miRTarBase - #MIRT103092 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAFK   
Synonyms NFE2U, P18
Description MAF bZIP transcription factor K
Transcript NM_002360   
Expression
Putative miRNA Targets on MAFK
3'UTR of MAFK
(miRNA target sites are highlighted)
>MAFK|NM_002360|3'UTR
   1 TGCCGGCCGGGGGCGGGGGGTGGCGGGCGGCGGGCGGCGGGCAGGCGGGTGGGGGCACACCCCTCGTACCTGTCACTGGG
  81 ATGCAGACTCTCGACATCCGAGTCCAAGCGCAGGCCCCTCGGGCGCAGGCAGCTCACACCAGGAAGAGACTGTATTGCAG
 161 GGTGAAGAGTGGGCTCCCGTGGGCCCAGAGCTGCACGCCGGTCCACAGACACACTCACGCCCGCCACCTGCTCCCCGCAG
 241 GATGTGTCTGTGTGTGGGAATTGGTATCTTGCACCCGTGGGAGTCGGGACATATAATGGAAAGGCCCTCGGGAAGTTCCG
 321 CGTCCTCTGTGGGGGCTGCCGGAAGACACGGCCCCAGGAGTCAGGCCCCTGTGGTCAGGTCTAGCATGGGGCTTGTTTTC
 401 CACTCCTGCTGTAAGCAGCCTTCGACACCTGTCCTGCCACGGCCTCCCAGCCGGTGCGGGAGCCCCTCACTGCCCTGACC
 481 GACTCCGCAGTCCCCGGGGAGGAGCATGGATGGTGTGTCGGCAGCTCCGTCCTTCCAGCTGTCCCGTTGCAGTGCCCGTG
 561 ATCCGCGTCTGCCTTAGCAGGGGCCTGCGTGAGTGGGCACGGTGTGGGAGGTCGCCTGCGTGGGGTGGTGTCTGTGTGTG
 641 TGCACGCACGCCTGCCATCAAAGCAGCAGGGCTGAGGGGGTGCAGCTTGCTGGTGTTCACTGGGGGAGGGCCTGTGGGCA
 721 CACATGGCAGAGAGAGTGGCTCACACGTCGTGAGGTCTCCCCTGTGCTCTGGTGACCCGAGGAGGTCGTGCAGCACAGCG
 801 CAGAAGCCCCTGCCCACGGGATCCGGCCCCCCAGACACCGACCCCACAGGCCGTCCCGGATCTCAGCGGACACAGGCAGG
 881 AGCGCCCCATCATTTGACGGTGAGCAGGACTCAGGCTGTGTGTCCTGGAGCTACTTCTCACCAACTGTGGTCAGTGCAGG
 961 GGGAACGAGGAGGTCTTTTGGGGGCCTGGCGAGGGGAAGGGCTGCTGCAGTCTAGGGAGAGGGGGTGCAGCCTGGGGGAT
1041 GTTGGTGGACATGGATGTGGAGGTGGAAGGAGGAGGACGTTGCGTGGAGTGGTGGGAGGAGGCGGGAGCCGTGTGCGAGA
1121 GCAGGTGGAAAGCCTTGAGGGGCAGGACCAGGATGCAGCTGGCTTGTAGAAGAGCTCAGGAGTGAGCCTGGCACTCCAGA
1201 GGGCGCGGCGGGTGGGGAGGCAGCAGGCACCAGTCCAGGAGAGCTTCGTGGACGTGGCTCCTGCGCGCACACCCCCAGGA
1281 GCACAGCCACGGGCTGCAGGTGTGGCTGGCCTCAGCACTCAGTCCTCACCCGGAGCCTTTGCCTGCTCCTCCTTCCAAGA
1361 GCACTGAGGCACCAGTGGGCTTGGCACTCCACCTTGGGCTTCCTTTTCCTGGAGAGCCGCCTTGAGGGTCCCTCCTGTGA
1441 CTGGGGTCTCTGCAGCGAGAGCCGCGGGGGTTGCGGAGCCCCTGCCTGGGGGAGCTGGCGGAATGTGAGCCGCCGGCCGG
1521 GGGCCGCCACATAAGACCTGCAAGGTGGTGCCTGGGGCCCTGGCTCCTTCTCGGCTGCCCCTGCCCACCCAGTAACAGCC
1601 CCCACCAGCTACAGAGCCCAGGCGGGTGCCAGCCACGCTGGGAGGGCAGAGGACAGACAGCCCCGGGGCTGCGACTTGGT
1681 TCTGTGTCTACTGTTAGAAGTTGAGTGGGAAGCTGCAGGCCCGCCAGGACCACTGGGTCCCTACAGAGCAAAGGCCTGCG
1761 TGTTCCCAAACAGCCGTTGCCCCCGTGGCCGTGGTAGGTAATCCATATTGGATGTCATAAGGACCAGGGGGATATTTAAA
1841 GAGAGAAACAGAAAATATATAGAGATATAAAATTATATTCACAGTTTATCTACAGATTTTTCGTAACAATCTTTCTTTTC
1921 CAGTTTGATACTGTAAATCTATCAGAGCAGAGCCGGGGGCACGGGCACAGGTGGGAGTTGGGAGCAAAGCGGAGGCCCGG
2001 GCTGCCCGCCGTCCCCCTTCATCTCCCCACGGACTGTACCAGGCAGCTGGGCCCCGCAGGACAGGCCGCAGCGGGTGGCC
2081 GGTTCTGTCCCGTCTTGGGGTTCTTGGTGTCCACGTCTTGTGGGCCGTGGGCTTCTACCTGCCCTTGGCCTGCAGTGCTT
2161 TGCTGGAGAAGGGACTCCCTGGTCCCCAGGGTGGACGGAGCCGCTGTCACCGCCCAGAGCTGGGCCGGGGAAGCACGGTG
2241 TGTTCTGCTTTTCTTTTCAGATTGTTGAAATTTCATTGTCATGATTTAATATATGGATTTTTTTATTTAAGAAAAAGACG
2321 AGGGACTCTTTGTCACGTGGGTTTGTTTTCTGTCTCCGTGCCTCCGGCTTCCCAAAGAGATCCAGGTCTTTGCGTTTCCA
2401 GGGCGTGGGGACCCCGGCCCCCTATGCCGCCACGCCGCCACACCGCCTCACCCTGGCTTCTGTGCTACTTGGCAGTTCCA
2481 TTTCATTATTTATTTTTTGTGCTGCTTTTTATCATGATATAAATTATTGAAAACAGATCACATGTGGGCCCGTGTCTGGC
2561 CGCCGCCGCCCTGCCCCGTCCCTGCGGCCACCACCTAATTTATTGCCGTGCGTCCTGCTGCTGTGACTGCTTTTGTACCT
2641 TTGCAATAAAGAATTTTCTGGTTTCAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   || ||||||||| 
Target 5' ttatttattTTTTGTGCTGCTt 3'
2486 - 2507 157.00 -14.20
2
miRNA  3' guGUUUGGUAA---UAC-----ACGACGAu 5'
            :|| ::|||   :||     ||||||| 
Target 5' ccTAATTTATTGCCGTGCGTCCTGCTGCTg 3'
2594 - 2623 148.00 -14.50
3
miRNA  3' gugUUUG-GUAAUACACGACGAu 5'
             ||:| |: |:||| ||||| 
Target 5' gggAAGCACGGTGTGTTCTGCTt 3'
2228 - 2250 135.00 -14.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31524544 16 COSMIC
COSN30709439 56 COSMIC
COSN17470017 238 COSMIC
COSN20817893 332 COSMIC
COSN28741127 382 COSMIC
COSN31546202 424 COSMIC
COSN31543680 491 COSMIC
COSN28201137 564 COSMIC
COSN7657830 568 COSMIC
COSN21345078 594 COSMIC
COSN2212747 688 COSMIC
COSN31487720 724 COSMIC
COSN30161544 750 COSMIC
COSN31517332 780 COSMIC
COSN31487595 885 COSMIC
COSN14775205 911 COSMIC
COSN28725504 926 COSMIC
COSN31611024 956 COSMIC
COSN28733334 968 COSMIC
COSN15662542 976 COSMIC
COSN26637469 1026 COSMIC
COSN26641404 1064 COSMIC
COSN8516162 1096 COSMIC
COSN26575162 1114 COSMIC
COSN25069227 1180 COSMIC
COSN15226314 1261 COSMIC
COSN32057063 1527 COSMIC
COSN19722630 1532 COSMIC
COSN31588186 1792 COSMIC
COSN31567911 1855 COSMIC
COSN31589991 1934 COSMIC
COSN30173075 1940 COSMIC
COSN31579447 2041 COSMIC
COSN9980298 2171 COSMIC
COSN24830696 2320 COSMIC
COSN31588646 2378 COSMIC
COSN32063592 2417 COSMIC
COSN19343226 2472 COSMIC
COSN5652953 2489 COSMIC
COSN24301975 2492 COSMIC
COSN26637470 2566 COSMIC
COSN31543374 2566 COSMIC
COSN18723737 2568 COSMIC
COSN27045118 2608 COSMIC
COSN26640038 2636 COSMIC
rs3735656 911 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766450561 4 dbSNP
rs753620957 5 dbSNP
rs559668774 6 dbSNP
rs1230145609 7 dbSNP
rs764971305 9 dbSNP
rs372751056 10 dbSNP
rs777974954 11 dbSNP
rs1202087490 12 dbSNP
rs757896570 13 dbSNP
rs1160642108 15 dbSNP
rs374770359 15 dbSNP
rs746555332 16 dbSNP
rs1427687440 17 dbSNP
rs747183610 18 dbSNP
rs771233474 18 dbSNP
rs781671062 20 dbSNP
rs1210565892 22 dbSNP
rs1485295138 22 dbSNP
rs574234247 22 dbSNP
rs879087043 22 dbSNP
rs1460509492 24 dbSNP
rs746216163 25 dbSNP
rs770208378 26 dbSNP
rs1406641464 29 dbSNP
rs994750779 30 dbSNP
rs1447786075 31 dbSNP
rs775748199 32 dbSNP
rs1244989884 33 dbSNP
rs749520912 33 dbSNP
rs1400297614 36 dbSNP
rs1478561415 36 dbSNP
rs1279681949 37 dbSNP
rs1427530602 39 dbSNP
rs181353243 40 dbSNP
rs1459555976 42 dbSNP
rs1262451278 44 dbSNP
rs774255082 47 dbSNP
rs1265478473 48 dbSNP
rs1357704233 49 dbSNP
rs896227952 51 dbSNP
rs1388415762 55 dbSNP
rs1298543569 61 dbSNP
rs1364772099 61 dbSNP
rs1437383965 64 dbSNP
rs1380589418 66 dbSNP
rs999999344 67 dbSNP
rs1166482855 75 dbSNP
rs1334427445 83 dbSNP
rs1390431652 85 dbSNP
rs1031520827 89 dbSNP
rs1241985069 92 dbSNP
rs913380196 93 dbSNP
rs955970547 94 dbSNP
rs992627815 96 dbSNP
rs1350557185 99 dbSNP
rs916901386 100 dbSNP
rs1230226715 101 dbSNP
rs1248275322 103 dbSNP
rs1286351157 105 dbSNP
rs1342537301 105 dbSNP
rs1349753634 109 dbSNP
rs969658598 110 dbSNP
rs979746472 111 dbSNP
rs1283649585 112 dbSNP
rs1043270054 113 dbSNP
rs920818434 115 dbSNP
rs1014423795 118 dbSNP
rs1280997073 121 dbSNP
rs926183203 122 dbSNP
rs1371491012 123 dbSNP
rs548138375 125 dbSNP
rs1422347026 126 dbSNP
rs1163302798 127 dbSNP
rs908063160 131 dbSNP
rs1362005438 137 dbSNP
rs1180913555 138 dbSNP
rs1253684083 141 dbSNP
rs1483298457 141 dbSNP
rs944779627 142 dbSNP
rs1489911183 144 dbSNP
rs1289374631 147 dbSNP
rs1252713047 157 dbSNP
rs924720311 169 dbSNP
rs1358491735 170 dbSNP
rs1040502039 175 dbSNP
rs900583881 179 dbSNP
rs931933600 180 dbSNP
rs1043757859 188 dbSNP
rs1351550468 189 dbSNP
rs904415640 195 dbSNP
rs1000144443 197 dbSNP
rs562117228 198 dbSNP
rs530882473 200 dbSNP
rs1014509619 201 dbSNP
rs897642304 204 dbSNP
rs1382132965 206 dbSNP
rs1024024228 212 dbSNP
rs369744704 213 dbSNP
rs1478579912 214 dbSNP
rs994781052 214 dbSNP
rs551070921 215 dbSNP
rs979715375 219 dbSNP
rs373141825 220 dbSNP
rs186206516 222 dbSNP
rs1282229304 223 dbSNP
rs749068603 223 dbSNP
rs983754184 224 dbSNP
rs1411109042 230 dbSNP
rs953248996 235 dbSNP
rs1306134178 236 dbSNP
rs570128063 237 dbSNP
rs944853456 238 dbSNP
rs965522660 239 dbSNP
rs1342971788 241 dbSNP
rs977226864 243 dbSNP
rs1457270312 247 dbSNP
rs760949840 248 dbSNP
rs1174111829 249 dbSNP
rs976661895 254 dbSNP
rs1425608583 255 dbSNP
rs921979884 256 dbSNP
rs763611457 257 dbSNP
rs1192058891 259 dbSNP
rs1479116965 263 dbSNP
rs932070929 265 dbSNP
rs1275592032 267 dbSNP
rs1043726765 268 dbSNP
rs903891250 271 dbSNP
rs935916185 273 dbSNP
rs1270579920 275 dbSNP
rs967968417 276 dbSNP
rs1053004460 277 dbSNP
rs891717407 278 dbSNP
rs376127098 281 dbSNP
rs751432485 286 dbSNP
rs552496312 287 dbSNP
rs926214197 292 dbSNP
rs1201632914 294 dbSNP
rs905603183 295 dbSNP
rs1477889206 298 dbSNP
rs1001266863 307 dbSNP
rs1172685769 308 dbSNP
rs1334697425 309 dbSNP
rs1027267961 310 dbSNP
rs757252936 311 dbSNP
rs983525123 312 dbSNP
rs1395122620 313 dbSNP
rs1168121624 315 dbSNP
rs1036506192 316 dbSNP
rs780953176 317 dbSNP
rs1249964494 318 dbSNP
rs897551832 319 dbSNP
rs1325407277 320 dbSNP
rs966706676 322 dbSNP
rs1329182737 323 dbSNP
rs1048893347 325 dbSNP
rs778601930 325 dbSNP
rs1228681301 328 dbSNP
rs1343755409 329 dbSNP
rs1007472872 331 dbSNP
rs1298647959 331 dbSNP
rs1379846617 332 dbSNP
rs1018302795 333 dbSNP
rs901150916 341 dbSNP
rs566019667 342 dbSNP
rs998173162 343 dbSNP
rs1392142903 344 dbSNP
rs1162803191 346 dbSNP
rs1250888795 347 dbSNP
rs922117445 348 dbSNP
rs1415171473 349 dbSNP
rs1212195754 350 dbSNP
rs1482318698 351 dbSNP
rs534923263 352 dbSNP
rs1251530451 370 dbSNP
rs554218271 372 dbSNP
rs1483817167 373 dbSNP
rs1468339665 379 dbSNP
rs755890707 380 dbSNP
rs747766733 381 dbSNP
rs574393322 384 dbSNP
rs1451001938 386 dbSNP
rs1186271708 387 dbSNP
rs958982236 388 dbSNP
rs979553696 393 dbSNP
rs925363700 396 dbSNP
rs992139084 402 dbSNP
rs1411385716 407 dbSNP
rs1372665410 408 dbSNP
rs1291943984 410 dbSNP
rs916947757 411 dbSNP
rs779145453 414 dbSNP
rs935314452 416 dbSNP
rs1052877452 424 dbSNP
rs138698752 425 dbSNP
rs1023588854 428 dbSNP
rs1388437735 429 dbSNP
rs1208804847 430 dbSNP
rs191905624 432 dbSNP
rs577021246 434 dbSNP
rs1048957319 435 dbSNP
rs888936381 441 dbSNP
rs950034052 442 dbSNP
rs1045530359 444 dbSNP
rs546031038 447 dbSNP
rs943288640 449 dbSNP
rs905738182 453 dbSNP
rs1001235830 454 dbSNP
rs369405233 458 dbSNP
rs887533047 459 dbSNP
rs1020243727 463 dbSNP
rs903317145 467 dbSNP
rs1004523056 469 dbSNP
rs1455677929 471 dbSNP
rs1015021557 472 dbSNP
rs1033170030 473 dbSNP
rs1160486175 475 dbSNP
rs966300999 481 dbSNP
rs772691050 482 dbSNP
rs1376267444 487 dbSNP
rs573154061 493 dbSNP
rs1268968124 494 dbSNP
rs1186149206 496 dbSNP
rs542140638 497 dbSNP
rs991651480 500 dbSNP
rs1209889651 502 dbSNP
rs1210506566 504 dbSNP
rs1024993543 505 dbSNP
rs971640913 508 dbSNP
rs561900730 520 dbSNP
rs1184456390 521 dbSNP
rs1305845337 529 dbSNP
rs530968333 530 dbSNP
rs10714927 533 dbSNP
rs1364467689 533 dbSNP
rs979604454 534 dbSNP
rs1188941792 542 dbSNP
rs1384395221 546 dbSNP
rs1466829022 547 dbSNP
rs925329090 547 dbSNP
rs930407076 549 dbSNP
rs1166254377 550 dbSNP
rs984518289 555 dbSNP
rs910279199 556 dbSNP
rs544356830 558 dbSNP
rs988142823 559 dbSNP
rs1390615337 563 dbSNP
rs943209662 565 dbSNP
rs917941981 566 dbSNP
rs923182858 567 dbSNP
rs949988480 574 dbSNP
rs142847928 579 dbSNP
rs1341603023 586 dbSNP
rs532335843 586 dbSNP
rs1403136434 588 dbSNP
rs114852016 589 dbSNP
rs565881423 590 dbSNP
rs770257652 593 dbSNP
rs903179485 594 dbSNP
rs1334019511 600 dbSNP
rs1000260687 601 dbSNP
rs528364464 602 dbSNP
rs1229587267 614 dbSNP
rs548477386 615 dbSNP
rs1367837539 616 dbSNP
rs1290728331 620 dbSNP
rs567943352 621 dbSNP
rs1048894473 624 dbSNP
rs1013511189 633 dbSNP
rs1215469576 633 dbSNP
rs778061674 633 dbSNP
rs887510575 635 dbSNP
rs1259787893 642 dbSNP
rs1483339626 645 dbSNP
rs537098686 646 dbSNP
rs1036014279 647 dbSNP
rs1197638343 648 dbSNP
rs901546873 650 dbSNP
rs993749534 651 dbSNP
rs1389473293 655 dbSNP
rs1485042142 656 dbSNP
rs1246145158 657 dbSNP
rs1026007427 666 dbSNP
rs12671303 670 dbSNP
rs879826662 671 dbSNP
rs1286817785 675 dbSNP
rs1409558254 676 dbSNP
rs1370811084 677 dbSNP
rs1330409750 681 dbSNP
rs556773911 686 dbSNP
rs1389386366 692 dbSNP
rs1029216037 700 dbSNP
rs1182873473 701 dbSNP
rs1414035836 705 dbSNP
rs1476127367 710 dbSNP
rs1409607131 711 dbSNP
rs1181209580 713 dbSNP
rs146094890 714 dbSNP
rs1158025230 715 dbSNP
rs1252817718 719 dbSNP
rs1206884318 721 dbSNP
rs1377971424 722 dbSNP
rs747502968 726 dbSNP
rs1301283306 729 dbSNP
rs1211003577 736 dbSNP
rs528358447 746 dbSNP
rs1410460484 747 dbSNP
rs1228180633 748 dbSNP
rs1310419551 750 dbSNP
rs766422603 751 dbSNP
rs1330056652 756 dbSNP
rs1001013017 757 dbSNP
rs1323677302 758 dbSNP
rs771612234 767 dbSNP
rs796302928 768 dbSNP
rs1032537741 775 dbSNP
rs577929484 779 dbSNP
rs964452780 780 dbSNP
rs976358869 788 dbSNP
rs923123481 789 dbSNP
rs1314305413 790 dbSNP
rs537523946 793 dbSNP
rs1194363397 797 dbSNP
rs1024971526 800 dbSNP
rs971095235 801 dbSNP
rs1208650733 802 dbSNP
rs980745441 804 dbSNP
rs1205206827 806 dbSNP
rs1253898552 809 dbSNP
rs1479587264 813 dbSNP
rs927181865 816 dbSNP
rs925178821 818 dbSNP
rs754134167 819 dbSNP
rs1434677010 820 dbSNP
rs140001708 825 dbSNP
rs1275012719 826 dbSNP
rs979008690 830 dbSNP
rs894568924 832 dbSNP
rs1430521548 833 dbSNP
rs909066501 836 dbSNP
rs1013002551 837 dbSNP
rs1170513835 838 dbSNP
rs1346786947 840 dbSNP
rs1336070262 841 dbSNP
rs1046347367 845 dbSNP
rs907349214 846 dbSNP
rs1424739714 850 dbSNP
rs940443150 852 dbSNP
rs994046011 853 dbSNP
rs776029527 854 dbSNP
rs901602019 857 dbSNP
rs373339790 858 dbSNP
rs573118960 859 dbSNP
rs1208475556 861 dbSNP
rs1050106961 868 dbSNP
rs117730393 869 dbSNP
rs1300807457 874 dbSNP
rs1339515777 876 dbSNP
rs1296184494 878 dbSNP
rs1001148255 884 dbSNP
rs376966808 885 dbSNP
rs1300951209 886 dbSNP
rs556052802 887 dbSNP
rs567840641 888 dbSNP
rs1447022221 890 dbSNP
rs764481404 892 dbSNP
rs1305257085 893 dbSNP
rs116976138 894 dbSNP
rs1265901520 895 dbSNP
rs970848146 899 dbSNP
rs748568283 901 dbSNP
rs1489344306 902 dbSNP
rs1429134738 903 dbSNP
rs1422271319 904 dbSNP
rs1191475234 909 dbSNP
rs3735656 911 dbSNP
rs1033664792 913 dbSNP
rs1258628639 915 dbSNP
rs1190719203 918 dbSNP
rs564480799 931 dbSNP
rs966588526 932 dbSNP
rs1273405404 938 dbSNP
rs1204625514 940 dbSNP
rs1308680546 943 dbSNP
rs762518594 946 dbSNP
rs1417542258 954 dbSNP
rs1310570242 962 dbSNP
rs984705516 964 dbSNP
rs112812160 967 dbSNP
rs977868045 968 dbSNP
rs940486380 974 dbSNP
rs1407725984 975 dbSNP
rs1368960727 977 dbSNP
rs1307578063 980 dbSNP
rs971936851 981 dbSNP
rs922991414 985 dbSNP
rs1325587839 986 dbSNP
rs143615402 991 dbSNP
rs1435453841 992 dbSNP
rs1471782221 997 dbSNP
rs1050077008 1001 dbSNP
rs1359274271 1004 dbSNP
rs1177422919 1005 dbSNP
rs1213411639 1008 dbSNP
rs888820059 1026 dbSNP
rs559553950 1031 dbSNP
rs1220800903 1032 dbSNP
rs773910538 1033 dbSNP
rs1054405520 1035 dbSNP
rs892725095 1037 dbSNP
rs1349645580 1038 dbSNP
rs1010118134 1052 dbSNP
rs948839351 1053 dbSNP
rs1375667441 1054 dbSNP
rs1272362727 1055 dbSNP
rs528327413 1060 dbSNP
rs907250788 1062 dbSNP
rs1395874284 1065 dbSNP
rs548186949 1074 dbSNP
rs568385725 1076 dbSNP
rs1047887077 1078 dbSNP
rs1159450074 1079 dbSNP
rs150895606 1080 dbSNP
rs375933520 1084 dbSNP
rs1264783991 1096 dbSNP
rs1033632235 1097 dbSNP
rs888067818 1100 dbSNP
rs1254881857 1101 dbSNP
rs1164834254 1102 dbSNP
rs1389916620 1104 dbSNP
rs1328275790 1110 dbSNP
rs115035215 1112 dbSNP
rs1319888121 1113 dbSNP
rs761718659 1117 dbSNP
rs111601093 1118 dbSNP
rs997567565 1134 dbSNP
rs966830566 1140 dbSNP
rs1433503543 1145 dbSNP
rs977900490 1146 dbSNP
rs535212367 1150 dbSNP
rs1455628555 1151 dbSNP
rs957983673 1152 dbSNP
rs570135771 1155 dbSNP
rs1174905803 1157 dbSNP
rs183229226 1163 dbSNP
rs1231449004 1169 dbSNP
rs1396338780 1186 dbSNP
rs972291006 1193 dbSNP
rs923161157 1197 dbSNP
rs1464410758 1202 dbSNP
rs1262281625 1204 dbSNP
rs552685747 1205 dbSNP
rs1482115437 1206 dbSNP
rs985920111 1207 dbSNP
rs910308363 1208 dbSNP
rs936286082 1210 dbSNP
rs566701030 1211 dbSNP
rs928738762 1213 dbSNP
rs988778106 1214 dbSNP
rs370456550 1215 dbSNP
rs929373034 1217 dbSNP
rs911941007 1219 dbSNP
rs374061657 1221 dbSNP
rs887932291 1224 dbSNP
rs1211055713 1231 dbSNP
rs1376853051 1232 dbSNP
rs942284880 1235 dbSNP
rs945671929 1240 dbSNP
rs1484726684 1248 dbSNP
rs1195234885 1249 dbSNP
rs1187887862 1254 dbSNP
rs575853503 1255 dbSNP
rs767691957 1258 dbSNP
rs1157144784 1261 dbSNP
rs997201464 1262 dbSNP
rs1030374092 1265 dbSNP
rs538157453 1266 dbSNP
rs750499437 1267 dbSNP
rs1055100550 1268 dbSNP
rs888544434 1270 dbSNP
rs1376809153 1271 dbSNP
rs1305724344 1272 dbSNP
rs1356990311 1272 dbSNP
rs1408932330 1273 dbSNP
rs1005942291 1284 dbSNP
rs1169629427 1285 dbSNP
rs756311585 1289 dbSNP
rs1023558093 1291 dbSNP
rs971010799 1292 dbSNP
rs1312202850 1293 dbSNP
rs1259885621 1297 dbSNP
rs1350987871 1298 dbSNP
rs1180267753 1299 dbSNP
rs1197587087 1301 dbSNP
rs189233879 1301 dbSNP
rs1354889317 1303 dbSNP
rs1273040217 1306 dbSNP
rs962259352 1308 dbSNP
rs993464434 1311 dbSNP
rs1030169247 1312 dbSNP
rs928617814 1316 dbSNP
rs950805708 1323 dbSNP
rs954490024 1325 dbSNP
rs1286134663 1328 dbSNP
rs578080312 1332 dbSNP
rs377278610 1333 dbSNP
rs139402822 1338 dbSNP
rs1384521589 1345 dbSNP
rs560617133 1349 dbSNP
rs957827752 1355 dbSNP
rs989530270 1358 dbSNP
rs1165482308 1359 dbSNP
rs766092208 1365 dbSNP
rs913596378 1366 dbSNP
rs922213580 1369 dbSNP
rs933568597 1370 dbSNP
rs1469844136 1373 dbSNP
rs1233617060 1374 dbSNP
rs1184092895 1375 dbSNP
rs1051475922 1376 dbSNP
rs902176985 1379 dbSNP
rs111764525 1390 dbSNP
rs1345828965 1394 dbSNP
rs1210206577 1395 dbSNP
rs1350975998 1399 dbSNP
rs1280871554 1403 dbSNP
rs1230448360 1404 dbSNP
rs1046682942 1409 dbSNP
rs1326548302 1410 dbSNP
rs1253198444 1412 dbSNP
rs893520626 1414 dbSNP
rs538214080 1419 dbSNP
rs190852165 1420 dbSNP
rs1408989968 1422 dbSNP
rs1160507333 1428 dbSNP
rs764119857 1443 dbSNP
rs1394535349 1444 dbSNP
rs777974625 1447 dbSNP
rs1470246594 1448 dbSNP
rs970702676 1449 dbSNP
rs1215541025 1454 dbSNP
rs541970164 1458 dbSNP
rs561740066 1464 dbSNP
rs530805753 1466 dbSNP
rs1005665038 1467 dbSNP
rs1184691945 1472 dbSNP
rs983421909 1475 dbSNP
rs754873584 1476 dbSNP
rs963420240 1480 dbSNP
rs1346731893 1481 dbSNP
rs1326758782 1483 dbSNP
rs1320588784 1486 dbSNP
rs974980379 1493 dbSNP
rs922087401 1500 dbSNP
rs117548665 1501 dbSNP
rs1455602004 1505 dbSNP
rs10226620 1507 dbSNP
rs532794089 1508 dbSNP
rs182310645 1512 dbSNP
rs1233816114 1513 dbSNP
rs890389679 1515 dbSNP
rs935003823 1516 dbSNP
rs1341557039 1518 dbSNP
rs1280525977 1519 dbSNP
rs186576927 1520 dbSNP
rs1339438604 1522 dbSNP
rs893596249 1523 dbSNP
rs1215067173 1525 dbSNP
rs1017470300 1526 dbSNP
rs535206487 1532 dbSNP
rs1355078988 1536 dbSNP
rs1313645743 1538 dbSNP
rs958014495 1540 dbSNP
rs1436740610 1542 dbSNP
rs544988060 1545 dbSNP
rs747946345 1549 dbSNP
rs989279339 1551 dbSNP
rs1021036557 1557 dbSNP
rs906339638 1572 dbSNP
rs150069281 1573 dbSNP
rs569370389 1574 dbSNP
rs1257870511 1580 dbSNP
rs1189606795 1588 dbSNP
rs1479400148 1589 dbSNP
rs113587702 1599 dbSNP
rs928197319 1601 dbSNP
rs1309211302 1613 dbSNP
rs1271133893 1617 dbSNP
rs1232464436 1618 dbSNP
rs938289584 1624 dbSNP
rs1294202106 1625 dbSNP
rs1004889926 1628 dbSNP
rs1371401132 1631 dbSNP
rs1297699870 1637 dbSNP
rs1442944791 1639 dbSNP
rs990936134 1650 dbSNP
rs1163388726 1653 dbSNP
rs1461311864 1659 dbSNP
rs1418990649 1662 dbSNP
rs746504491 1664 dbSNP
rs1416962744 1666 dbSNP
rs910089612 1673 dbSNP
rs1405766380 1674 dbSNP
rs867292875 1677 dbSNP
rs558520116 1684 dbSNP
rs1481293764 1685 dbSNP
rs770381969 1688 dbSNP
rs1212982395 1693 dbSNP
rs975221227 1694 dbSNP
rs1236569214 1706 dbSNP
rs1315358671 1710 dbSNP
rs1306492437 1718 dbSNP
rs1224464386 1720 dbSNP
rs941442613 1723 dbSNP
rs1037081013 1724 dbSNP
rs1440790597 1727 dbSNP
rs1440530169 1729 dbSNP
rs1328381935 1732 dbSNP
rs1298592137 1736 dbSNP
rs1362874382 1737 dbSNP
rs897241968 1742 dbSNP
rs578054092 1744 dbSNP
rs534228297 1750 dbSNP
rs1192979976 1753 dbSNP
rs987620812 1760 dbSNP
rs776152453 1761 dbSNP
rs1270159906 1776 dbSNP
rs560256315 1777 dbSNP
rs1007508825 1783 dbSNP
rs574034027 1785 dbSNP
rs542779508 1786 dbSNP
rs1356009589 1787 dbSNP
rs145347546 1791 dbSNP
rs575384797 1792 dbSNP
rs368835704 1818 dbSNP
rs1020667353 1825 dbSNP
rs1261917592 1826 dbSNP
rs544081901 1830 dbSNP
rs966881315 1832 dbSNP
rs1190339045 1840 dbSNP
rs981725934 1846 dbSNP
rs1371980117 1848 dbSNP
rs1373204138 1850 dbSNP
rs191164663 1850 dbSNP
rs1172485417 1852 dbSNP
rs939191459 1858 dbSNP
rs1167005998 1860 dbSNP
rs138130049 1862 dbSNP
rs776496247 1862 dbSNP
rs1190933723 1869 dbSNP
rs959608750 1872 dbSNP
rs1427748422 1873 dbSNP
rs887065646 1876 dbSNP
rs991073532 1877 dbSNP
rs750094942 1878 dbSNP
rs1321473640 1887 dbSNP
rs371792473 1892 dbSNP
rs1016304880 1903 dbSNP
rs746378437 1904 dbSNP
rs941506209 1906 dbSNP
rs973326092 1910 dbSNP
rs1225831975 1911 dbSNP
rs1029496906 1914 dbSNP
rs918653801 1916 dbSNP
rs1296763211 1933 dbSNP
rs934086399 1937 dbSNP
rs371602175 1939 dbSNP
rs560858322 1942 dbSNP
rs1031119850 1945 dbSNP
rs1166139431 1955 dbSNP
rs1434873525 1955 dbSNP
rs747570386 1955 dbSNP
rs889825251 1956 dbSNP
rs1291959326 1960 dbSNP
rs142578618 1962 dbSNP
rs559895233 1963 dbSNP
rs1038928861 1964 dbSNP
rs1260971659 1974 dbSNP
rs1187489262 1979 dbSNP
rs893721219 1985 dbSNP
rs1258320121 1988 dbSNP
rs915469305 1991 dbSNP
rs144263130 1992 dbSNP
rs980430161 1999 dbSNP
rs1485705478 2000 dbSNP
rs1292341827 2002 dbSNP
rs1189999293 2005 dbSNP
rs147798572 2009 dbSNP
rs939113466 2011 dbSNP
rs902248149 2012 dbSNP
rs886929884 2024 dbSNP
rs941283785 2026 dbSNP
rs1003280890 2031 dbSNP
rs1416853730 2032 dbSNP
rs1164538189 2034 dbSNP
rs1475668966 2035 dbSNP
rs1370373437 2041 dbSNP
rs1234611219 2045 dbSNP
rs1034647763 2047 dbSNP
rs569416337 2048 dbSNP
rs958994283 2055 dbSNP
rs879650991 2056 dbSNP
rs1011877743 2057 dbSNP
rs796713524 2059 dbSNP
rs996580888 2067 dbSNP
rs1403069789 2068 dbSNP
rs367917142 2069 dbSNP
rs1028991082 2071 dbSNP
rs890568480 2073 dbSNP
rs762124325 2074 dbSNP
rs1335826404 2079 dbSNP
rs10276767 2081 dbSNP
rs918776611 2082 dbSNP
rs1309660308 2083 dbSNP
rs955431584 2090 dbSNP
rs1315503110 2091 dbSNP
rs986921318 2093 dbSNP
rs1259723154 2097 dbSNP
rs1347979791 2098 dbSNP
rs911312111 2108 dbSNP
rs956887391 2115 dbSNP
rs767757142 2116 dbSNP
rs942642757 2121 dbSNP
rs1011001483 2122 dbSNP
rs1252847607 2123 dbSNP
rs1255346579 2127 dbSNP
rs1054876565 2128 dbSNP
rs1485330840 2128 dbSNP
rs915145535 2131 dbSNP
rs1204154747 2136 dbSNP
rs946654878 2138 dbSNP
rs1310840590 2144 dbSNP
rs1231381511 2145 dbSNP
rs1370159103 2149 dbSNP
rs1042215603 2160 dbSNP
rs1482311682 2169 dbSNP
rs1438434051 2180 dbSNP
rs902394968 2184 dbSNP
rs1003336351 2185 dbSNP
rs1022978396 2188 dbSNP
rs11544235 2191 dbSNP
rs1316566292 2196 dbSNP
rs768347471 2197 dbSNP
rs1056109943 2198 dbSNP
rs894912680 2203 dbSNP
rs141094326 2204 dbSNP
rs1417066094 2209 dbSNP
rs1017034429 2212 dbSNP
rs962977949 2213 dbSNP
rs571930804 2215 dbSNP
rs534501089 2221 dbSNP
rs554183174 2227 dbSNP
rs761262669 2228 dbSNP
rs534494825 2231 dbSNP
rs1447250319 2234 dbSNP
rs1374898301 2236 dbSNP
rs184925068 2237 dbSNP
rs1208114751 2238 dbSNP
rs1300404969 2238 dbSNP
rs1346520955 2243 dbSNP
rs1038168667 2244 dbSNP
rs911279517 2260 dbSNP
rs1220855724 2261 dbSNP
rs932575345 2263 dbSNP
rs536735429 2264 dbSNP
rs1050884751 2269 dbSNP
rs1431110153 2276 dbSNP
rs766948264 2280 dbSNP
rs556411500 2284 dbSNP
rs890442865 2291 dbSNP
rs1236010041 2293 dbSNP
rs914591462 2294 dbSNP
rs1177483906 2296 dbSNP
rs1346512853 2298 dbSNP
rs1205200169 2315 dbSNP
rs143452198 2320 dbSNP
rs544041187 2321 dbSNP
rs1052485327 2325 dbSNP
rs1253374772 2327 dbSNP
rs892518020 2329 dbSNP
rs1485088756 2330 dbSNP
rs1011032680 2331 dbSNP
rs1022460054 2337 dbSNP
rs557539077 2338 dbSNP
rs1215005545 2340 dbSNP
rs1252864662 2341 dbSNP
rs1042661576 2351 dbSNP
rs970079019 2357 dbSNP
rs923869466 2358 dbSNP
rs939160175 2359 dbSNP
rs56780119 2363 dbSNP
rs894878128 2366 dbSNP
rs1490256802 2368 dbSNP
rs947822388 2369 dbSNP
rs1038031315 2373 dbSNP
rs982418089 2376 dbSNP
rs1163168245 2378 dbSNP
rs1474694783 2384 dbSNP
rs898192749 2386 dbSNP
rs1189644618 2387 dbSNP
rs993850692 2394 dbSNP
rs1026280960 2395 dbSNP
rs1479365011 2399 dbSNP
rs891397360 2405 dbSNP
rs540158147 2406 dbSNP
rs560057809 2410 dbSNP
rs1008375736 2413 dbSNP
rs974345240 2416 dbSNP
rs1271060332 2417 dbSNP
rs1018483897 2422 dbSNP
rs1051038467 2426 dbSNP
rs964116991 2429 dbSNP
rs527779220 2430 dbSNP
rs1448200324 2434 dbSNP
rs1324307896 2435 dbSNP
rs944716548 2435 dbSNP
rs1397102458 2436 dbSNP
rs766179267 2437 dbSNP
rs1427375652 2438 dbSNP
rs528913173 2442 dbSNP
rs1300786191 2443 dbSNP
rs1406578322 2444 dbSNP
rs1178662809 2445 dbSNP
rs1441499246 2446 dbSNP
rs542683052 2457 dbSNP
rs1044517 2458 dbSNP
rs542819255 2464 dbSNP
rs923838333 2465 dbSNP
rs1224025534 2476 dbSNP
rs758659499 2481 dbSNP
rs905343252 2486 dbSNP
rs1240881998 2493 dbSNP
rs1379781202 2494 dbSNP
rs1273657660 2503 dbSNP
rs1440719569 2515 dbSNP
rs1368708877 2518 dbSNP
rs991938330 2526 dbSNP
rs1002762172 2535 dbSNP
rs1212070180 2541 dbSNP
rs1451203631 2546 dbSNP
rs116258531 2551 dbSNP
rs551960123 2552 dbSNP
rs1038486256 2553 dbSNP
rs764374615 2562 dbSNP
rs1428483912 2563 dbSNP
rs751855463 2565 dbSNP
rs1420542916 2566 dbSNP
rs1046781992 2567 dbSNP
rs962480073 2568 dbSNP
rs147989683 2569 dbSNP
rs1278865975 2575 dbSNP
rs1028466448 2576 dbSNP
rs757357421 2578 dbSNP
rs527958861 2579 dbSNP
rs55961916 2583 dbSNP
rs548143137 2585 dbSNP
rs899961470 2586 dbSNP
rs1011757057 2587 dbSNP
rs1373060888 2588 dbSNP
rs1172424918 2589 dbSNP
rs781140274 2590 dbSNP
rs1044528 2591 dbSNP
rs1379233982 2591 dbSNP
rs1168081045 2592 dbSNP
rs1044529 2594 dbSNP
rs746381685 2596 dbSNP
rs977809490 2597 dbSNP
rs1489339630 2599 dbSNP
rs1035680221 2602 dbSNP
rs960602316 2608 dbSNP
rs532461313 2609 dbSNP
rs1044533 2612 dbSNP
rs556609445 2613 dbSNP
rs1317676761 2617 dbSNP
rs1043837120 2619 dbSNP
rs1353140433 2620 dbSNP
rs1332940308 2622 dbSNP
rs570011761 2623 dbSNP
rs11544234 2628 dbSNP
rs916499334 2631 dbSNP
rs938203533 2631 dbSNP
rs1404340858 2640 dbSNP
rs1240498518 2650 dbSNP
rs1485576512 2652 dbSNP
rs1189281815 2654 dbSNP
rs947845324 2656 dbSNP
rs1057028815 2657 dbSNP
rs3177192 2659 dbSNP
rs3180965 2668 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   || ||||||||| 
Target 5' uuauuuauuUUUUGUGCUGCUu 3'
11 - 32
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   || ||||||||| 
Target 5' uuauuuauuUUUUGUGCUGCUu 3'
11 - 32
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000343242.4 | 3UTR | UUCCAUUUCAUUAUUUAUUUUUUGUGCUGCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000343242.4 | 3UTR | UUCCAUUUCAUUAUUUAUUUUUUGUGCUGCUUUUUAUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.559 5.2e-3 -0.722 1.6e-4 20 Click to see details
GSE21032 Prostate cancer -0.178 5.4e-2 -0.163 7.0e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.322 5.8e-2 -0.139 2.5e-1 25 Click to see details
GSE38226 Liver fibrosis -0.294 9.8e-2 -0.113 3.1e-1 21 Click to see details
GSE32688 Pancreatic cancer -0.192 1.5e-1 -0.070 3.5e-1 32 Click to see details
GSE28544 Breast cancer -0.194 1.8e-1 -0.507 5.7e-3 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.178 2.0e-1 -0.149 2.4e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.242 2.2e-1 -0.070 4.1e-1 12 Click to see details
GSE27834 Pluripotent stem cells 0.158 2.8e-1 0.097 3.6e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.106 3.1e-1 -0.103 3.1e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.057 3.3e-1 -0.056 3.3e-1 64 Click to see details
GSE19536 Breast cancer -0.043 3.4e-1 -0.094 1.8e-1 100 Click to see details
GSE17498 Multiple myeloma -0.069 3.4e-1 0.022 4.5e-1 40 Click to see details
GSE19783 ER- ER- breast cancer 0.039 3.7e-1 -0.028 4.0e-1 79 Click to see details
GSE28260 Renal cortex and medulla -0.074 4.1e-1 -0.159 3.0e-1 13 Click to see details
GSE21849 B cell lymphoma 0.045 4.1e-1 0.368 2.5e-2 29 Click to see details
GSE14794 Lymphoblastoid cells 0.015 4.4e-1 -0.032 3.8e-1 90 Click to see details
GSE19783 ER+ ER+ breast cancer 0.02 4.7e-1 -0.116 3.1e-1 20 Click to see details
GSE17306 Multiple myeloma -0.011 4.7e-1 -0.068 3.2e-1 49 Click to see details
GSE17306 Multiple myeloma -0.011 4.7e-1 -0.068 3.2e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.358 0.02 -0.379 0.02 32 Click to see details
HNSC 0.312 0.02 0.309 0.02 42 Click to see details
PCPG 0.964 0.09 1.000 0.5 3 Click to see details
COAD 0.526 0.09 0.714 0.02 8 Click to see details
KIRC -0.158 0.1 -0.138 0.13 68 Click to see details
CHOL 0.434 0.12 0.200 0.3 9 Click to see details
KIRP -0.202 0.13 -0.240 0.09 32 Click to see details
KICH 0.222 0.14 0.144 0.25 25 Click to see details
UCEC -0.233 0.17 -0.154 0.26 19 Click to see details
BLCA 0.218 0.19 0.187 0.23 18 Click to see details
CESC -0.798 0.21 -0.500 0.33 3 Click to see details
ESCA 0.243 0.24 0.245 0.23 11 Click to see details
LUSC -0.113 0.25 -0.194 0.12 38 Click to see details
PRAD -0.069 0.32 0.011 0.47 50 Click to see details
BRCA -0.024 0.41 -0.001 0.5 84 Click to see details
PAAD -0.124 0.44 0.400 0.3 4 Click to see details
LUAD 0.04 0.45 0.049 0.44 12 Click to see details
LIHC 0.017 0.45 -0.047 0.37 49 Click to see details
THCA -0.002 0.49 0.037 0.39 59 Click to see details
THCA -0.002 0.49 0.037 0.39 59 Click to see details
THCA -0.002 0.49 0.037 0.39 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16