 238 dbSNP
rs1171287198 251 dbSNP
rs952466376 255 dbSNP
rs1234667211 256 dbSNP
rs1260168190 258 dbSNP
rs1169158023 264 dbSNP
rs917655589 267 dbSNP
rs141610970 268 dbSNP
rs970470725 273 dbSNP
rs1191410305 275 dbSNP
rs983888762 275 dbSNP
rs371418610 276 dbSNP
rs926254390 278 dbSNP
rs1338032251 283 dbSNP
rs1250784673 286 dbSNP
rs1234096781 298 dbSNP
rs1207048971 300 dbSNP
rs1301504877 302 dbSNP
rs565011956 306 dbSNP
rs1262711111 317 dbSNP
rs1331801932 328 dbSNP
rs908189360 332 dbSNP
rs1394284931 334 dbSNP
rs1468248926 337 dbSNP
rs936346452 338 dbSNP
rs1250949088 339 dbSNP
rs1171358325 350 dbSNP
rs1455513020 355 dbSNP
rs1054703375 366 dbSNP
rs1362650348 375 dbSNP
rs1184455774 382 dbSNP
rs1436539972 385 dbSNP
rs914865787 386 dbSNP
rs184240580 387 dbSNP
rs1159855334 389 dbSNP
rs1388915282 393 dbSNP
rs1041852538 403 dbSNP
rs550519967 411 dbSNP
rs375690606 417 dbSNP
rs1324279607 418 dbSNP
rs760584014 420 dbSNP
rs560781411 424 dbSNP
rs932564304 425 dbSNP
rs1240876756 435 dbSNP
rs1039780211 456 dbSNP
rs1306184440 457 dbSNP
rs1376672562 461 dbSNP
rs1396602472 461 dbSNP
rs150437605 467 dbSNP
rs1310557440 475 dbSNP
rs1360806193 480 dbSNP
rs1387817536 482 dbSNP
rs899825473 485 dbSNP
rs1333995939 486 dbSNP
rs1476479039 494 dbSNP
rs1255425204 497 dbSNP
rs1210293963 498 dbSNP
rs1488679651 499 dbSNP
rs1241256612 505 dbSNP
rs530880896 507 dbSNP
rs1268918580 508 dbSNP
rs1348268091 513 dbSNP
rs1049547877 516 dbSNP
rs1259931569 518 dbSNP
rs1233762851 524 dbSNP
rs772949413 526 dbSNP
rs1027308218 533 dbSNP
rs1413599567 547 dbSNP
rs947452774 565 dbSNP
rs1340652585 567 dbSNP
rs1212105626 568 dbSNP
rs1319868373 576 dbSNP
rs1043148144 580 dbSNP
rs951368509 583 dbSNP
rs1384623387 589 dbSNP
rs370550944 596 dbSNP
rs1164217758 598 dbSNP
rs548982132 601 dbSNP
rs1463434796 603 dbSNP
rs1024781807 609 dbSNP
rs1187927264 618 dbSNP
rs575012389 619 dbSNP
rs1489345746 624 dbSNP
rs373943493 629 dbSNP
rs567484875 640 dbSNP
rs1478181175 645 dbSNP
rs970567645 647 dbSNP
rs1249720563 648 dbSNP
rs1191217616 649 dbSNP
rs187309558 650 dbSNP
rs1036101208 658 dbSNP
rs896034603 659 dbSNP
rs1336727775 668 dbSNP
rs1271173469 672 dbSNP
rs1412131369 687 dbSNP
rs546737784 688 dbSNP
rs989202455 688 dbSNP
rs1162388371 702 dbSNP
rs1013597658 718 dbSNP
rs1271439101 719 dbSNP
rs1023108424 721 dbSNP
rs1325517388 735 dbSNP
rs1326216839 736 dbSNP
rs1443531982 743 dbSNP
rs952879425 744 dbSNP
rs1164823843 745 dbSNP
rs370423541 754 dbSNP
rs1458747521 755 dbSNP
rs946284431 760 dbSNP
rs1475185609 761 dbSNP
rs1298021854 774 dbSNP
rs1195787141 778 dbSNP
rs1042373080 785 dbSNP
rs1469642552 785 dbSNP
rs983857897 790 dbSNP
rs1393684143 794 dbSNP
rs944231762 812 dbSNP
rs1354923006 816 dbSNP
rs867308512 820 dbSNP
rs1274444678 824 dbSNP
rs1212262295 826 dbSNP
rs1338234322 829 dbSNP
rs542545766 832 dbSNP
rs961029044 842 dbSNP
rs1303670016 853 dbSNP
rs1236122765 855 dbSNP
rs1043898 860 dbSNP
rs1443500565 861 dbSNP
rs922270347 872 dbSNP
rs1327483427 875 dbSNP
rs1409430211 881 dbSNP
rs1426034943 884 dbSNP
rs1222029518 891 dbSNP
rs953959539 895 dbSNP
rs1452816839 896 dbSNP
rs138272199 901 dbSNP
rs557044828 913 dbSNP
rs575111724 919 dbSNP
rs191842970 921 dbSNP
rs1043116699 929 dbSNP
rs887121199 938 dbSNP
rs1202420937 949 dbSNP
rs1485061767 949 dbSNP
rs10655158 950 dbSNP
rs1224655474 950 dbSNP
rs924656782 950 dbSNP
rs386398124 951 dbSNP
rs1278283939 953 dbSNP
rs1376080139 954 dbSNP
rs1025334931 955 dbSNP
rs970536507 956 dbSNP
rs1409972665 957 dbSNP
rs397704676 958 dbSNP
rs957737316 958 dbSNP
rs1319103667 959 dbSNP
rs934751959 966 dbSNP
rs1223664072 971 dbSNP
rs1356687821 988 dbSNP
rs1424097268 991 dbSNP
rs184067845 996 dbSNP
rs1057101594 1004 dbSNP
rs1371748807 1005 dbSNP
rs1455541780 1008 dbSNP
rs1346684216 1009 dbSNP
rs1156694743 1014 dbSNP
rs1456602895 1019 dbSNP
rs1418446395 1030 dbSNP
rs966794854 1031 dbSNP
rs977681012 1032 dbSNP
rs573407929 1035 dbSNP
rs1463932717 1045 dbSNP
rs1186680274 1052 dbSNP
rs895822072 1056 dbSNP
rs1486651907 1060 dbSNP
rs1240677218 1062 dbSNP
rs1374871719 1065 dbSNP
rs1215565613 1066 dbSNP
rs1335974572 1077 dbSNP
rs1013149746 1082 dbSNP
rs1232068766 1087 dbSNP
rs1334160505 1095 dbSNP
rs912844495 1095 dbSNP
rs944202310 1097 dbSNP
rs1045071052 1110 dbSNP
rs149625881 1116 dbSNP
rs1005762918 1117 dbSNP
rs77943591 1118 dbSNP
rs528139856 1119 dbSNP
rs1048976425 1120 dbSNP
rs565046965 1121 dbSNP
rs1294526515 1129 dbSNP
rs1367324022 1139 dbSNP
rs1305582669 1147 dbSNP
rs998329373 1152 dbSNP
rs1230435161 1154 dbSNP
rs1429890376 1159 dbSNP
rs1275280580 1161 dbSNP
rs1416915368 1162 dbSNP
rs1187598595 1168 dbSNP
rs1347133339 1172 dbSNP
rs1029352412 1174 dbSNP
rs1208093476 1175 dbSNP
rs1469183035 1183 dbSNP
rs1238740972 1185 dbSNP
rs953818010 1190 dbSNP
rs1255286999 1193 dbSNP
rs985405481 1194 dbSNP
rs1251922565 1196 dbSNP
rs915123905 1197 dbSNP
rs1185593060 1208 dbSNP
rs1229663384 1210 dbSNP
rs1305889258 1223 dbSNP
rs1295111015 1225 dbSNP
rs1235385952 1229 dbSNP
rs1260033974 1230 dbSNP
rs1327688142 1230 dbSNP
rs967938552 1236 dbSNP
rs370562641 1237 dbSNP
rs1389968079 1241 dbSNP
rs1298706791 1242 dbSNP
rs1169693361 1247 dbSNP
rs1395009140 1252 dbSNP
rs1433448502 1264 dbSNP
rs1352268459 1265 dbSNP
rs1451915973 1267 dbSNP
rs940045907 1267 dbSNP
rs977931282 1267 dbSNP
rs1046304768 1268 dbSNP
rs923764994 1271 dbSNP
rs1430231216 1278 dbSNP
rs1287340388 1279 dbSNP
rs1359536004 1281 dbSNP
rs576963845 1282 dbSNP
rs1298151575 1283 dbSNP
rs1198092530 1286 dbSNP
rs1479660230 1291 dbSNP
rs906490542 1293 dbSNP
rs934771518 1299 dbSNP
rs1033480489 1310 dbSNP
rs764594587 1314 dbSNP
rs1231748811 1316 dbSNP
rs1330319375 1317 dbSNP
rs893654919 1321 dbSNP
rs1214545367 1327 dbSNP
rs1370527617 1330 dbSNP
rs1306928447 1331 dbSNP
rs755014015 1342 dbSNP
rs1376855405 1343 dbSNP
rs1466031847 1351 dbSNP
rs1465805185 1352 dbSNP
rs948695316 1359 dbSNP
rs1252820087 1365 dbSNP
rs1453066506 1366 dbSNP
rs1021144485 1369 dbSNP
rs1184593980 1377 dbSNP
rs1193460012 1382 dbSNP
rs546672719 1383 dbSNP
rs544297126 1386 dbSNP
rs1251138417 1394 dbSNP
rs138992033 1397 dbSNP
rs888739930 1398 dbSNP
rs530023998 1400 dbSNP
rs987576073 1402 dbSNP
rs1278396446 1403 dbSNP
rs1200101866 1414 dbSNP
rs549272574 1418 dbSNP
rs1157084336 1423 dbSNP
rs1019821886 1424 dbSNP
rs1261157341 1428 dbSNP
rs1391102570 1430 dbSNP
rs560994687 1436 dbSNP
rs143332183 1438 dbSNP
rs1320952621 1444 dbSNP
rs757949113 1445 dbSNP
rs571142086 1446 dbSNP
rs528300381 1449 dbSNP
rs867737707 1458 dbSNP
rs984209014 1459 dbSNP
rs1386113973 1460 dbSNP
rs1160701609 1466 dbSNP
rs1452222518 1470 dbSNP
rs897308480 1482 dbSNP
rs546860200 1483 dbSNP
rs75845909 1487 dbSNP
rs1046394164 1491 dbSNP
rs531346096 1500 dbSNP
rs953743802 1508 dbSNP
rs112485071 1519 dbSNP
rs1262131684 1521 dbSNP
rs1021910831 1522 dbSNP
rs967969169 1524 dbSNP
rs977962305 1525 dbSNP
rs192879844 1526 dbSNP
rs1030811805 1529 dbSNP
rs1336297874 1533 dbSNP
rs1011182279 1535 dbSNP
rs1243582134 1548 dbSNP
rs960795692 1552 dbSNP
rs1470132115 1554 dbSNP
rs992935131 1558 dbSNP
rs1414342087 1561 dbSNP
rs111916583 1564 dbSNP
rs1388376241 1574 dbSNP
rs1327165091 1583 dbSNP
rs1463532916 1587 dbSNP
rs1415745242 1588 dbSNP
rs771570529 1588 dbSNP
rs1475802097 1602 dbSNP
rs1008649237 1605 dbSNP
rs917282130 1606 dbSNP
rs550681015 1610 dbSNP
rs1164515455 1625 dbSNP
rs1018529635 1626 dbSNP
rs368298057 1629 dbSNP
rs1403402036 1634 dbSNP
rs1469804514 1635 dbSNP
rs1287091109 1654 dbSNP
rs1325362739 1657 dbSNP
rs1227205003 1659 dbSNP
rs1339505844 1669 dbSNP
rs980132298 1671 dbSNP
rs568850915 1672 dbSNP
rs114747828 1673 dbSNP
rs1225729778 1674 dbSNP
rs1350371405 1674 dbSNP
rs386666555 1674 dbSNP
rs909870541 1676 dbSNP
rs1277218658 1677 dbSNP
rs941616865 1678 dbSNP
rs1443717369 1681 dbSNP
rs1348610202 1684 dbSNP
rs1028560756 1692 dbSNP
rs1410547381 1694 dbSNP
rs1398732836 1699 dbSNP
rs1351832140 1703 dbSNP
rs952903176 1724 dbSNP
rs372568456 1725 dbSNP
rs1449154725 1730 dbSNP
rs1037261385 1732 dbSNP
rs1332299642 1736 dbSNP
rs1455443865 1744 dbSNP
rs897339563 1751 dbSNP
rs1220756349 1752 dbSNP
rs751309391 1755 dbSNP
rs142270080 1756 dbSNP
rs1202566155 1758 dbSNP
rs1341074435 1760 dbSNP
rs1280641315 1761 dbSNP
rs1365946783 1764 dbSNP
rs889570444 1767 dbSNP
rs1006629773 1780 dbSNP
rs1443646680 1781 dbSNP
rs982207430 1784 dbSNP
rs1291086159 1796 dbSNP
rs1437732821 1803 dbSNP
rs1443381241 1806 dbSNP
rs1021941842 1811 dbSNP
rs1429310704 1821 dbSNP
rs903506588 1825 dbSNP
rs999413491 1828 dbSNP
rs938016160 1829 dbSNP
rs745830342 1833 dbSNP
rs1187412946 1836 dbSNP
rs1422799765 1841 dbSNP
rs866451869 1842 dbSNP
rs1470502027 1846 dbSNP
rs1055031520 1848 dbSNP
rs756536745 1849 dbSNP
rs915175436 1856 dbSNP
rs946567306 1863 dbSNP
rs1042574573 1868 dbSNP
rs902352927 1870 dbSNP
rs1278429312 1875 dbSNP
rs1409264529 1875 dbSNP
rs1224805155 1881 dbSNP
rs1030843207 1888 dbSNP
rs1353516809 1889 dbSNP
rs145930029 1892 dbSNP
rs534210789 1893 dbSNP
rs1040123519 1896 dbSNP
rs1409890714 1901 dbSNP
rs1446172317 1903 dbSNP
rs1023459981 1915 dbSNP
rs558772771 1926 dbSNP
rs1311819808 1927 dbSNP
rs1401109477 1930 dbSNP
rs1414035962 1935 dbSNP
rs1156876768 1946 dbSNP
rs980163271 1950 dbSNP
rs1338304719 1955 dbSNP
rs1449838804 1964 dbSNP
rs995833713 1966 dbSNP
rs909901484 1969 dbSNP
rs953038869 1972 dbSNP
rs1449117568 1979 dbSNP
rs577000905 1986 dbSNP
rs1228320782 1987 dbSNP
rs1339171827 1991 dbSNP
rs972986837 1992 dbSNP
rs544331812 1995 dbSNP
rs918792926 1996 dbSNP
rs961588295 2002 dbSNP
rs1277410487 2014 dbSNP
rs1390569772 2027 dbSNP
rs1318458356 2029 dbSNP
rs1456694816 2036 dbSNP
rs934256114 2040 dbSNP
rs1166343006 2045 dbSNP
rs1051732621 2047 dbSNP
rs928059690 2063 dbSNP
rs1412557935 2065 dbSNP
rs1186751979 2076 dbSNP
rs959351549 2078 dbSNP
rs990856916 2087 dbSNP
rs1210244217 2097 dbSNP
rs780636700 2103 dbSNP
rs915247229 2106 dbSNP
rs1219403331 2121 dbSNP
rs1321213763 2121 dbSNP
rs946591055 2121 dbSNP
rs1042320842 2130 dbSNP
rs3088201 2131 dbSNP
rs11549146 2138 dbSNP
rs1367077848 2143 dbSNP
rs199662686 2145 dbSNP
rs1395076769 2146 dbSNP
rs923751673 2146 dbSNP
rs944570996 2149 dbSNP
rs1170701806 2152 dbSNP
rs1348795593 2152 dbSNP
rs1182338958 2154 dbSNP
rs1188550096 2159 dbSNP
rs1237772012 2170 dbSNP
rs1040094242 2179 dbSNP
rs1043429116 2186 dbSNP
rs903537673 2191 dbSNP
rs1455001188 2192 dbSNP
rs1474969079 2205 dbSNP
rs999108550 2206 dbSNP
rs1166545183 2210 dbSNP
rs1030622091 2212 dbSNP
rs1488196714 2214 dbSNP
rs7623532 2217 dbSNP
rs139831543 2218 dbSNP
rs1340353084 2219 dbSNP
rs1013490637 2227 dbSNP
rs887466403 2229 dbSNP
rs1023912711 2230 dbSNP
rs1172451187 2233 dbSNP
rs141613900 2236 dbSNP
rs1015868499 2245 dbSNP
rs1001631925 2247 dbSNP
rs1366271357 2262 dbSNP
rs1298298190 2263 dbSNP
rs1431141257 2265 dbSNP
rs1397374888 2269 dbSNP
rs1167592953 2272 dbSNP
rs897313190 2280 dbSNP
rs1379802992 2283 dbSNP
rs560530405 2284 dbSNP
rs528424956 2285 dbSNP
rs1035098617 2303 dbSNP
rs1184386096 2303 dbSNP
rs1482126577 2308 dbSNP
rs1251282517 2317 dbSNP
rs565100386 2319 dbSNP
rs185865282 2333 dbSNP
rs990909434 2334 dbSNP
rs1257597978 2335 dbSNP
rs1230944208 2338 dbSNP
rs150757578 2346 dbSNP
rs968094038 2353 dbSNP
rs978401357 2357 dbSNP
rs923915012 2369 dbSNP
rs532313038 2372 dbSNP
rs1307025955 2373 dbSNP
rs1234235656 2377 dbSNP
rs1415081576 2384 dbSNP
rs1404773819 2387 dbSNP
rs1278237206 2393 dbSNP
rs1171234037 2401 dbSNP
rs962703194 2410 dbSNP
rs778806697 2412 dbSNP
rs918584699 2420 dbSNP
rs1201194327 2421 dbSNP
rs1188901834 2422 dbSNP
rs7635468 2424 dbSNP
rs115091996 2427 dbSNP
rs1198469089 2429 dbSNP
rs911394413 2430 dbSNP
rs1268616236 2434 dbSNP
rs1230228779 2442 dbSNP
rs942838434 2446 dbSNP
rs1043459201 2447 dbSNP
rs1048824303 2454 dbSNP
rs925074086 2454 dbSNP
rs772178698 2456 dbSNP
rs529702797 2461 dbSNP
rs139142135 2470 dbSNP
rs1013938396 2474 dbSNP
rs566459186 2475 dbSNP
rs1456165143 2476 dbSNP
rs746890971 2487 dbSNP
rs1044959344 2503 dbSNP
rs1366881282 2504 dbSNP
rs905031843 2519 dbSNP
rs1423028990 2526 dbSNP
rs1172710210 2534 dbSNP
rs1383782685 2535 dbSNP
rs1463520729 2548 dbSNP
rs1006018035 2558 dbSNP
rs1035152310 2559 dbSNP
rs1281997480 2559 dbSNP
rs895328733 2560 dbSNP
rs149920065 2568 dbSNP
rs1366357753 2569 dbSNP
rs1389885873 2579 dbSNP
rs1433485561 2583 dbSNP
rs150892230 2583 dbSNP
rs1388493200 2591 dbSNP
rs1012721466 2602 dbSNP
rs1440732992 2603 dbSNP
rs190293233 2609 dbSNP
rs1162880284 2610 dbSNP
rs968445142 2611 dbSNP
rs1234053801 2612 dbSNP
rs1016100023 2616 dbSNP
rs1247276686 2616 dbSNP
rs1199493166 2644 dbSNP
rs962819790 2647 dbSNP
rs1287199901 2651 dbSNP
rs1208845837 2656 dbSNP
rs1279080445 2666 dbSNP
rs868669474 2668 dbSNP
rs1327311287 2672 dbSNP
rs34680345 2675 dbSNP
rs1210845523 2688 dbSNP
rs994237965 2689 dbSNP
rs181026571 2694 dbSNP
rs1275960706 2695 dbSNP
rs1439296737 2696 dbSNP
rs1329401148 2699 dbSNP
rs558808660 2705 dbSNP
rs1323019947 2712 dbSNP
rs921747805 2721 dbSNP
rs1372593078 2727 dbSNP
rs1465186022 2730 dbSNP
rs1166964086 2744 dbSNP
rs1212924478 2746 dbSNP
rs768443474 2746 dbSNP
rs1265162418 2750 dbSNP
rs1389396333 2754 dbSNP
rs1434902864 2760 dbSNP
rs570723594 2761 dbSNP
rs987469035 2767 dbSNP
rs538019144 2788 dbSNP
rs911440488 2790 dbSNP
rs1197497836 2793 dbSNP
rs1471384439 2800 dbSNP
rs1160936999 2806 dbSNP
rs1483108537 2823 dbSNP
rs1301542968 2827 dbSNP
rs964261724 2834 dbSNP
rs557647045 2837 dbSNP
rs1341885286 2839 dbSNP
rs1279846480 2841 dbSNP
rs1221406041 2842 dbSNP
rs556619607 2846 dbSNP
rs979605266 2860 dbSNP
rs1274801618 2862 dbSNP
rs574878137 2863 dbSNP
rs1352413065 2876 dbSNP
rs1306398990 2893 dbSNP
rs1409504776 2901 dbSNP
rs940345632 2902 dbSNP
rs1334611858 2904 dbSNP
rs925442246 2908 dbSNP
rs1422913988 2911 dbSNP
rs1171936736 2926 dbSNP
rs1472632058 2931 dbSNP
rs569066643 2942 dbSNP
rs1413610756 2943 dbSNP
rs1179546778 2947 dbSNP
rs1393477970 2953 dbSNP
rs1482549694 2959 dbSNP
rs1035988333 2964 dbSNP
rs1212628287 2969 dbSNP
rs1328205843 2977 dbSNP
rs935105597 2978 dbSNP
rs1348739914 2980 dbSNP
rs1278457514 2992 dbSNP
rs536147091 2993 dbSNP
rs1289234031 2994 dbSNP
rs1331306365 2999 dbSNP
rs1286583672 3004 dbSNP
rs1227979702 3012 dbSNP
rs1334507740 3015 dbSNP
rs1380105597 3016 dbSNP
rs1286193785 3020 dbSNP
rs186013558 3023 dbSNP
rs949045455 3027 dbSNP
rs1357285239 3030 dbSNP
rs1335991654 3040 dbSNP
rs1045388377 3049 dbSNP
rs1390169035 3063 dbSNP
rs17633378 3064 dbSNP
rs1413999097 3065 dbSNP
rs572458148 3065 dbSNP
rs540549879 3072 dbSNP
rs1210394697 3080 dbSNP
rs1037564455 3081 dbSNP
rs377442417 3083 dbSNP
rs1250346283 3088 dbSNP
rs994674901 3089 dbSNP
rs565149201 3090 dbSNP
rs1044197031 3096 dbSNP
rs1208128825 3102 dbSNP
rs1322418335 3102 dbSNP
rs188040338 3105 dbSNP
rs1315026355 3109 dbSNP
rs1183788119 3111 dbSNP
rs1314166755 3111 dbSNP
rs1435590262 3113 dbSNP
rs544382928 3114 dbSNP
rs1318478736 3120 dbSNP
rs1000027376 3121 dbSNP
rs1163097797 3122 dbSNP
rs374011529 3126 dbSNP
rs1030933329 3128 dbSNP
rs1370584761 3132 dbSNP
rs1458829061 3134 dbSNP
rs1189569795 3141 dbSNP
rs1188488583 3146 dbSNP
rs1451739944 3146 dbSNP
rs1488842105 3149 dbSNP
rs1267357873 3159 dbSNP
rs1219612975 3167 dbSNP
rs544203283 3172 dbSNP
rs1167848488 3178 dbSNP
rs1275650337 3181 dbSNP
rs891124421 3186 dbSNP
rs966036854 3198 dbSNP
rs1295310933 3201 dbSNP
rs1381634524 3220 dbSNP
rs1367666805 3224 dbSNP
rs140580112 3228 dbSNP
rs1008269542 3231 dbSNP
rs1364511812 3233 dbSNP
rs1355024067 3244 dbSNP
rs765253225 3249 dbSNP
rs1028897716 3261 dbSNP
rs1388775308 3267 dbSNP
rs1170335767 3268 dbSNP
rs566480161 3268 dbSNP
rs1018684145 3270 dbSNP
rs548244896 3273 dbSNP
rs1310266608 3276 dbSNP
rs1323292722 3280 dbSNP
rs1245358449 3282 dbSNP
rs566378715 3283 dbSNP
rs979634939 3289 dbSNP
rs1032491353 3305 dbSNP
rs956840680 3308 dbSNP
rs1344025053 3316 dbSNP
rs1272269451 3318 dbSNP
rs1340049088 3331 dbSNP
rs988303458 3334 dbSNP
rs917633774 3344 dbSNP
rs1226560002 3348 dbSNP
rs1312658204 3350 dbSNP
rs1303342007 3353 dbSNP
rs909040227 3362 dbSNP
rs1344324988 3369 dbSNP
rs10790 3375 dbSNP
rs1411333026 3376 dbSNP
rs1369064787 3380 dbSNP
rs972236798 3380 dbSNP
rs1251971936 3382 dbSNP
rs980494183 3393 dbSNP
rs928260735 3399 dbSNP
rs1174586466 3400 dbSNP
rs938351264 3403 dbSNP
rs111440951 3428 dbSNP
rs762505646 3429 dbSNP
rs916874787 3431 dbSNP
rs948308370 3436 dbSNP
rs1258621699 3438 dbSNP
rs1257621743 3442 dbSNP
rs1201768398 3464 dbSNP
rs1322196609 3465 dbSNP
rs1043866787 3469 dbSNP
rs62276908 3471 dbSNP
rs1348189340 3478 dbSNP
rs1037596856 3479 dbSNP
rs1396911114 3481 dbSNP
rs1404890415 3484 dbSNP
rs1301596190 3492 dbSNP
rs1469785707 3503 dbSNP
rs1192990710 3510 dbSNP
rs999594382 3514 dbSNP
rs1161407875 3516 dbSNP
rs1363377456 3519 dbSNP
rs1388847799 3520 dbSNP
rs897670905 3525 dbSNP
rs576944236 3527 dbSNP
rs1424170361 3534 dbSNP
rs1258076737 3543 dbSNP
rs570761052 3544 dbSNP
rs537979041 3546 dbSNP
rs1374948526 3551 dbSNP
rs1268719074 3554 dbSNP
rs1052031169 3557 dbSNP
rs768036099 3558 dbSNP
rs1209994048 3560 dbSNP
rs891246116 3562 dbSNP
rs1259782951 3565 dbSNP
rs1245145014 3577 dbSNP
rs1342615822 3583 dbSNP
rs1311076202 3588 dbSNP
rs1008715705 3590 dbSNP
rs1018254215 3591 dbSNP
rs1455647632 3595 dbSNP
rs899820434 3607 dbSNP
rs1164033509 3614 dbSNP
rs1459683780 3626 dbSNP
rs1366971580 3627 dbSNP
rs997504748 3628 dbSNP
rs778551282 3634 dbSNP
rs1190512458 3637 dbSNP
rs1032520666 3639 dbSNP
rs1296650356 3644 dbSNP
rs1357973944 3646 dbSNP
rs956871120 3648 dbSNP
rs988364707 3660 dbSNP
rs1343319881 3662 dbSNP
rs1300441874 3670 dbSNP
rs1429313263 3675 dbSNP
rs1230550936 3683 dbSNP
rs1325907425 3695 dbSNP
rs962203616 3696 dbSNP
rs971788839 3701 dbSNP
rs1025554241 3703 dbSNP
rs879715003 3703 dbSNP
rs8831 3704 dbSNP
rs991115274 3705 dbSNP
rs1311106924 3707 dbSNP
rs1390624032 3710 dbSNP
rs1170393816 3724 dbSNP
rs915588366 3726 dbSNP
rs1207515773 3727 dbSNP
rs1198889037 3729 dbSNP
rs1257381758 3732 dbSNP
rs1483409465 3737 dbSNP
rs13715 3741 dbSNP
rs1044389655 3745 dbSNP
rs1246622630 3752 dbSNP
rs1213290741 3762 dbSNP
rs925457916 3767 dbSNP
rs1275977253 3770 dbSNP
rs1189783680 3774 dbSNP
rs1424478980 3779 dbSNP
rs144530445 3781 dbSNP
rs369681099 3782 dbSNP
rs1370909121 3783 dbSNP
rs1309580813 3788 dbSNP
rs1052467309 3791 dbSNP
rs535613048 3792 dbSNP
rs554207233 3794 dbSNP
rs147871863 3799 dbSNP
rs1359932178 3800 dbSNP
rs919216355 3812 dbSNP
rs878952137 3820 dbSNP
rs1198211967 3822 dbSNP
rs1472736038 3842 dbSNP
rs1253561333 3847 dbSNP
rs929207948 3850 dbSNP
rs546173924 3858 dbSNP
rs933407567 3861 dbSNP
rs1279948199 3863 dbSNP
rs1202769274 3879 dbSNP
rs1050350572 3881 dbSNP
rs889127634 3883 dbSNP
rs1229126668 3888 dbSNP
rs1352503785 3889 dbSNP
rs755396268 3896 dbSNP
rs890267554 3900 dbSNP
rs558902016 3903 dbSNP
rs527706716 3905 dbSNP
rs1298259004 3920 dbSNP
rs544490874 3923 dbSNP
rs569802387 3924 dbSNP
rs1175036661 3932 dbSNP
rs1457324810 3940 dbSNP
rs899851492 3943 dbSNP
rs141570395 3944 dbSNP
rs1302812913 3965 dbSNP
rs1175188521 3966 dbSNP
rs1053710713 3971 dbSNP
rs1469935622 3985 dbSNP
rs1238466067 3986 dbSNP
rs1312384793 3989 dbSNP
rs10413 4003 dbSNP
rs1010218122 4006 dbSNP
rs1022607627 4020 dbSNP
rs1209371447 4028 dbSNP
rs1025162695 4033 dbSNP
rs979696759 4037 dbSNP
rs925562263 4045 dbSNP
rs527918266 4047 dbSNP
rs935497114 4049 dbSNP
rs971277931 4059 dbSNP
rs1001964327 4060 dbSNP
rs1380425199 4062 dbSNP
rs541575302 4064 dbSNP
rs868135630 4087 dbSNP
rs559784800 4090 dbSNP
rs1487817232 4092 dbSNP
rs1346514029 4093 dbSNP
rs1156471102 4110 dbSNP
rs1033392068 4126 dbSNP
rs1414111459 4128 dbSNP
rs1165812714 4131 dbSNP
rs748651116 4135 dbSNP
rs1443177386 4136 dbSNP
rs1242998570 4137 dbSNP
rs963123413 4139 dbSNP
rs1240480187 4141 dbSNP
rs1215291547 4144 dbSNP
rs1322511290 4148 dbSNP
rs1192970440 4151 dbSNP
rs1425989134 4153 dbSNP
rs1472365335 4154 dbSNP
rs1157221568 4176 dbSNP
rs1363418502 4180 dbSNP
rs973100642 4180 dbSNP
rs918914275 4182 dbSNP
rs527290877 4192 dbSNP
rs933376660 4202 dbSNP
rs1350054741 4229 dbSNP
rs1304584613 4231 dbSNP
rs1050487969 4235 dbSNP
rs1385062511 4237 dbSNP
rs3821646 4249 dbSNP
rs548847679 4251 dbSNP
rs1418030614 4254 dbSNP
rs987771693 4259 dbSNP
rs1037616311 4266 dbSNP
rs1294722103 4271 dbSNP
rs1248669494 4272 dbSNP
rs897697729 4274 dbSNP
rs772938957 4275 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.72 1.7e-4 0.803 1.0e-5 20 Click to see details
GSE38226 Liver fibrosis -0.647 7.6e-4 -0.445 2.2e-2 21 Click to see details
GSE21032 Prostate cancer 0.327 1.3e-3 0.232 1.7e-2 83 Click to see details
GSE28260 Renal cortex and medulla -0.423 7.5e-2 -0.308 1.5e-1 13 Click to see details
GSE21849 B cell lymphoma 0.273 7.6e-2 0.243 1.0e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.233 1.0e-1 0.190 1.5e-1 32 Click to see details
GSE19536 Breast cancer 0.11 1.4e-1 0.143 7.8e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.211 1.6e-1 0.264 1.0e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.317 1.6e-1 -0.119 3.6e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.117 1.8e-1 0.125 1.6e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.185 1.9e-1 0.026 4.5e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.201 2.0e-1 0.206 1.9e-1 20 Click to see details
GSE28544 Breast cancer -0.138 2.6e-1 -0.167 2.2e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.132 2.7e-1 0.196 1.9e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.039 4.3e-1 0.090 3.4e-1 24 Click to see details
GSE17306 Multiple myeloma 0.019 4.5e-1 -0.013 4.6e-1 49 Click to see details
GSE17498 Multiple myeloma -0.021 4.5e-1 -0.006 4.9e-1 40 Click to see details
GSE19783 ER- ER- breast cancer -0.001 5.0e-1 0.046 3.4e-1 79 Click to see details
GSE19783 ER- ER- breast cancer -0.001 5.0e-1 0.046 3.4e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.9 0.05 0.800 0.1 4 Click to see details
PRAD 0.219 0.06 0.235 0.05 50 Click to see details
LUAD 0.426 0.08 0.203 0.26 12 Click to see details
BRCA -0.119 0.14 -0.144 0.1 84 Click to see details
HNSC 0.161 0.15 0.164 0.15 42 Click to see details
THCA 0.129 0.17 0.069 0.3 59 Click to see details
BLCA -0.222 0.19 -0.115 0.32 18 Click to see details
UCEC 0.214 0.19 0.272 0.13 19 Click to see details
CHOL 0.287 0.23 0.600 0.04 9 Click to see details
STAD -0.134 0.23 -0.206 0.13 32 Click to see details
KIRP -0.113 0.27 -0.053 0.39 32 Click to see details
PCPG -0.567 0.31 -0.500 0.33 3 Click to see details
COAD -0.21 0.31 -0.619 0.05 8 Click to see details
LUSC 0.061 0.36 0.003 0.49 38 Click to see details
CESC 0.409 0.37 0.500 0.33 3 Click to see details
KICH 0.072 0.37 0.115 0.29 25 Click to see details
KIRC -0.042 0.37 -0.071 0.28 68 Click to see details
LIHC 0.039 0.4 0.049 0.37 49 Click to see details
ESCA 0 0.5 0.027 0.47 11 Click to see details
ESCA 0 0.5 0.027 0.47 11 Click to see details
ESCA 0 0.5 0.027 0.47 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27