miRTarBase - #MIRT092209 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BHLHE40   
Synonyms BHLHB2, Clast5, DEC1, HLHB2, SHARP-2, SHARP2, STRA13, Stra14
Description basic helix-loop-helix family member e40
Transcript NM_003670   
Expression
Putative miRNA Targets on BHLHE40
3'UTR of BHLHE40
(miRNA target sites are highlighted)
>BHLHE40|NM_003670|3'UTR
   1 ACTCTCTAGGGGATCCTGCTGCTTTGCTTTCCTTCCTCGCTACTTCCTAAAAAGCAACAAAAAAGTTTTTGTGAATGCTG
  81 CAAGATTGTTGCATTGTGTATACTGAGATAATCTGAGGCATGGAGAGCAGATTCAGGGTGTGTGTGTGTGTGTGTGTGTG
 161 TGTATGTGCGTGTGCGTGCACATGTGTGCCTGCGTGTTGGTATAGGACTTTAAAGCTCCTTTTGGCATAGGGAAGTCACG
 241 AAGGATTGCTTGACATCAGGAGACTTGGGGGGGATTGTAGCAGACGTCTGGGCTTTTCCCCACCCAGAGAATAGCCCCCT
 321 TCGATACACATCAGCTGGATTTTCAAAAGCTTCAAAGTCTTGGTCTGTGAGTCACTCTTCAGTTTGGGAGCTGGGTCTGT
 401 GGCTTTGATCAGAAGGTACTTTCAAAAGAGGGCTTTCCAGGGCTCAGCTCCCAACCAGCTGTTAGGACCCCACCCTTTTG
 481 CCTTTATTGTCGACGTGACTCACCAGACGTCGGGGAGAGAGAGCAGTCAGACCGAGCTTTCTGCTAACATGGGGAGGTAG
 561 CAGGCACTGGCATAGCACGGTAGTGGTTTGGGGAGGTTTCCGCAGGTCTGCTCCCCACCCCTGCCTCGGAAGAATAAAGA
 641 GAATGTAGTTCCCTACTCAGGCTTTCGTAGTGATTAGCTTACTAAGGAACTGAAAATGGGCCCCTTGTACAAGCTGAGCT
 721 GCCCCGGAGGGAGGGAGGAGTTCCCTGGGCTTCTGGCACCTGTTTCTAGGCCTAACCATTAGTACTTACTGTGCAGGGAA
 801 CCAAACCAAGGTCTGAGAAATGCGGACACCCCGAGCGAGCACCCCAAAGTGCACAAAGCTGAGTAAAAAGCTGCCCCCTT
 881 CAAACAGAACTAGACTCAGTTTTCAATTCCATCCTAAAACTCCTTTTAACCAAGCTTAGCTTCTCAAAGGCCTAACCAAG
 961 CCTTGGCACCGCCAGATCCTTTCTGTAGGCTAATTCCTCTTGCCCAACGGCATATGGAGTGTCCTTATTGCTAAAAAGGA
1041 TTCCGTCTCCTTCAAAGAAGTTTTATTTTTGGTCCAGAGTACTTGTTTTCCCGATGTGTCCAGCCAGCTCCGCAGCAGCT
1121 TTTCAAAATGCACTATGCCTGATTGCTGATCGTGTTTTAACTTTTTCTTTTCCTGTTTTTATTTTGGTATTAAGTCGTTG
1201 CCTTTATTTGTAAAGCTGTTATAAATATATATTATATAAATATATTAAAAAGGAAAATGTTTCAGATGTTTATTTGTATA
1281 ATTACTTGATTCACACAGTGAGAAAAAATGAATGTATTCCTGTTTTTGAAGAGAAGAATAATTTTTTTTTTCTCTAGGGA
1361 GAGGTACAGTGTTTATATTTTGGAGCCTTCCTGAAGGTGTAAAATTGTAAATATTTTTATCTATGAGTAAATGTTAAGTA
1441 GTTGTTTTAAAATACTTAATAAAATAATTCTTTTCCTGTGGAAGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUAC--ACGACGau 5'
             ||::: ||:||  ||||||  
Target 5' aaaAAGTTTTTGTGAATGCTGCaa 3'
60 - 83 141.00 -10.90
2
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' tctctaggggatccTGCTGCTt 3'
3 - 24 140.00 -10.90
3
miRNA  3' gugUUUG-GUAAUAC------ACGACGAu 5'
             |||: || ||||      ||||| | 
Target 5' tcaAAATGCACTATGCCTGATTGCTGATc 3'
1123 - 1151 125.00 -10.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30166561 23 COSMIC
COSN30110360 33 COSMIC
COSN14071342 39 COSMIC
COSN30139771 40 COSMIC
COSN31498984 56 COSMIC
COSN15612707 73 COSMIC
COSN23337635 101 COSMIC
COSN30177621 119 COSMIC
COSN8489357 159 COSMIC
COSN20098074 161 COSMIC
COSN20098075 162 COSMIC
COSN30654733 162 COSMIC
COSN20098071 164 COSMIC
COSN27354946 164 COSMIC
COSN30638729 164 COSMIC
COSN30732530 165 COSMIC
COSN31534310 167 COSMIC
COSN30514186 168 COSMIC
COSN23987526 170 COSMIC
COSN31589047 189 COSMIC
COSN28655905 274 COSMIC
COSN28658300 278 COSMIC
COSN1278162 305 COSMIC
COSN28201596 316 COSMIC
COSN26555618 324 COSMIC
COSN31523906 396 COSMIC
COSN24718869 456 COSMIC
COSN30540345 466 COSMIC
COSN7700026 718 COSMIC
COSN19281932 782 COSMIC
COSN27910690 917 COSMIC
COSN1951891 1054 COSMIC
COSN24299615 1109 COSMIC
COSN31486012 1165 COSMIC
COSN22873302 1166 COSMIC
COSN31529744 1168 COSMIC
COSN31548196 1184 COSMIC
COSN31537753 1198 COSMIC
COSN31570169 1206 COSMIC
COSN31516165 1344 COSMIC
COSN31569396 1352 COSMIC
COSN21844149 1434 COSMIC
COSN31584810 1469 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774972751 4 dbSNP
rs1442058949 7 dbSNP
rs760062858 10 dbSNP
rs753865800 12 dbSNP
rs763558739 16 dbSNP
rs1214066138 17 dbSNP
rs1206443410 23 dbSNP
rs753353598 27 dbSNP
rs761399314 29 dbSNP
rs1200522065 33 dbSNP
rs764995772 37 dbSNP
rs371642469 39 dbSNP
rs751465731 40 dbSNP
rs781352483 43 dbSNP
rs1474186124 45 dbSNP
rs748249405 51 dbSNP
rs1298713024 66 dbSNP
rs1398667902 66 dbSNP
rs759533852 71 dbSNP
rs1428956238 75 dbSNP
rs1368488795 79 dbSNP
rs1165309398 99 dbSNP
rs567520251 105 dbSNP
rs1444984236 113 dbSNP
rs557774839 119 dbSNP
rs1367580183 121 dbSNP
rs929006203 127 dbSNP
rs1018179368 129 dbSNP
rs1299254041 136 dbSNP
rs1202166718 138 dbSNP
rs1208301195 138 dbSNP
rs1250315863 138 dbSNP
rs1260883534 138 dbSNP
rs1267033197 138 dbSNP
rs139879256 138 dbSNP
rs1452581707 138 dbSNP
rs56076357 138 dbSNP
rs1353817631 140 dbSNP
rs1227389396 142 dbSNP
rs1268968964 144 dbSNP
rs1403842237 145 dbSNP
rs1227916286 153 dbSNP
rs1285148538 156 dbSNP
rs113672785 159 dbSNP
rs1208300997 159 dbSNP
rs201705299 159 dbSNP
rs79071212 159 dbSNP
rs1219870257 161 dbSNP
rs1463604009 161 dbSNP
rs888597035 161 dbSNP
rs1491355357 163 dbSNP
rs772994431 163 dbSNP
rs923592233 164 dbSNP
rs13093955 165 dbSNP
rs1034589470 166 dbSNP
rs1247306848 166 dbSNP
rs1432357504 168 dbSNP
rs759051732 168 dbSNP
rs878978207 170 dbSNP
rs13070453 171 dbSNP
rs1391098226 171 dbSNP
rs1190576843 172 dbSNP
rs1245193508 173 dbSNP
rs1441898391 176 dbSNP
rs1210960333 177 dbSNP
rs1276447953 182 dbSNP
rs1014203732 183 dbSNP
rs1342618997 185 dbSNP
rs1296526061 186 dbSNP
rs1225884989 194 dbSNP
rs1384629378 195 dbSNP
rs1472550842 201 dbSNP
rs1284393752 202 dbSNP
rs1024228445 207 dbSNP
rs967437779 209 dbSNP
rs992307268 221 dbSNP
rs1332775276 224 dbSNP
rs576163457 229 dbSNP
rs917689276 230 dbSNP
rs879382055 231 dbSNP
rs1448008507 238 dbSNP
rs1182621135 240 dbSNP
rs1045214108 241 dbSNP
rs1158958045 242 dbSNP
rs1235744461 253 dbSNP
rs577820140 266 dbSNP
rs1390003140 267 dbSNP
rs1483374877 268 dbSNP
rs34883305 269 dbSNP
rs560332970 270 dbSNP
rs34870629 274 dbSNP
rs542366772 275 dbSNP
rs779438826 276 dbSNP
rs74439275 278 dbSNP
rs910465261 279 dbSNP
rs1280839224 280 dbSNP
rs944387001 281 dbSNP
rs1284455663 285 dbSNP
rs997555168 287 dbSNP
rs1052251900 289 dbSNP
rs975751789 291 dbSNP
rs1380939828 298 dbSNP
rs918886519 301 dbSNP
rs929058563 304 dbSNP
rs188926124 306 dbSNP
rs889223410 307 dbSNP
rs1404931109 308 dbSNP
rs1267330135 309 dbSNP
rs1161546976 310 dbSNP
rs530939990 313 dbSNP
rs1329768343 315 dbSNP
rs941537141 323 dbSNP
rs1179872937 328 dbSNP
rs544571242 335 dbSNP
rs755020662 339 dbSNP
rs903720973 341 dbSNP
rs1319618345 345 dbSNP
rs1285873711 346 dbSNP
rs192013328 350 dbSNP
rs1288308921 355 dbSNP
rs1014419984 359 dbSNP
rs1370205230 364 dbSNP
rs1294549184 374 dbSNP
rs1436201933 375 dbSNP
rs1045729677 382 dbSNP
rs903164930 386 dbSNP
rs999376259 392 dbSNP
rs1161619976 400 dbSNP
rs1033080893 404 dbSNP
rs1457862296 412 dbSNP
rs1411245070 423 dbSNP
rs1156874113 424 dbSNP
rs1434895312 426 dbSNP
rs1425775515 431 dbSNP
rs1190444341 432 dbSNP
rs533722850 440 dbSNP
rs957469635 446 dbSNP
rs1188386797 449 dbSNP
rs1249528963 454 dbSNP
rs1239411842 456 dbSNP
rs1468852123 458 dbSNP
rs1181907166 468 dbSNP
rs757789788 469 dbSNP
rs956546996 488 dbSNP
rs1007383717 490 dbSNP
rs1265636997 492 dbSNP
rs536079814 495 dbSNP
rs1025106768 499 dbSNP
rs969174943 504 dbSNP
rs1473825696 508 dbSNP
rs1017413008 509 dbSNP
rs1365872090 510 dbSNP
rs965951818 512 dbSNP
rs975974053 513 dbSNP
rs1388164964 515 dbSNP
rs145719941 517 dbSNP
rs1413376333 518 dbSNP
rs1290553982 522 dbSNP
rs182792652 524 dbSNP
rs1175208037 525 dbSNP
rs972275411 526 dbSNP
rs1391716161 531 dbSNP
rs984987756 532 dbSNP
rs747993570 534 dbSNP
rs1448564296 535 dbSNP
rs933293728 545 dbSNP
rs937724280 560 dbSNP
rs1055970898 562 dbSNP
rs1051772028 569 dbSNP
rs529418777 572 dbSNP
rs950318403 574 dbSNP
rs1209948267 576 dbSNP
rs548683483 579 dbSNP
rs568569869 580 dbSNP
rs998863472 581 dbSNP
rs903677091 582 dbSNP
rs1000716525 583 dbSNP
rs1201099095 590 dbSNP
rs371508699 599 dbSNP
rs1372319665 602 dbSNP
rs1031313888 603 dbSNP
rs537448379 605 dbSNP
rs771256245 608 dbSNP
rs1387992649 611 dbSNP
rs1189135465 612 dbSNP
rs1008015301 614 dbSNP
rs1451083850 616 dbSNP
rs879930303 618 dbSNP
rs1013637040 620 dbSNP
rs1024636601 628 dbSNP
rs1473793871 629 dbSNP
rs11130215 632 dbSNP
rs965840279 636 dbSNP
rs781518884 645 dbSNP
rs997462960 646 dbSNP
rs1377536034 655 dbSNP
rs1026216577 656 dbSNP
rs950470222 668 dbSNP
rs984482554 669 dbSNP
rs1172648560 679 dbSNP
rs77157534 685 dbSNP
rs534124829 686 dbSNP
rs746106852 691 dbSNP
rs916110657 698 dbSNP
rs1307047073 703 dbSNP
rs950203335 705 dbSNP
rs963484725 706 dbSNP
rs1164648342 713 dbSNP
rs1458146860 714 dbSNP
rs972222737 715 dbSNP
rs1367524965 716 dbSNP
rs1370833652 722 dbSNP
rs1254617729 726 dbSNP
rs1473271824 726 dbSNP
rs1183480110 732 dbSNP
rs1411408011 734 dbSNP
rs1482934965 736 dbSNP
rs919462840 741 dbSNP
rs1046002963 744 dbSNP
rs933594012 746 dbSNP
rs1357409037 747 dbSNP
rs988161362 747 dbSNP
rs553756846 750 dbSNP
rs1331262742 752 dbSNP
rs573898781 764 dbSNP
rs1321412617 765 dbSNP
rs1330447999 769 dbSNP
rs1227643936 774 dbSNP
rs1333892410 775 dbSNP
rs187438302 778 dbSNP
rs1389627965 783 dbSNP
rs191520834 784 dbSNP
rs943381841 786 dbSNP
rs183998579 788 dbSNP
rs1160567131 790 dbSNP
rs1276633205 792 dbSNP
rs1472585923 797 dbSNP
rs1362567106 798 dbSNP
rs1201521867 802 dbSNP
rs1254203117 812 dbSNP
rs765659944 814 dbSNP
rs1227897062 817 dbSNP
rs540443694 823 dbSNP
rs189447099 824 dbSNP
rs747512348 827 dbSNP
rs893101014 828 dbSNP
rs562018800 829 dbSNP
rs192486237 830 dbSNP
rs1276517151 832 dbSNP
rs1233735603 833 dbSNP
rs1330257137 834 dbSNP
rs1300809948 837 dbSNP
rs1436751121 841 dbSNP
rs1388904966 844 dbSNP
rs1319383171 848 dbSNP
rs1039123823 850 dbSNP
rs1201659746 851 dbSNP
rs1174783988 871 dbSNP
rs1478581074 875 dbSNP
rs901699739 877 dbSNP
rs1254277236 878 dbSNP
rs3750275 885 dbSNP
rs1192003118 895 dbSNP
rs1026118596 898 dbSNP
rs1167473808 898 dbSNP
rs1248844247 920 dbSNP
rs886360812 920 dbSNP
rs1208237064 923 dbSNP
rs1445300788 924 dbSNP
rs1280690386 926 dbSNP
rs1013501877 932 dbSNP
rs1463265378 938 dbSNP
rs1046767830 951 dbSNP
rs185625137 952 dbSNP
rs1230332855 957 dbSNP
rs1001837553 963 dbSNP
rs1296390296 966 dbSNP
rs1387229764 968 dbSNP
rs564470003 971 dbSNP
rs1015942100 972 dbSNP
rs1375362099 979 dbSNP
rs1172206035 980 dbSNP
rs963099481 988 dbSNP
rs112767189 991 dbSNP
rs1186108913 992 dbSNP
rs1474469899 998 dbSNP
rs990555058 1004 dbSNP
rs1024678517 1008 dbSNP
rs1188315227 1010 dbSNP
rs1026473234 1029 dbSNP
rs1298494388 1034 dbSNP
rs955082541 1039 dbSNP
rs1342548702 1040 dbSNP
rs770277837 1044 dbSNP
rs1273511835 1045 dbSNP
rs987720654 1046 dbSNP
rs1357868572 1055 dbSNP
rs1284340884 1056 dbSNP
rs1446609321 1061 dbSNP
rs1801739 1066 dbSNP
rs1355434221 1075 dbSNP
rs529453613 1080 dbSNP
rs910822498 1085 dbSNP
rs971570225 1093 dbSNP
rs780468996 1095 dbSNP
rs1412095789 1100 dbSNP
rs752794802 1112 dbSNP
rs1265166436 1119 dbSNP
rs981581663 1129 dbSNP
rs776961689 1132 dbSNP
rs1357519104 1133 dbSNP
rs1212108876 1145 dbSNP
rs1474909710 1149 dbSNP
rs1255348082 1152 dbSNP
rs1184205893 1158 dbSNP
rs934945239 1197 dbSNP
rs549117808 1198 dbSNP
rs914607389 1216 dbSNP
rs1202169480 1220 dbSNP
rs978761720 1222 dbSNP
rs1227262916 1226 dbSNP
rs925994907 1226 dbSNP
rs1331974357 1236 dbSNP
rs1291983952 1237 dbSNP
rs569102444 1238 dbSNP
rs34622661 1242 dbSNP
rs1298029617 1243 dbSNP
rs901937211 1244 dbSNP
rs1351887655 1245 dbSNP
rs772858014 1248 dbSNP
rs114360023 1262 dbSNP
rs1047614029 1267 dbSNP
rs756300783 1270 dbSNP
rs966378289 1281 dbSNP
rs1415689848 1282 dbSNP
rs148919791 1292 dbSNP
rs1058377 1294 dbSNP
rs1184994271 1297 dbSNP
rs1407162132 1301 dbSNP
rs1390709746 1303 dbSNP
rs533523086 1306 dbSNP
rs905137309 1309 dbSNP
rs1246953598 1319 dbSNP
rs1367635451 1324 dbSNP
rs1058380 1332 dbSNP
rs1458193427 1333 dbSNP
rs1001785054 1337 dbSNP
rs1466760541 1339 dbSNP
rs368808493 1340 dbSNP
rs1026504512 1342 dbSNP
rs1306890914 1342 dbSNP
rs898868614 1342 dbSNP
rs954873663 1342 dbSNP
rs993256652 1342 dbSNP
rs1359137610 1343 dbSNP
rs1009500416 1347 dbSNP
rs1322725256 1348 dbSNP
rs1457809283 1352 dbSNP
rs1456701129 1353 dbSNP
rs1321224226 1355 dbSNP
rs567521339 1358 dbSNP
rs1156786808 1360 dbSNP
rs1011861608 1370 dbSNP
rs751178895 1384 dbSNP
rs372924886 1387 dbSNP
rs970452250 1391 dbSNP
rs977785957 1400 dbSNP
rs1192760994 1401 dbSNP
rs1452257123 1408 dbSNP
rs1249468782 1409 dbSNP
rs1312313257 1418 dbSNP
rs1485233161 1420 dbSNP
rs1260686700 1432 dbSNP
rs1214192182 1443 dbSNP
rs964968179 1447 dbSNP
rs1058395 1454 dbSNP
rs1031849851 1456 dbSNP
rs979043381 1460 dbSNP
rs114892045 1468 dbSNP
rs1300030183 1471 dbSNP
rs1329005678 1475 dbSNP
rs562387936 1491 dbSNP
rs990440406 1499 dbSNP
rs1435943784 1504 dbSNP
rs754932397 1504 dbSNP
rs1361274958 1506 dbSNP
rs11914971 1510 dbSNP
rs943568418 1511 dbSNP
rs988898640 1514 dbSNP
rs1432604990 1518 dbSNP
rs11925620 1522 dbSNP
rs1188760354 1523 dbSNP
rs1198270585 1525 dbSNP
rs1427414968 1534 dbSNP
rs923243961 1544 dbSNP
rs949223935 1550 dbSNP
rs981912377 1551 dbSNP
rs1409491998 1552 dbSNP
rs1258795378 1557 dbSNP
rs1210683857 1558 dbSNP
rs933404767 1561 dbSNP
rs1277038665 1578 dbSNP
rs1228348115 1580 dbSNP
rs1048266550 1586 dbSNP
rs937920777 1592 dbSNP
rs907727044 1596 dbSNP
rs1397826198 1599 dbSNP
rs1356064577 1608 dbSNP
rs1312149237 1609 dbSNP
rs755899114 1610 dbSNP
rs1037618833 1617 dbSNP
rs1472189309 1624 dbSNP
rs1168853183 1626 dbSNP
rs1037660830 1627 dbSNP
rs898814892 1630 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.674 4.0e-4 -0.718 1.2e-4 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.602 1.2e-3 0.489 8.9e-3 23 Click to see details
GSE19536 Breast cancer 0.268 3.5e-3 0.298 1.3e-3 100 Click to see details
GSE19783 ER- ER- breast cancer 0.284 5.6e-3 0.349 8.1e-4 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.396 2.5e-2 0.382 3.0e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.2 5.7e-2 0.228 3.5e-2 64 Click to see details
GSE28260 Renal cortex and medulla -0.441 6.6e-2 -0.374 1.0e-1 13 Click to see details
GSE17306 Multiple myeloma 0.216 6.8e-2 0.289 2.2e-2 49 Click to see details
GSE32688 Pancreatic cancer 0.249 8.5e-2 0.208 1.3e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.275 9.2e-2 0.222 1.4e-1 25 Click to see details
GSE21032 Prostate cancer 0.139 1.1e-1 0.060 3.0e-1 83 Click to see details
GSE21849 B cell lymphoma -0.208 1.4e-1 0.173 1.8e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.169 2.4e-1 0.173 2.3e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.147 2.7e-1 0.159 2.5e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.162 2.7e-1 -0.174 2.6e-1 16 Click to see details
GSE28544 Breast cancer -0.108 3.1e-1 -0.063 3.8e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.095 3.3e-1 -0.053 4.0e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.109 3.7e-1 0.077 4.1e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.035 3.7e-1 -0.073 2.5e-1 90 Click to see details
GSE14794 Lymphoblastoid cells -0.035 3.7e-1 -0.073 2.5e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.34 0.01 0.342 0.01 42 Click to see details
BLCA 0.48 0.02 0.467 0.03 18 Click to see details
BRCA -0.199 0.03 -0.198 0.04 84 Click to see details
UCEC -0.414 0.04 -0.135 0.29 19 Click to see details
LUAD 0.486 0.05 0.608 0.02 12 Click to see details
PAAD -0.888 0.06 -0.800 0.1 4 Click to see details
ESCA 0.489 0.06 0.491 0.06 11 Click to see details
CHOL -0.504 0.08 -0.500 0.09 9 Click to see details
KICH 0.266 0.1 0.135 0.26 25 Click to see details
KIRP -0.222 0.11 -0.256 0.08 32 Click to see details
LUSC 0.193 0.12 0.129 0.22 38 Click to see details
STAD -0.139 0.22 -0.273 0.07 32 Click to see details
CESC -0.719 0.24 -0.500 0.33 3 Click to see details
COAD -0.272 0.26 -0.238 0.29 8 Click to see details
KIRC 0.07 0.29 0.137 0.13 68 Click to see details
LIHC 0.069 0.32 0.006 0.48 49 Click to see details
PRAD 0.057 0.35 -0.022 0.44 50 Click to see details
THCA 0.049 0.36 0.093 0.24 59 Click to see details
PCPG -0.291 0.41 -0.500 0.33 3 Click to see details
PCPG -0.291 0.41 -0.500 0.33 3 Click to see details
PCPG -0.291 0.41 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*