miRTarBase - #MIRT102434 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CALU   
Synonyms -
Description calumenin
Transcript NM_001130674   
Other Transcripts NM_001219   
Expression
Putative miRNA Targets on CALU
3'UTR of CALU
(miRNA target sites are highlighted)
>CALU|NM_001130674|3'UTR
   1 GCTACGGAGGAACCCTCATTTCCTCAAAAGTAATTTATTTTTACAGCTTCTGGTTTCACATGAAATTGTTTGCGCTACTG
  81 AGACTGTTACTACAAACTTTTTAAGACATGAAAAGGCGTAATGAAAACCATCCCGTCCCCATTCCTCCTCCTCTCTGAGG
 161 GACTGGAGGGAAGCCGTGCTTCTGAGGAACAACTCTAATTAGTACACTTGTGTTTGTAGATTTACACTTTGTATTATGTA
 241 TTAACATGGCGTGTTTATTTTTGTATTTTTCTCTGGTTGGGAGTATGATATGAAGGATCAAGATCCTCAACTCACACATG
 321 TAGACAAACATTAGCTCTTTACTCTTTCTCAACCCCTTTTATGATTTTAATAATTCTCACTTAACTAATTTTGTAAGCCT
 401 GAGATCAATAAGAAATGTTCAGGAGAGAGGAAAGAAAAAAAATATATGCTCCACAATTTATATTTAGAGAGAGAACACTT
 481 AGTCTTGCCTGTCAAAAAGTCCAACATTTCATAGGTAGTAGGGGCCACATATTACATTCAGTTGCTATAGGTCCAGCAAC
 561 TGAACCTGCCATTACCTGGGCAAGGAAAGATCCCTTTGCTCTAGGAAAGCTTGGCCCAAATTGATTTTCTTCTTTTTCCC
 641 CCTGTAGGACTGACTGTTGGCTAATTTTGTCAAGCACAGCTGTGGTGGGAAGAGTTAGGGCCAGTGTCTTGAAAATCAAT
 721 CAAGTAGTGAATGTGATCTCTTTGCAGAGCTATAGATAGAAACAGCTGGAAAACTAAAGGAAAAATACAAGTGTTTTCGG
 801 GGCATACATTTTTTTTCTGGGTGTGCATCTGTTGAAATGCTCAAGACTTAATTATTTGCCTTTTGAAATCACTGTAAATG
 881 CCCCCATCCGGTTCCTCTTCTTCCCAGGTGTGCCAAGGAATTAATCTTGGTTTCACTACAATTAAAATTCACTCCTTTCC
 961 AATCATGTCATTGAAAGTGCCTTTAACGAAAGAAATGGTCACTGAATGGGAATTCTCTTAAGAAACCCTGAGATTAAAAA
1041 AAGACTATTTGGATAACTTATAGGAAAGCCTAGAACCTCCCAGTAGAGTGGGGATTTTTTTCTTCTTCCCTTTCTCTTTT
1121 GGACAATAGTTAAATTAGCAGTATTAGTTATGAGTTTGGTTGCAGTGTTCTTATCTTGTGGGCTGATTTCCAAAAACCAC
1201 ATGCTGCTGAATTTACCAGGGATCCTCATACCTCACAATGCAAACCACTTACTACCAGGCCTTTTTCTGTGTCCACTGGA
1281 GAGCTTGAGCTCACACTCAAAGATCAGAGGACCTACAGAGAGGGCTCTTTGGTTTGAGGACCATGGCTTACCTTTCCTGC
1361 CTTTGACCCATCACACCCCATTTCCTCCTCTTTCCCTCTCCCCGCTGCCAAAAAAAAAAAAAAAGGAAACGTTTATCATG
1441 AATCAACAGGGTTTCAGTCCTTATCAAAGAGAGATGTGGAAAGAGCTAAAGAAACCACCCTTTGTTCCCAACTCCACTTT
1521 ACCCATATTTTATGCAACACAAACACTGTCCTTTTGGGTCCCTTTCTTACAGATGGACCTCTTGAGAAGAATTATCGTAT
1601 TCCACGTTTTTAGCCCTCAGGTTACCAAGATAAATATATGTATATATAACCTTTATTATTGCTATATCTTTGTGGATAAT
1681 ACATTCAGGTGGTGCTGGGTGATTTATTATAATCTGAACCTAGGTATATCCTTTGGTCTTCCACAGTCATGTTGAGGTGG
1761 GCTCCCTGGTATGGTAAAAAGCCAGGTATAATGTAACTTCACCCCAGCCTTTGTACTAAGCTCTTGATAGTGGATATACT
1841 CTTTTAAGTTTAGCCCCAATATAGGGTAATGGAAATTTCCTGCCCTCTGGGTTCCCCATTTTTACTATTAAGAAGACCAG
1921 TGATAATTTAATAATGCCACCAACTCTGGCTTAGTTAAGTGAGAGTGTGAACTGTGTGGCAAGAGAGCCTCACACCTCAC
2001 TAGGTGCAGAGAGCCCAGGCCTTATGTTAAAATCATGCACTTGAAAAGCAAACCTTAATCTGCAAAGACAGCAGCAAGCA
2081 TTATACGGTCATCTTGAATGATCCCTTTGAAATTTTTTTTTTGTTTGTTTGTTTAAATCAAGCCTGAGGCTGGTGAACAG
2161 TAGCTACACACCCATATTGTGTGTTCTGTGAATGCTAGCTCTCTTGAATTTGGATATTGGTTATTTTTTATAGAGTGTAA
2241 ACCAAGTTTTATATTCTGCAATGCGAACAGGTACCTATCTGTTTCTAAATAAAACTGTTTACATTCATTATGGGGTATGT
2321 ATGACCTTCATTTTCCAAGAAATAGAACTCTAGCTTAGAATTATGGATGCTCTAAAATGTCAGAATGGGAACTCTCCTCG
2401 AAGTTCTCCCAAACTCAGAGACAGCACTGCCTTCTCCTAAATGATTATTCTTTTCTCCCTGTTTTCTGGTATTTTCTAGC
2481 ATCCTTCTCACCACAGCCATAACCCTTTTTTACTTCCATTAGGCCGTATAACTGGAGAGACCTGCTGCTCGTTATATAAT
2561 TATCTGATACCAAACACAAGCGATTCTGAATGTACACACACGTTTATCTATAGAGCATAAGGTAAAACAATTTTGTTTAA
2641 CATTTTGGTATTGTTTACAAATGTTATTAAAACATGCAAATTCATTTTGAGAACCTCGAGAGAATTAAACTATTAACTTT
2721 AGTAAACACACAGTTTAAGACAAATATAAAGGTTTAGCCAAATGCAACGGGGAGGAAGCACCTGGAATAATTTGTGCTTG
2801 CTCAGGGGCTTGTGGACATGGCTGTTCCTGCCAAAGCTGTAGCAGTTATCCAAAAGTTCTTTCAAACTCATATTTGGGGC
2881 CACTGAGTTTTTTTTGTTTTTTTTTTTGTTTTGTTTTGTTTTTTCTTTATGTCTCTCCCATTTCTAAAGTGTTTTCTTAA
2961 GTTTGTTCTAATTCAGCATATATCATCTCAGAATGGATCCCCAGCAGGAAAAAAAAAAAAAGTTACTAAAAAGGAAAGTA
3041 TCCATACACTGAAAACTTAAAGCATATTCCTTTTTGGTTGCCTTGTATGTAGAAATCAGTTCTCCAAGTGCTGTGAATGG
3121 TGCCACTTAGGAGTAGAAACTGATGATTGTTGAAATGGCCTTTGGGTGGTCTGAAATAGACCAGTGGAAACAGTAGCTTT
3201 GTAGGCAAGAAGGCAATAGTAAGAAAATGAAAAATTGACTCCCCAAACTGCCATCACTCCTTTTACCATCTTTTTTGTGT
3281 TTTTAGTAGTTTGGTTTCTGACGGAGACAATAGAAACTTACTTAAAAGTAAAATTTAATTCTAGCTGTTGCAAACAGGCC
3361 AATATTGGGTCCTCAGTTGGGGCCAACTTGGGTAGACGAGACAGTAGAAACTTCTGTTTTCTGGGAGCTGCATGTGTCGG
3441 ATTCATCTGTCATGGCCTTCCCACACACCATCTTCATGATGCAAGCTTGGAACTGGAGAGAAAGGTACAATTGGAGATAA
3521 CCTTGGCAGATGAGGAAGTATGGGAAAAAAGACCTTATTCTCTGTATCACCAAAGCCTTGCACAATGCTTTGTACCCAGA
3601 ATGCCCTTAGGTGGTTTTGAATCTATCTTCCCCATCCTGAAAACTATCTAGATTCCAGTCTAGAACTACTCCTGGGTCTA
3681 CGGTAATCCTAAACTGGTCAAGTCTGAGACCTCACTGTTGGTAAATTCACAAACCATCCTGCTTCATAAAAGCACTGTCA
3761 GCAGAGGCCCCTCCATTACTAGCAGGTGCTCCCAGCTGGAAAGGACTGCCAATTCTCTTCTATCCAGGGAGGTTTCAAAT
3841 TAGTTTTGAGTCTACCTCTGGGATTGAGGAAACAATACCATCTGAAAGTAGGGTTTTTGCCACTTAGGGTTTGGTGTTTA
3921 TTAGCTCGGATTTCAGATGGGATAGGAAATCCCCCAGTACCTTCAGATGATAAGATATTTTAGAGATTTTTGCATGTGGT
4001 ATGATTTCTGTGCTTCACACATGCTCGTGCAGGCTAAAAGTTGGAAGGGAAATGATTAAGAAATTATTAAATGCAAGGAC
4081 TGAAAATTGAGAGGAATCTGAGTTTTTATTTTTATTTTTTTAATTTTATTTAAGTTCCAGGATACATGTGCAGGATGTGC
4161 AGGTTTGTTACATAGGTAAACGTGTGCCATGGTGGTTTGCTGCACGAGTTTTTCAATAAAATGCTTTCATTCATCCTGTT
4241 CTTTGGAGCAACTTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||||  |  ||||||| 
Target 5' caaAAACCA-CA--TGCTGCTg 3'
1191 - 1209 154.00 -14.60
2
miRNA  3' guGUUUGGUA-AU--AC--------ACGACGAu 5'
            :|::||:| ||  ||        ||||||| 
Target 5' atTAGGCCGTATAACTGGAGAGACCTGCTGCTc 3'
2518 - 2550 144.00 -14.70
3
miRNA  3' guguuUGGUAAUAC---ACGACGau 5'
               :|||| :||   ||||||  
Target 5' cgtgtGCCATGGTGGTTTGCTGCac 3'
4181 - 4205 137.00 -14.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1167587 3398 ClinVar
1116696 3404 ClinVar
852775 3405 ClinVar
1036080 3408 ClinVar
1130650 3416 ClinVar
1077815 3434 ClinVar
836919 3436 ClinVar
1160419 3440 ClinVar
858901 3480 ClinVar
1121794 3501 ClinVar
1130035 3503 ClinVar
COSN2200971 4 COSMIC
COSN168196 5 COSMIC
COSN32059420 7 COSMIC
COSN30463003 10 COSMIC
COSN30462928 11 COSMIC
COSN30506433 19 COSMIC
COSN20087166 30 COSMIC
COSN30167281 51 COSMIC
COSN31581268 119 COSMIC
COSN29856453 777 COSMIC
COSN28720993 805 COSMIC
COSN31596623 834 COSMIC
COSN31607731 891 COSMIC
COSN28763192 988 COSMIC
COSN26465379 1005 COSMIC
COSN8515396 1017 COSMIC
COSN4921125 1097 COSMIC
COSN20104764 1425 COSMIC
COSN15200878 1466 COSMIC
COSN17182179 1522 COSMIC
COSN28758838 1536 COSMIC
COSN21516741 1567 COSMIC
COSN23347054 1596 COSMIC
COSN21516083 1619 COSMIC
COSN31565028 1649 COSMIC
COSN26602690 1834 COSMIC
COSN5647634 1926 COSMIC
COSN29461256 2124 COSMIC
COSN31516215 2126 COSMIC
COSN1342353 2254 COSMIC
COSM744636 3380 COSMIC
COSM3877950 3398 COSMIC
COSM9885412 3405 COSMIC
COSM6245040 3417 COSMIC
COSM9087788 3431 COSMIC
COSM1447908 3439 COSMIC
COSM7840896 3441 COSMIC
COSM1218474 3460 COSMIC
COSM163089 3473 COSMIC
COSM3831830 3473 COSMIC
COSN18731771 3648 COSMIC
COSN7959550 3929 COSMIC
COSN19467924 4058 COSMIC
COSN20720845 4168 COSMIC
rs1043595 792 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs11545531 1 dbSNP
rs1043550 5 dbSNP
rs542402496 6 dbSNP
rs757119279 7 dbSNP
rs748650579 12 dbSNP
rs746162690 15 dbSNP
rs756419950 17 dbSNP
rs780217565 19 dbSNP
rs1171207756 20 dbSNP
rs749411084 38 dbSNP
rs772603098 38 dbSNP
rs1401000395 40 dbSNP
rs1297170389 43 dbSNP
rs1008631429 59 dbSNP
rs1313802011 61 dbSNP
rs760700810 63 dbSNP
rs1428358889 71 dbSNP
rs1043168590 74 dbSNP
rs750840024 78 dbSNP
rs924710135 84 dbSNP
rs1390175793 85 dbSNP
rs1435922194 87 dbSNP
rs1452922446 89 dbSNP
rs183512762 91 dbSNP
rs934734528 92 dbSNP
rs575644561 96 dbSNP
rs1421819299 97 dbSNP
rs1432900055 98 dbSNP
rs901137038 98 dbSNP
rs1183189091 101 dbSNP
rs756414740 109 dbSNP
rs1364272503 113 dbSNP
rs996806876 114 dbSNP
rs545884540 118 dbSNP
rs888316205 119 dbSNP
rs1266536476 121 dbSNP
rs920810519 122 dbSNP
rs1005780123 123 dbSNP
rs1015397444 124 dbSNP
rs1357704799 133 dbSNP
rs961426022 135 dbSNP
rs908029347 136 dbSNP
rs1339847949 138 dbSNP
rs1366780438 145 dbSNP
rs1292735439 148 dbSNP
rs1224619762 154 dbSNP
rs1381592142 155 dbSNP
rs939461462 160 dbSNP
rs1290573670 161 dbSNP
rs1422555932 163 dbSNP
rs1056536278 164 dbSNP
rs916605081 172 dbSNP
rs948008621 176 dbSNP
rs1218654295 177 dbSNP
rs1191196988 180 dbSNP
rs1243377815 181 dbSNP
rs1003254959 185 dbSNP
rs1044344376 189 dbSNP
rs1449645291 193 dbSNP
rs1187591761 196 dbSNP
rs1489968388 196 dbSNP
rs1205436143 200 dbSNP
rs1343783196 220 dbSNP
rs116822773 228 dbSNP
rs537258411 229 dbSNP
rs1331149177 231 dbSNP
rs1165494965 246 dbSNP
rs1402968820 247 dbSNP
rs1344667729 249 dbSNP
rs991728295 251 dbSNP
rs916143378 252 dbSNP
rs1398997742 254 dbSNP
rs1166343987 258 dbSNP
rs968975498 259 dbSNP
rs1378225899 267 dbSNP
rs1321630685 272 dbSNP
rs1390957268 275 dbSNP
rs1479705557 278 dbSNP
rs979353176 286 dbSNP
rs1009081821 292 dbSNP
rs1320215660 297 dbSNP
rs1248026721 301 dbSNP
rs924771989 311 dbSNP
rs1362748522 312 dbSNP
rs1221612644 313 dbSNP
rs964353056 316 dbSNP
rs185226621 320 dbSNP
rs995760141 331 dbSNP
rs934746505 333 dbSNP
rs1288907462 336 dbSNP
rs1247819586 357 dbSNP
rs11653 360 dbSNP
rs1355503773 362 dbSNP
rs922632015 364 dbSNP
rs932627238 371 dbSNP
rs755116292 373 dbSNP
rs545230900 382 dbSNP
rs983708364 387 dbSNP
rs559205753 389 dbSNP
rs1245875293 390 dbSNP
rs888373729 409 dbSNP
rs1801995 418 dbSNP
rs1429284344 421 dbSNP
rs1160512960 423 dbSNP
rs1471388974 424 dbSNP
rs1005432840 425 dbSNP
rs1189975820 426 dbSNP
rs1238449246 430 dbSNP
rs1472730585 431 dbSNP
rs960883169 435 dbSNP
rs992258621 435 dbSNP
rs1037274128 436 dbSNP
rs529888427 447 dbSNP
rs1268752090 448 dbSNP
rs1230102148 451 dbSNP
rs1348316537 456 dbSNP
rs1801994 468 dbSNP
rs1278670288 483 dbSNP
rs754227883 486 dbSNP
rs1341356935 489 dbSNP
rs548318829 492 dbSNP
rs1338937629 496 dbSNP
rs1457886871 506 dbSNP
rs925293345 519 dbSNP
rs1158532955 525 dbSNP
rs935937704 533 dbSNP
rs1053018057 538 dbSNP
rs1383264392 546 dbSNP
rs1034716576 548 dbSNP
rs1386752097 553 dbSNP
rs974446248 553 dbSNP
rs376276417 556 dbSNP
rs1181350447 559 dbSNP
rs1443509108 560 dbSNP
rs914866234 565 dbSNP
rs1248062430 570 dbSNP
rs959053869 572 dbSNP
rs1011884553 577 dbSNP
rs1021889451 582 dbSNP
rs1445153655 585 dbSNP
rs1283462161 592 dbSNP
rs1210277996 596 dbSNP
rs1358161017 600 dbSNP
rs779081559 602 dbSNP
rs900300743 612 dbSNP
rs145125201 614 dbSNP
rs1433515828 633 dbSNP
rs1027306853 638 dbSNP
rs138943011 640 dbSNP
rs1005567380 642 dbSNP
rs956225037 643 dbSNP
rs1227183917 645 dbSNP
rs976863403 647 dbSNP
rs922664257 649 dbSNP
rs961170110 651 dbSNP
rs932700695 653 dbSNP
rs1474137253 657 dbSNP
rs551909537 660 dbSNP
rs149442178 662 dbSNP
rs41274230 670 dbSNP
rs1220539044 672 dbSNP
rs1358920354 675 dbSNP
rs925293935 678 dbSNP
rs1216447386 686 dbSNP
rs935317482 691 dbSNP
rs989141641 706 dbSNP
rs1270156112 708 dbSNP
rs550012024 714 dbSNP
rs572511367 720 dbSNP
rs1036943278 724 dbSNP
rs944624674 739 dbSNP
rs1370859579 750 dbSNP
rs1040219773 751 dbSNP
rs1254519447 755 dbSNP
rs1407760030 759 dbSNP
rs11545534 765 dbSNP
rs897006846 770 dbSNP
rs553746157 786 dbSNP
rs1043595 792 dbSNP
rs1266522340 797 dbSNP
rs1409877299 799 dbSNP
rs1483256609 800 dbSNP
rs1208057137 808 dbSNP
rs1048776729 809 dbSNP
rs1305873325 809 dbSNP
rs1272296675 814 dbSNP
rs1467752240 818 dbSNP
rs535671195 827 dbSNP
rs1326354883 829 dbSNP
rs1011918844 836 dbSNP
rs751679870 839 dbSNP
rs769562900 846 dbSNP
rs1299548194 847 dbSNP
rs339042 851 dbSNP
rs903518569 855 dbSNP
rs1470660919 859 dbSNP
rs1013830934 860 dbSNP
rs1175593788 861 dbSNP
rs1023830242 878 dbSNP
rs969519498 882 dbSNP
rs148087928 887 dbSNP
rs1031910238 890 dbSNP
rs375432304 891 dbSNP
rs1285857993 894 dbSNP
rs1332370133 896 dbSNP
rs1336090951 912 dbSNP
rs1462688003 940 dbSNP
rs1233483083 941 dbSNP
rs976937238 963 dbSNP
rs1203533956 969 dbSNP
rs191113826 970 dbSNP
rs116878240 972 dbSNP
rs1342451536 975 dbSNP
rs1309519757 982 dbSNP
rs1199019391 985 dbSNP
rs1372226350 987 dbSNP
rs773873112 988 dbSNP
rs1277245692 989 dbSNP
rs1454152460 995 dbSNP
rs572934824 1004 dbSNP
rs941356360 1009 dbSNP
rs1457645075 1017 dbSNP
rs988198271 1018 dbSNP
rs182826791 1028 dbSNP
rs540223106 1034 dbSNP
rs559226411 1035 dbSNP
rs188295181 1040 dbSNP
rs1407584758 1044 dbSNP
rs761198325 1047 dbSNP
rs1446543465 1049 dbSNP
rs912547215 1052 dbSNP
rs939240504 1058 dbSNP
rs143898751 1062 dbSNP
rs1486444030 1087 dbSNP
rs1263003839 1095 dbSNP
rs12984 1102 dbSNP
rs894945022 1109 dbSNP
rs1214175036 1111 dbSNP
rs1377226261 1127 dbSNP
rs563471786 1128 dbSNP
rs1292083993 1137 dbSNP
rs1801996 1148 dbSNP
rs1477165127 1155 dbSNP
rs975954021 1168 dbSNP
rs147276629 1189 dbSNP
rs921786451 1202 dbSNP
rs1043477686 1219 dbSNP
rs903545451 1220 dbSNP
rs192800780 1236 dbSNP
rs879673514 1242 dbSNP
rs1392260876 1247 dbSNP
rs1386786987 1253 dbSNP
rs1164482115 1262 dbSNP
rs908924379 1270 dbSNP
rs940434276 1276 dbSNP
rs1036055275 1285 dbSNP
rs796566560 1291 dbSNP
rs1185264193 1296 dbSNP
rs1485765235 1299 dbSNP
rs1269967570 1300 dbSNP
rs772686249 1303 dbSNP
rs1356902238 1307 dbSNP
rs1290579146 1309 dbSNP
rs1230185059 1313 dbSNP
rs892066448 1339 dbSNP
rs1227574145 1341 dbSNP
rs1308729113 1353 dbSNP
rs1045312817 1354 dbSNP
rs1345914490 1356 dbSNP
rs905368807 1360 dbSNP
rs773580445 1362 dbSNP
rs1364019571 1372 dbSNP
rs1162858295 1375 dbSNP
rs978281746 1376 dbSNP
rs564158343 1386 dbSNP
rs923685553 1387 dbSNP
rs939171294 1390 dbSNP
rs8899 1394 dbSNP
rs1032919913 1395 dbSNP
rs1056278060 1398 dbSNP
rs916515055 1400 dbSNP
rs1202135212 1402 dbSNP
rs758873681 1403 dbSNP
rs1489763001 1404 dbSNP
rs368736970 1405 dbSNP
rs1210441210 1407 dbSNP
rs1195973844 1408 dbSNP
rs1481344667 1408 dbSNP
rs1226616672 1410 dbSNP
rs1392114359 1410 dbSNP
rs1398745239 1410 dbSNP
rs35355395 1410 dbSNP
rs956847238 1410 dbSNP
rs62479592 1411 dbSNP
rs370251766 1414 dbSNP
rs1019636104 1415 dbSNP
rs1430667276 1421 dbSNP
rs1029875365 1422 dbSNP
rs1450038421 1426 dbSNP
rs965327086 1427 dbSNP
rs1390529743 1431 dbSNP
rs954184947 1432 dbSNP
rs1007415112 1439 dbSNP
rs6949995 1459 dbSNP
rs1016999624 1460 dbSNP
rs1370048112 1474 dbSNP
rs975986947 1478 dbSNP
rs1458373711 1484 dbSNP
rs1194799823 1487 dbSNP
rs1461352892 1489 dbSNP
rs1292384960 1495 dbSNP
rs963092130 1497 dbSNP
rs1388009979 1499 dbSNP
rs1201636030 1501 dbSNP
rs1322566374 1505 dbSNP
rs1279860826 1508 dbSNP
rs182860656 1510 dbSNP
rs568672290 1512 dbSNP
rs1337826030 1515 dbSNP
rs1305099563 1518 dbSNP
rs953218014 1520 dbSNP
rs4566976 1521 dbSNP
rs960616703 1522 dbSNP
rs745537897 1531 dbSNP
rs992036672 1539 dbSNP
rs1159563558 1555 dbSNP
rs1293887988 1558 dbSNP
rs1323990172 1559 dbSNP
rs1251562866 1570 dbSNP
rs1361745587 1576 dbSNP
rs916452279 1582 dbSNP
rs940474120 1595 dbSNP
rs150783498 1596 dbSNP
rs1244399699 1597 dbSNP
rs766786549 1598 dbSNP
rs187489274 1604 dbSNP
rs1043890480 1606 dbSNP
rs1036496305 1614 dbSNP
rs925076148 1626 dbSNP
rs148562448 1627 dbSNP
rs935047361 1629 dbSNP
rs1259212198 1631 dbSNP
rs1239648397 1632 dbSNP
rs1383619382 1635 dbSNP
rs1317174817 1639 dbSNP
rs1319520532 1641 dbSNP
rs1340464739 1641 dbSNP
rs1402857916 1645 dbSNP
rs1248946765 1647 dbSNP
rs1157708942 1651 dbSNP
rs539629394 1656 dbSNP
rs1386696563 1657 dbSNP
rs1161204013 1660 dbSNP
rs1472161082 1671 dbSNP
rs1242686053 1676 dbSNP
rs755627384 1681 dbSNP
rs34448193 1686 dbSNP
rs1445101178 1688 dbSNP
rs1045343178 1689 dbSNP
rs1216175729 1690 dbSNP
rs139193450 1708 dbSNP
rs149959220 1711 dbSNP
rs1360508125 1717 dbSNP
rs1294206894 1719 dbSNP
rs1186392548 1727 dbSNP
rs549257472 1730 dbSNP
rs901505272 1733 dbSNP
rs144879508 1735 dbSNP
rs867040671 1737 dbSNP
rs1366195437 1738 dbSNP
rs41274233 1744 dbSNP
rs1007074808 1751 dbSNP
rs1367095194 1763 dbSNP
rs1387372280 1765 dbSNP
rs574665286 1770 dbSNP
rs12536765 1782 dbSNP
rs6954415 1788 dbSNP
rs1287438858 1790 dbSNP
rs1381863315 1791 dbSNP
rs1019629115 1798 dbSNP
rs962833450 1801 dbSNP
rs765260789 1802 dbSNP
rs994621125 1805 dbSNP
rs1474354075 1806 dbSNP
rs965359832 1812 dbSNP
rs1199961652 1815 dbSNP
rs1490769408 1816 dbSNP
rs1271382279 1826 dbSNP
rs1219587609 1840 dbSNP
rs1451140285 1845 dbSNP
rs996766551 1853 dbSNP
rs1316668909 1855 dbSNP
rs113619493 1859 dbSNP
rs6972005 1860 dbSNP
rs953331306 1865 dbSNP
rs960689415 1867 dbSNP
rs1347724297 1872 dbSNP
rs1230230091 1883 dbSNP
rs992067737 1883 dbSNP
rs758383067 1884 dbSNP
rs916479852 1892 dbSNP
rs909063587 1897 dbSNP
rs969686872 1899 dbSNP
rs962156402 1908 dbSNP
rs1399504412 1910 dbSNP
rs979302790 1950 dbSNP
rs1213973747 1956 dbSNP
rs1257508405 1960 dbSNP
rs1483492358 1963 dbSNP
rs781245470 1964 dbSNP
rs1426893078 1965 dbSNP
rs192409862 1967 dbSNP
rs1477788500 1980 dbSNP
rs917633931 1989 dbSNP
rs1473534858 1994 dbSNP
rs1456482358 1995 dbSNP
rs755906267 2007 dbSNP
rs1204826526 2022 dbSNP
rs998696276 2022 dbSNP
rs1299575219 2033 dbSNP
rs935133237 2036 dbSNP
rs1052604677 2037 dbSNP
rs1443995151 2054 dbSNP
rs80070830 2058 dbSNP
rs1337345859 2081 dbSNP
rs866649019 2085 dbSNP
rs768618192 2087 dbSNP
rs546015528 2088 dbSNP
rs890052509 2094 dbSNP
rs1175181579 2096 dbSNP
rs1007518423 2103 dbSNP
rs62479593 2111 dbSNP
rs1179119976 2113 dbSNP
rs199936795 2113 dbSNP
rs79642300 2120 dbSNP
rs901306708 2120 dbSNP
rs996880073 2120 dbSNP
rs1028302156 2121 dbSNP
rs3211119 2124 dbSNP
rs1209904811 2126 dbSNP
rs1289040056 2128 dbSNP
rs888419758 2130 dbSNP
rs1349990188 2131 dbSNP
rs1222276366 2132 dbSNP
rs1303750222 2135 dbSNP
rs866283144 2140 dbSNP
rs994299855 2143 dbSNP
rs1016559525 2146 dbSNP
rs1375523526 2156 dbSNP
rs1315066819 2164 dbSNP
rs546636253 2170 dbSNP
rs780427395 2177 dbSNP
rs528519937 2182 dbSNP
rs1302172493 2187 dbSNP
rs1483968524 2192 dbSNP
rs961906018 2193 dbSNP
rs561699616 2194 dbSNP
rs528863815 2197 dbSNP
rs1161564543 2199 dbSNP
rs8597 2202 dbSNP
rs1468217858 2220 dbSNP
rs970493889 2224 dbSNP
rs1164372231 2229 dbSNP
rs1023563851 2231 dbSNP
rs1425369366 2244 dbSNP
rs1254741615 2252 dbSNP
rs1044203 2257 dbSNP
rs980499712 2259 dbSNP
rs1175733580 2262 dbSNP
rs1244127734 2265 dbSNP
rs969341434 2266 dbSNP
rs1374074679 2269 dbSNP
rs1214020159 2274 dbSNP
rs979754256 2278 dbSNP
rs1292013840 2282 dbSNP
rs1432132981 2285 dbSNP
rs1247598614 2290 dbSNP
rs1032208995 2301 dbSNP
rs187496860 2304 dbSNP
rs956732040 2311 dbSNP
rs569441928 2314 dbSNP
rs539691664 2316 dbSNP
rs1399164368 2322 dbSNP
rs987912800 2346 dbSNP
rs1303956856 2347 dbSNP
rs1459528384 2355 dbSNP
rs923031354 2356 dbSNP
rs914103175 2364 dbSNP
rs1429566138 2371 dbSNP
rs1370011294 2384 dbSNP
rs933026629 2386 dbSNP
rs1041232967 2387 dbSNP
rs985799368 2393 dbSNP
rs1269182133 2395 dbSNP
rs1044226 2400 dbSNP
rs192738917 2401 dbSNP
rs943006539 2403 dbSNP
rs932755194 2407 dbSNP
rs1218886994 2411 dbSNP
rs771480184 2413 dbSNP
rs1344095394 2419 dbSNP
rs1217832673 2420 dbSNP
rs1229051286 2426 dbSNP
rs184569676 2432 dbSNP
rs1388671633 2442 dbSNP
rs1388683639 2445 dbSNP
rs1293075713 2448 dbSNP
rs930120042 2458 dbSNP
rs1005924251 2466 dbSNP
rs1436026750 2469 dbSNP
rs557613321 2470 dbSNP
rs1169103706 2476 dbSNP
rs1477718542 2481 dbSNP
rs1430338832 2484 dbSNP
rs199787815 2494 dbSNP
rs76549052 2504 dbSNP
rs1431154345 2506 dbSNP
rs1024838308 2514 dbSNP
rs970526685 2523 dbSNP
rs574011378 2526 dbSNP
rs771448709 2527 dbSNP
rs1197885131 2531 dbSNP
rs777099740 2541 dbSNP
rs537840591 2542 dbSNP
rs1230774123 2549 dbSNP
rs1393650187 2551 dbSNP
rs1032654680 2552 dbSNP
rs1169636860 2555 dbSNP
rs1392060026 2556 dbSNP
rs1419345129 2562 dbSNP
rs1408745705 2569 dbSNP
rs956626048 2571 dbSNP
rs1033813359 2582 dbSNP
rs1350591008 2583 dbSNP
rs957731720 2586 dbSNP
rs369130036 2589 dbSNP
rs1324218762 2593 dbSNP
rs1464835566 2596 dbSNP
rs987983409 2598 dbSNP
rs759945318 2602 dbSNP
rs114872200 2603 dbSNP
rs1235755885 2606 dbSNP
rs1177945334 2611 dbSNP
rs1461756455 2612 dbSNP
rs1264921908 2623 dbSNP
rs752847166 2643 dbSNP
rs1435475696 2647 dbSNP
rs763157452 2649 dbSNP
rs985876234 2651 dbSNP
rs764011519 2662 dbSNP
rs1296611897 2668 dbSNP
rs910254165 2670 dbSNP
rs111484600 2676 dbSNP
rs1230004229 2692 dbSNP
rs1307251290 2693 dbSNP
rs1446127544 2694 dbSNP
rs922783551 2698 dbSNP
rs1336698105 2708 dbSNP
rs546033905 2713 dbSNP
rs932786359 2713 dbSNP
rs1158788331 2721 dbSNP
rs1378083754 2726 dbSNP
rs557953115 2726 dbSNP
rs572998608 2731 dbSNP
rs540359523 2732 dbSNP
rs930199885 2734 dbSNP
rs561614444 2740 dbSNP
rs1241917640 2741 dbSNP
rs1262098330 2745 dbSNP
rs897135784 2748 dbSNP
rs1165551760 2753 dbSNP
rs1284112815 2759 dbSNP
rs896620201 2760 dbSNP
rs1414625626 2764 dbSNP
rs1461043748 2766 dbSNP
rs1046319185 2769 dbSNP
rs528924328 2770 dbSNP
rs567199131 2773 dbSNP
rs1402236344 2776 dbSNP
rs1045542242 2777 dbSNP
rs543861744 2782 dbSNP
rs760895013 2786 dbSNP
rs1424782457 2795 dbSNP
rs1010645390 2803 dbSNP
rs1161406744 2807 dbSNP
rs1324503919 2808 dbSNP
rs1373572335 2817 dbSNP
rs1021065970 2818 dbSNP
rs1450119219 2825 dbSNP
rs966319254 2830 dbSNP
rs1216108953 2835 dbSNP
rs1452256438 2840 dbSNP
rs1227483350 2845 dbSNP
rs1292041280 2850 dbSNP
rs1208121985 2854 dbSNP
rs905215582 2860 dbSNP
rs1271254011 2861 dbSNP
rs1338838738 2866 dbSNP
rs766650499 2866 dbSNP
rs1277186100 2870 dbSNP
rs922816273 2871 dbSNP
rs1031665436 2872 dbSNP
rs985626956 2877 dbSNP
rs1404212620 2881 dbSNP
rs1378364993 2882 dbSNP
rs1172674982 2884 dbSNP
rs1230850351 2887 dbSNP
rs1248665520 2888 dbSNP
rs1286393955 2888 dbSNP
rs1422565162 2888 dbSNP
rs1476739003 2888 dbSNP
rs1478510710 2888 dbSNP
rs201424020 2888 dbSNP
rs1491266747 2889 dbSNP
rs910037881 2889 dbSNP
rs199836652 2890 dbSNP
rs1207769654 2891 dbSNP
rs1451085320 2891 dbSNP
rs1180508217 2892 dbSNP
rs796706020 2892 dbSNP
rs1201000299 2893 dbSNP
rs553708996 2893 dbSNP
rs1220174502 2894 dbSNP
rs1369337389 2894 dbSNP
rs941465658 2894 dbSNP
rs1435163591 2895 dbSNP
rs1688906 2895 dbSNP
rs1053761845 2896 dbSNP
rs369353008 2896 dbSNP
rs536238594 2896 dbSNP
rs1189642485 2897 dbSNP
rs1415927310 2897 dbSNP
rs1427585427 2897 dbSNP
rs1688905 2897 dbSNP
rs763113986 2897 dbSNP
rs1037095751 2898 dbSNP
rs373779393 2898 dbSNP
rs1238500692 2899 dbSNP
rs1238807419 2900 dbSNP
rs1475172328 2901 dbSNP
rs1211328461 2902 dbSNP
rs886484839 2902 dbSNP
rs918596435 2902 dbSNP
rs1314262560 2903 dbSNP
rs1218212465 2904 dbSNP
rs1353810697 2904 dbSNP
rs533412722 2904 dbSNP
rs1185853271 2905 dbSNP
rs1443926260 2906 dbSNP
rs567056336 2906 dbSNP
rs747271530 2906 dbSNP
rs760006990 2906 dbSNP
rs1457934240 2907 dbSNP
rs535320358 2907 dbSNP
rs767050270 2907 dbSNP
rs1449979808 2908 dbSNP
rs58253064 2908 dbSNP
rs1160576814 2909 dbSNP
rs1381149153 2909 dbSNP
rs1437884441 2909 dbSNP
rs2402937 2909 dbSNP
rs7792925 2910 dbSNP
rs1046350049 2911 dbSNP
rs1158276411 2912 dbSNP
rs565571318 2913 dbSNP
rs62479594 2914 dbSNP
rs906490405 2914 dbSNP
rs1415900103 2917 dbSNP
rs1334569366 2918 dbSNP
rs965006208 2919 dbSNP
rs1002114779 2922 dbSNP
rs1289656027 2923 dbSNP
rs1350615685 2926 dbSNP
rs1227396532 2930 dbSNP
rs1277472340 2932 dbSNP
rs1346704261 2934 dbSNP
rs1313386547 2936 dbSNP
rs1202478216 2956 dbSNP
rs1229894576 2957 dbSNP
rs1279824059 2962 dbSNP
rs1302115574 2966 dbSNP
rs1400351136 2978 dbSNP
rs1361471157 2979 dbSNP
rs1485605632 2985 dbSNP
rs1417975994 2992 dbSNP
rs1055399682 2995 dbSNP
rs1166122112 2997 dbSNP
rs893624857 2998 dbSNP
rs1412262809 3001 dbSNP
rs1209401534 3005 dbSNP
rs1181682102 3006 dbSNP
rs1254060017 3007 dbSNP
rs1478341633 3007 dbSNP
rs1472991138 3008 dbSNP
rs1223121251 3009 dbSNP
rs200681363 3009 dbSNP
rs397748997 3009 dbSNP
rs534495056 3009 dbSNP
rs1311889439 3010 dbSNP
rs36090779 3010 dbSNP
rs1219032016 3018 dbSNP
rs892382986 3025 dbSNP
rs1181191965 3028 dbSNP
rs1280338545 3035 dbSNP
rs1398317142 3036 dbSNP
rs1362207663 3045 dbSNP
rs1384514044 3049 dbSNP
rs1294265332 3051 dbSNP
rs1009445760 3061 dbSNP
rs1479145904 3063 dbSNP
rs566674140 3065 dbSNP
rs1348700092 3069 dbSNP
rs1164775570 3076 dbSNP
rs1394303506 3077 dbSNP
rs1432751290 3078 dbSNP
rs954520767 3079 dbSNP
rs1007346947 3081 dbSNP
rs1370624570 3082 dbSNP
rs1390257452 3083 dbSNP
rs1326289965 3086 dbSNP
rs1332427882 3092 dbSNP
rs1192475420 3093 dbSNP
rs181395003 3096 dbSNP
rs1017755707 3108 dbSNP
rs1487189621 3113 dbSNP
rs1233554778 3118 dbSNP
rs963137310 3126 dbSNP
rs1199115515 3138 dbSNP
rs1304580633 3144 dbSNP
rs549495079 3160 dbSNP
rs567648628 3163 dbSNP
rs1217785636 3167 dbSNP
rs552655829 3170 dbSNP
rs1302222245 3183 dbSNP
rs1388619014 3185 dbSNP
rs1365530616 3213 dbSNP
rs997844792 3220 dbSNP
rs1029275642 3230 dbSNP
rs1232721266 3240 dbSNP
rs1169037555 3244 dbSNP
rs982994363 3247 dbSNP
rs747692132 3252 dbSNP
rs1377863847 3257 dbSNP
rs572974798 3268 dbSNP
rs777103121 3270 dbSNP
rs1195261268 3271 dbSNP
rs985711425 3271 dbSNP
rs949534641 3278 dbSNP
rs1045209880 3279 dbSNP
rs556241656 3286 dbSNP
rs569192851 3289 dbSNP
rs1394248426 3294 dbSNP
rs1197835815 3308 dbSNP
rs1345396513 3310 dbSNP
rs926710590 3312 dbSNP
rs759581967 3317 dbSNP
rs766373331 3320 dbSNP
rs1407999379 3323 dbSNP
rs773423213 3324 dbSNP
rs918636307 3334 dbSNP
rs1406268333 3336 dbSNP
rs769238341 3339 dbSNP
rs1330454745 3341 dbSNP
rs775045727 3342 dbSNP
rs1262328678 3343 dbSNP
rs748430460 3347 dbSNP
rs981477585 3348 dbSNP
rs1302844693 3352 dbSNP
rs1335956271 3353 dbSNP
rs1379824951 3356 dbSNP
rs1217670344 3358 dbSNP
rs1285549649 3360 dbSNP
rs371632717 3363 dbSNP
rs1201718523 3364 dbSNP
rs747346814 3367 dbSNP
rs771228886 3371 dbSNP
rs772553185 3373 dbSNP
rs776133013 3378 dbSNP
rs759166292 3385 dbSNP
rs747624901 3394 dbSNP
rs140568559 3398 dbSNP
rs558064192 3399 dbSNP
rs1426092236 3400 dbSNP
rs1464280173 3402 dbSNP
rs1303243754 3403 dbSNP
rs1389369635 3404 dbSNP
rs376418066 3408 dbSNP
rs763991421 3411 dbSNP
rs1336176040 3416 dbSNP
rs1239181192 3423 dbSNP
rs1315875835 3424 dbSNP
rs1306753275 3425 dbSNP
rs1351782596 3426 dbSNP
rs1224995349 3427 dbSNP
rs753174022 3429 dbSNP
rs150426624 3433 dbSNP
rs374287355 3434 dbSNP
rs1208633947 3435 dbSNP
rs750190072 3436 dbSNP
rs545093905 3439 dbSNP
rs368257791 3440 dbSNP
rs780447000 3448 dbSNP
rs753945979 3451 dbSNP
rs755147227 3452 dbSNP
rs1367423732 3461 dbSNP
rs1455912387 3465 dbSNP
rs946529537 3466 dbSNP
rs779283336 3471 dbSNP
rs143205154 3472 dbSNP
rs1240992962 3473 dbSNP
rs1329058691 3478 dbSNP
rs201497890 3480 dbSNP
rs778128511 3486 dbSNP
rs371754125 3487 dbSNP
rs540420837 3489 dbSNP
rs200091747 3490 dbSNP
rs1054197675 3491 dbSNP
rs771601968 3494 dbSNP
rs892468343 3498 dbSNP
rs374687514 3501 dbSNP
rs768216743 3503 dbSNP
rs777251068 3508 dbSNP
rs367791096 3511 dbSNP
rs1236804194 3512 dbSNP
rs761743897 3519 dbSNP
rs767387479 3520 dbSNP
rs371641480 3525 dbSNP
rs1051668886 3537 dbSNP
rs184461423 3539 dbSNP
rs1029306637 3549 dbSNP
rs1007417450 3555 dbSNP
rs1473119037 3570 dbSNP
rs1370114333 3572 dbSNP
rs1467319715 3577 dbSNP
rs12112071 3586 dbSNP
rs544210051 3595 dbSNP
rs1017152521 3598 dbSNP
rs963468545 3602 dbSNP
rs558800220 3603 dbSNP
rs1369694353 3613 dbSNP
rs1457912915 3615 dbSNP
rs994559503 3620 dbSNP
rs575492398 3624 dbSNP
rs972966718 3626 dbSNP
rs752037361 3633 dbSNP
rs1026440721 3634 dbSNP
rs1337946540 3637 dbSNP
rs950373249 3638 dbSNP
rs1405413794 3644 dbSNP
rs1025811761 3647 dbSNP
rs562316580 3648 dbSNP
rs755815438 3663 dbSNP
rs770046613 3670 dbSNP
rs779623213 3671 dbSNP
rs1363153400 3677 dbSNP
rs1423995963 3680 dbSNP
rs1382143104 3682 dbSNP
rs1478961191 3692 dbSNP
rs1240540694 3704 dbSNP
rs1294142182 3705 dbSNP
rs1452207884 3705 dbSNP
rs1292683810 3711 dbSNP
rs1212295545 3712 dbSNP
rs1334627046 3714 dbSNP
rs1259177500 3720 dbSNP
rs918185091 3723 dbSNP
rs1315724633 3728 dbSNP
rs764287739 3736 dbSNP
rs981508849 3741 dbSNP
rs1332252487 3760 dbSNP
rs1868774 3762 dbSNP
rs1332898152 3767 dbSNP
rs926772265 3771 dbSNP
rs1181984863 3774 dbSNP
rs1400934316 3775 dbSNP
rs1172601489 3780 dbSNP
rs113569143 3781 dbSNP
rs545326925 3789 dbSNP
rs991143850 3794 dbSNP
rs1261066788 3810 dbSNP
rs372058528 3813 dbSNP
rs1485462569 3817 dbSNP
rs561231344 3818 dbSNP
rs1053866380 3822 dbSNP
rs560402413 3823 dbSNP
rs1184569362 3825 dbSNP
rs1258113518 3842 dbSNP
rs1271857705 3850 dbSNP
rs1219386821 3853 dbSNP
rs527925248 3860 dbSNP
rs1186555825 3861 dbSNP
rs902336163 3863 dbSNP
rs552779996 3865 dbSNP
rs570956146 3874 dbSNP
rs889458779 3875 dbSNP
rs1444350900 3877 dbSNP
rs1353640447 3878 dbSNP
rs1051744572 3881 dbSNP
rs890391366 3884 dbSNP
rs1159519578 3887 dbSNP
rs943269594 3903 dbSNP
rs1017010080 3905 dbSNP
rs1039284074 3908 dbSNP
rs898997484 3909 dbSNP
rs754481273 3927 dbSNP
rs898783225 3928 dbSNP
rs1453410563 3929 dbSNP
rs200879306 3937 dbSNP
rs1250060539 3945 dbSNP
rs146689090 3949 dbSNP
rs1415968241 3955 dbSNP
rs1443824859 3957 dbSNP
rs1277718562 3958 dbSNP
rs1209553908 3961 dbSNP
rs778864031 3963 dbSNP
rs748052675 3964 dbSNP
rs1353691447 3975 dbSNP
rs531679811 3979 dbSNP
rs971535232 3994 dbSNP
rs1316572513 4000 dbSNP
rs761859824 4004 dbSNP
rs886163971 4009 dbSNP
rs1449918988 4015 dbSNP
rs1002973888 4018 dbSNP
rs117607581 4027 dbSNP
rs959037998 4028 dbSNP
rs1023889275 4037 dbSNP
rs189168873 4038 dbSNP
rs543011966 4041 dbSNP
rs1254758654 4043 dbSNP
rs1483788657 4047 dbSNP
rs970956245 4049 dbSNP
rs968015469 4063 dbSNP
rs1473948973 4073 dbSNP
rs116699212 4088 dbSNP
rs1186702195 4089 dbSNP
rs1034297456 4091 dbSNP
rs567527479 4092 dbSNP
rs1488341131 4099 dbSNP
rs1287616541 4103 dbSNP
rs551741211 4106 dbSNP
rs566770860 4107 dbSNP
rs958218193 4113 dbSNP
rs923789160 4115 dbSNP
rs1229845308 4116 dbSNP
rs1353257377 4121 dbSNP
rs865904747 4122 dbSNP
rs1379770030 4123 dbSNP
rs1341354989 4127 dbSNP
rs181833432 4129 dbSNP
rs1312862913 4140 dbSNP
rs945414933 4151 dbSNP
rs1411678271 4157 dbSNP
rs911014417 4160 dbSNP
rs987479796 4161 dbSNP
rs1159633203 4163 dbSNP
rs1038070219 4170 dbSNP
rs1416072539 4170 dbSNP
rs911858679 4180 dbSNP
rs1187669065 4182 dbSNP
rs943322435 4183 dbSNP
rs1264842990 4184 dbSNP
rs1038943956 4188 dbSNP
rs1485232656 4190 dbSNP
rs753772247 4195 dbSNP
rs1222325216 4196 dbSNP
rs1247250965 4202 dbSNP
rs1223598265 4205 dbSNP
rs899016738 4206 dbSNP
rs930510002 4207 dbSNP
rs1348397895 4217 dbSNP
rs1218980603 4225 dbSNP
rs555231478 4234 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||||  |  ||||||| 
Target 5' caaAAACCA-CA--UGCUGCUg 3'
9 - 27
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000535011.2 | 3UTR | CUGAUUUCCAAAAACCACAUGCUGCUGAAUUUACCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.594 1.4e-3 -0.448 1.6e-2 23 Click to see details
GSE19783 ER- ER- breast cancer -0.314 2.4e-3 -0.358 6.0e-4 79 Click to see details
GSE19536 Breast cancer -0.249 6.2e-3 -0.288 1.8e-3 100 Click to see details
GSE28260 Renal cortex and medulla -0.605 1.4e-2 -0.511 3.7e-2 13 Click to see details
GSE21032 Prostate cancer 0.205 3.2e-2 0.172 6.0e-2 83 Click to see details
GSE14794 Lymphoblastoid cells 0.171 5.4e-2 0.178 4.7e-2 90 Click to see details
GSE32688 Pancreatic cancer 0.267 7.0e-2 0.250 8.4e-2 32 Click to see details
GSE38226 Liver fibrosis 0.327 7.4e-2 0.277 1.1e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.395 1.0e-1 0.322 1.5e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.156 1.1e-1 -0.172 8.7e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.258 1.1e-1 -0.287 8.7e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.215 1.5e-1 0.021 4.6e-1 25 Click to see details
GSE28544 Breast cancer 0.169 2.1e-1 0.517 4.8e-3 24 Click to see details
GSE17498 Multiple myeloma 0.097 2.8e-1 0.137 2.0e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.14 2.8e-1 0.198 2.0e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.117 2.9e-1 -0.049 4.1e-1 25 Click to see details
GSE17306 Multiple myeloma 0.078 3.0e-1 -0.015 4.6e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.136 3.1e-1 0.132 3.1e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.037 4.4e-1 -0.092 3.5e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.037 4.4e-1 -0.092 3.5e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.037 4.4e-1 -0.092 3.5e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.8 0 -0.810 0 32 Click to see details
BLCA -0.629 0 -0.577 0.01 18 Click to see details
PRAD -0.338 0.01 -0.270 0.03 50 Click to see details
PAAD -0.977 0.01 -1.000 0.5 4 Click to see details
HNSC -0.314 0.02 -0.376 0.01 42 Click to see details
CHOL -0.57 0.05 -0.733 0.01 9 Click to see details
THCA -0.208 0.06 -0.202 0.06 59 Click to see details
ESCA 0.474 0.07 0.627 0.02 11 Click to see details
LUSC -0.219 0.09 -0.214 0.1 38 Click to see details
KICH 0.244 0.12 0.198 0.17 25 Click to see details
LIHC -0.163 0.13 -0.120 0.21 49 Click to see details
COAD -0.432 0.14 -0.595 0.06 8 Click to see details
KIRC 0.083 0.25 0.050 0.34 68 Click to see details
KIRP -0.099 0.29 -0.047 0.4 32 Click to see details
CESC -0.44 0.35 -0.500 0.33 3 Click to see details
UCEC 0.089 0.36 -0.035 0.44 19 Click to see details
PCPG -0.295 0.4 -0.500 0.33 3 Click to see details
LUAD 0.059 0.43 0.210 0.26 12 Click to see details
BRCA 0.006 0.48 0.046 0.34 84 Click to see details
BRCA 0.006 0.48 0.046 0.34 84 Click to see details
BRCA 0.006 0.48 0.046 0.34 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and p