miRTarBase - #MIRT104015 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol USP42   
Synonyms -
Description ubiquitin specific peptidase 42
Transcript NM_032172   
Expression
Putative miRNA Targets on USP42
3'UTR of USP42
(miRNA target sites are highlighted)
>USP42|NM_032172|3'UTR
   1 AAACTCAGCCTCAAAACAAAAAATTCACTAGTTATGATTCAACGCGTTCAACAGAAGCCATCCCCAGCCCAGCTTAAATT
  81 ATAAAGATAGACAATAACTCTGTTCCAATCTGCGTGGTGCTTCTTTAGTAAATACTGTACAGATTTTACCATGGAGAACT
 161 TTTTTTTTAGTTTTTACCTTTTCTTAATTACCCTTATTCCGAATGGACGAACACTTTCTACCACTGCTGACCATTGTAAA
 241 ATACCGTGTATATAAATCCCATTGAAATAATGCCCTGGAATAGAACATCTCAAATGCTGCTTAATTACAGACTCAGGTCG
 321 ATTACTTGTATTTCATGTAATGTTCCTCCAAGTTAGACATCTGGTGCAAGACCAACCGGGAGACCATGGAATTGTCAAAA
 401 GTACAAACTGACAGTGTGTATATTTAATTTAAAGACTTATTTAAAAACTCACAAGCTCTCACCTAGACTTTGGAGAGCAG
 481 TCTGTTTTCTGTAATGTCTGATACTAGAAACTAATTTGCTTATTTTAGTTGTATTCAAGATTTGAAGATGTATTTTATAG
 561 ACAAGTTCTGTTTTTGAACTTTGTGGAACTGTTCCAATCAATCAATTTCCCAGTTATGATGAGTATTTACATTATGAATG
 641 TATAACCCAGACATGATTTGTAAAGCCGACAGTATGTTTCTATTACACAACACTTTTTGATACAGCGTCTCTTGTCTTCA
 721 CTGATACTGGAGTCTCCGTTGTCTGCTTGGTCCCTTCGAGTTTCTAGTTACAGACACAATCATACTGTGATTTTATTTTT
 801 AATATGGATATGCTATCAAACTGTGATACACTTATAATTCACTGGTCCTGCATCAGGAGATGGAGTGGGGAAAACTGTAT
 881 TTAATACAGTTTGTATCTGAATAATCTGTATGGTTTATACAGTTTGTGTTGTTCAGAGATGTTTAAAGTTTGATCTTTGT
 961 TTTTCTAAAGATTAAAAAAGCACTTGCCCCACTGTAAATATACAGCATGTAAAATTTCTATAGTATATAAATGGCAGCAA
1041 ATCACAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-A-UACACGACGAu 5'
            :|:| ||| | |  ||||||| 
Target 5' aaTAGAACATCTCAAATGCTGCTt 3'
279 - 302 152.00 -11.10
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :| || :|| ||||:||:| 
Target 5' ttTATACAGTT-TGTGTTGTTc 3'
914 - 934 131.00 -10.30
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | ||:|  |: ||| |||| 
Target 5' ttCCAATC--TGCGTGGTGCTt 3'
103 - 122 124.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30106801 18 COSMIC
COSN30648993 24 COSMIC
COSN16934580 27 COSMIC
COSN24695802 90 COSMIC
COSN30741259 100 COSMIC
COSN1351960 132 COSMIC
COSN28765228 169 COSMIC
COSN28650070 178 COSMIC
COSN26530960 203 COSMIC
COSN29321259 913 COSMIC
COSN29316434 921 COSMIC
COSN31489332 1096 COSMIC
COSN31489176 1102 COSMIC
COSN31489362 1162 COSMIC
COSN26640046 1174 COSMIC
COSN5660969 1283 COSMIC
COSN28651268 1312 COSMIC
COSN26552056 1334 COSMIC
COSN31555559 1334 COSMIC
COSN31484775 1376 COSMIC
COSN31488540 1569 COSMIC
COSN26603449 1580 COSMIC
COSN31573157 1831 COSMIC
COSN25231589 1885 COSMIC
COSN31484806 1909 COSMIC
COSN26677921 2056 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748819055 6 dbSNP
rs754526590 8 dbSNP
rs778725705 11 dbSNP
rs747735804 12 dbSNP
rs1369975345 18 dbSNP
rs1447905007 18 dbSNP
rs772024867 22 dbSNP
rs772834644 25 dbSNP
rs746798598 28 dbSNP
rs770838446 29 dbSNP
rs201085042 31 dbSNP
rs1458244037 32 dbSNP
rs988732100 34 dbSNP
rs1208274481 36 dbSNP
rs1471925079 36 dbSNP
rs1489708274 43 dbSNP
rs369863349 45 dbSNP
rs764093779 49 dbSNP
rs749488498 50 dbSNP
rs775587133 50 dbSNP
rs1469630237 51 dbSNP
rs117177787 53 dbSNP
rs1266440417 55 dbSNP
rs943626278 57 dbSNP
rs1392360996 65 dbSNP
rs1303559943 77 dbSNP
rs7783538 79 dbSNP
rs1358590057 90 dbSNP
rs187290777 91 dbSNP
rs1407124241 96 dbSNP
rs549061604 100 dbSNP
rs567063970 101 dbSNP
rs917804558 102 dbSNP
rs1216397933 103 dbSNP
rs929436482 103 dbSNP
rs115618671 109 dbSNP
rs1217990017 112 dbSNP
rs1344844228 113 dbSNP
rs553104752 115 dbSNP
rs879065251 116 dbSNP
rs1273746989 117 dbSNP
rs1230375919 118 dbSNP
rs1332494492 119 dbSNP
rs1036690572 120 dbSNP
rs1399218618 121 dbSNP
rs1301534985 127 dbSNP
rs896863094 129 dbSNP
rs1372741104 130 dbSNP
rs1401333652 133 dbSNP
rs1170915194 135 dbSNP
rs1467610626 136 dbSNP
rs1430309219 158 dbSNP
rs949812441 161 dbSNP
rs371140550 165 dbSNP
rs539509271 165 dbSNP
rs1286073491 167 dbSNP
rs59486546 169 dbSNP
rs999869914 170 dbSNP
rs1346476785 173 dbSNP
rs1217629218 175 dbSNP
rs10246266 178 dbSNP
rs1279868774 179 dbSNP
rs145418957 195 dbSNP
rs1321811771 200 dbSNP
rs1332092921 202 dbSNP
rs575574982 203 dbSNP
rs773675337 204 dbSNP
rs542700070 205 dbSNP
rs1464276747 207 dbSNP
rs1425991415 209 dbSNP
rs1472657060 215 dbSNP
rs1236282886 218 dbSNP
rs1205585269 219 dbSNP
rs1462317754 222 dbSNP
rs1010479727 224 dbSNP
rs1468529888 225 dbSNP
rs763497389 229 dbSNP
rs765670169 231 dbSNP
rs1183529529 239 dbSNP
rs987549056 240 dbSNP
rs1414554119 241 dbSNP
rs766755385 244 dbSNP
rs965031404 245 dbSNP
rs1450137767 246 dbSNP
rs968714456 250 dbSNP
rs1383369457 259 dbSNP
rs1330791917 262 dbSNP
rs973441827 263 dbSNP
rs920822059 264 dbSNP
rs878986736 266 dbSNP
rs1165297255 268 dbSNP
rs1445780280 271 dbSNP
rs546812626 272 dbSNP
rs368815194 277 dbSNP
rs191739123 282 dbSNP
rs573332510 283 dbSNP
rs958838054 289 dbSNP
rs991024048 290 dbSNP
rs949781877 298 dbSNP
rs917767748 303 dbSNP
rs927069489 306 dbSNP
rs949278517 309 dbSNP
rs540730573 313 dbSNP
rs1308405454 323 dbSNP
rs1303958687 324 dbSNP
rs1054145165 326 dbSNP
rs891686437 328 dbSNP
rs972666731 329 dbSNP
rs1244561538 333 dbSNP
rs1010137441 335 dbSNP
rs1325966644 336 dbSNP
rs1343842879 338 dbSNP
rs559560480 339 dbSNP
rs533177313 342 dbSNP
rs551636315 350 dbSNP
rs1435879635 351 dbSNP
rs930936906 355 dbSNP
rs1212083849 364 dbSNP
rs1238011032 369 dbSNP
rs1224499129 371 dbSNP
rs1490446397 372 dbSNP
rs1285296202 376 dbSNP
rs1214351205 380 dbSNP
rs964843263 382 dbSNP
rs1285060334 383 dbSNP
rs1048077619 385 dbSNP
rs1460843906 386 dbSNP
rs1181803458 389 dbSNP
rs889493674 391 dbSNP
rs1296668218 395 dbSNP
rs182471448 397 dbSNP
rs369402298 401 dbSNP
rs540017149 401 dbSNP
rs1346261167 402 dbSNP
rs528450165 403 dbSNP
rs760312724 409 dbSNP
rs1416548680 411 dbSNP
rs759252037 414 dbSNP
rs1201121457 415 dbSNP
rs1480678206 418 dbSNP
rs530519056 419 dbSNP
rs1191166967 420 dbSNP
rs1486819804 422 dbSNP
rs1261193902 426 dbSNP
rs1010426993 428 dbSNP
rs1209553171 431 dbSNP
rs1027685033 432 dbSNP
rs548662206 434 dbSNP
rs566927212 435 dbSNP
rs983744837 436 dbSNP
rs917510815 438 dbSNP
rs534385981 439 dbSNP
rs927008947 440 dbSNP
rs980277592 440 dbSNP
rs763671686 443 dbSNP
rs1000131064 444 dbSNP
rs1403264100 446 dbSNP
rs546308346 447 dbSNP
rs758188911 448 dbSNP
rs767141836 450 dbSNP
rs1422407391 453 dbSNP
rs1168311121 457 dbSNP
rs1430045818 458 dbSNP
rs1859546 464 dbSNP
rs1220705611 465 dbSNP
rs992964629 466 dbSNP
rs538892894 469 dbSNP
rs557631931 470 dbSNP
rs1204335186 474 dbSNP
rs1457512023 476 dbSNP
rs1025209476 485 dbSNP
rs1230138718 490 dbSNP
rs1322710517 494 dbSNP
rs1050930351 495 dbSNP
rs891049215 495 dbSNP
rs114172066 497 dbSNP
rs1465418739 499 dbSNP
rs370606288 500 dbSNP
rs918483917 501 dbSNP
rs931220306 502 dbSNP
rs994966573 505 dbSNP
rs1373424010 510 dbSNP
rs554953244 512 dbSNP
rs142289927 513 dbSNP
rs1192130884 516 dbSNP
rs1386974209 516 dbSNP
rs1184337973 525 dbSNP
rs1457354818 530 dbSNP
rs1236641727 534 dbSNP
rs1429113630 536 dbSNP
rs1481045387 540 dbSNP
rs1265238973 543 dbSNP
rs1219760916 544 dbSNP
rs1362259953 544 dbSNP
rs1468636202 547 dbSNP
rs886675 548 dbSNP
rs942442483 555 dbSNP
rs1375499491 561 dbSNP
rs1040824424 562 dbSNP
rs901337796 563 dbSNP
rs1392774705 564 dbSNP
rs1317070244 565 dbSNP
rs1396711998 567 dbSNP
rs1292760353 570 dbSNP
rs1324297630 572 dbSNP
rs1004896450 575 dbSNP
rs1283613004 581 dbSNP
rs532462789 583 dbSNP
rs1221560921 586 dbSNP
rs1269975821 587 dbSNP
rs367760197 595 dbSNP
rs1266890370 599 dbSNP
rs371139737 600 dbSNP
rs551058924 602 dbSNP
rs1282322001 604 dbSNP
rs1258460911 607 dbSNP
rs904746624 611 dbSNP
rs1336026126 613 dbSNP
rs1222589737 616 dbSNP
rs1300140921 617 dbSNP
rs577888454 624 dbSNP
rs1402938851 625 dbSNP
rs1347160393 626 dbSNP
rs1056193327 628 dbSNP
rs186811376 630 dbSNP
rs544917457 634 dbSNP
rs1268551032 637 dbSNP
rs989953605 638 dbSNP
rs894498930 653 dbSNP
rs1184914206 654 dbSNP
rs945680598 655 dbSNP
rs986448032 661 dbSNP
rs1319320980 670 dbSNP
rs572200118 672 dbSNP
rs74541050 672 dbSNP
rs760491665 672 dbSNP
rs536487611 678 dbSNP
rs1264438135 680 dbSNP
rs1206427246 686 dbSNP
rs1350755079 692 dbSNP
rs1255124561 694 dbSNP
rs1221311434 709 dbSNP
rs1406684907 718 dbSNP
rs1024364657 721 dbSNP
rs962139293 724 dbSNP
rs993961703 734 dbSNP
rs1283708335 737 dbSNP
rs1399119874 749 dbSNP
rs1025489497 753 dbSNP
rs530671281 756 dbSNP
rs542930244 761 dbSNP
rs560517172 762 dbSNP
rs750366607 763 dbSNP
rs1174281029 764 dbSNP
rs1290040102 767 dbSNP
rs528112306 768 dbSNP
rs931143502 773 dbSNP
rs963775594 777 dbSNP
rs546269639 780 dbSNP
rs1474619107 782 dbSNP
rs571058266 784 dbSNP
rs886538009 788 dbSNP
rs922335370 789 dbSNP
rs1358575550 790 dbSNP
rs1246920969 794 dbSNP
rs532727835 798 dbSNP
rs907439651 810 dbSNP
rs1217832713 816 dbSNP
rs550852770 821 dbSNP
rs926160081 824 dbSNP
rs936230280 825 dbSNP
rs1228069210 826 dbSNP
rs1339743723 828 dbSNP
rs1334814874 830 dbSNP
rs1454619614 831 dbSNP
rs1330918891 837 dbSNP
rs1407178922 837 dbSNP
rs1251761821 838 dbSNP
rs1056078034 839 dbSNP
rs1180306827 840 dbSNP
rs990731521 841 dbSNP
rs894730442 845 dbSNP
rs1472772283 846 dbSNP
rs1473512114 849 dbSNP
rs1181255989 865 dbSNP
rs1163710856 867 dbSNP
rs1020003141 868 dbSNP
rs1014230359 870 dbSNP
rs569434808 873 dbSNP
rs377566217 882 dbSNP
rs536513775 883 dbSNP
rs1309621236 890 dbSNP
rs897878167 893 dbSNP
rs555316611 894 dbSNP
rs1025479441 895 dbSNP
rs1390688237 897 dbSNP
rs566854995 909 dbSNP
rs376081299 910 dbSNP
rs1005870125 912 dbSNP
rs1440312722 920 dbSNP
rs534211649 924 dbSNP
rs931134316 925 dbSNP
rs1246758778 927 dbSNP
rs368831707 930 dbSNP
rs559089237 931 dbSNP
rs1047353811 933 dbSNP
rs886501948 934 dbSNP
rs1230974072 935 dbSNP
rs550944641 936 dbSNP
rs1182321366 941 dbSNP
rs940782898 944 dbSNP
rs1339165795 945 dbSNP
rs1045752893 946 dbSNP
rs577228740 947 dbSNP
rs1194545653 948 dbSNP
rs111773054 959 dbSNP
rs56943349 959 dbSNP
rs745603542 959 dbSNP
rs869226982 959 dbSNP
rs1022060938 965 dbSNP
rs1222108254 966 dbSNP
rs1183660508 968 dbSNP
rs386709807 969 dbSNP
rs1180868185 970 dbSNP
rs200284815 970 dbSNP
rs1375845781 971 dbSNP
rs1242066960 974 dbSNP
rs1280334854 974 dbSNP
rs1001942632 976 dbSNP
rs1344017121 981 dbSNP
rs10590782 982 dbSNP
rs867731742 982 dbSNP
rs1425858912 988 dbSNP
rs967095220 995 dbSNP
rs1034573290 997 dbSNP
rs1157771113 999 dbSNP
rs977182333 1012 dbSNP
rs1373382524 1014 dbSNP
rs926110020 1017 dbSNP
rs936152802 1023 dbSNP
rs1266530117 1029 dbSNP
rs1056382902 1030 dbSNP
rs73675859 1033 dbSNP
rs950355870 1034 dbSNP
rs1019327328 1035 dbSNP
rs1045753119 1038 dbSNP
rs1223135130 1041 dbSNP
rs897866783 1045 dbSNP
rs556851328 1050 dbSNP
rs1049203321 1051 dbSNP
rs963714570 1052 dbSNP
rs887872779 1053 dbSNP
rs575412043 1054 dbSNP
rs71531360 1055 dbSNP
rs542500281 1056 dbSNP
rs1225673363 1057 dbSNP
rs1426725580 1061 dbSNP
rs1178376908 1063 dbSNP
rs71531361 1065 dbSNP
rs1258202050 1068 dbSNP
rs750728748 1069 dbSNP
rs982621198 1073 dbSNP
rs560880058 1075 dbSNP
rs528075408 1077 dbSNP
rs372364231 1078 dbSNP
rs940751856 1081 dbSNP
rs191273045 1082 dbSNP
rs928711790 1083 dbSNP
rs998094821 1085 dbSNP
rs1029283601 1087 dbSNP
rs1265197611 1087 dbSNP
rs1224572100 1089 dbSNP
rs1459607257 1098 dbSNP
rs967044487 1105 dbSNP
rs977067947 1106 dbSNP
rs768755241 1107 dbSNP
rs1012276618 1108 dbSNP
rs957348139 1114 dbSNP
rs1466416805 1115 dbSNP
rs1431249487 1116 dbSNP
rs991637488 1119 dbSNP
rs1353709222 1120 dbSNP
rs1041866973 1123 dbSNP
rs903322110 1128 dbSNP
rs1420094036 1131 dbSNP
rs185759664 1141 dbSNP
rs1442832414 1142 dbSNP
rs1204551698 1144 dbSNP
rs1458861511 1144 dbSNP
rs1289571030 1146 dbSNP
rs916098263 1146 dbSNP
rs1361513984 1147 dbSNP
rs950327313 1150 dbSNP
rs1314942965 1152 dbSNP
rs190285232 1154 dbSNP
rs1008360426 1156 dbSNP
rs1379932828 1162 dbSNP
rs981713255 1170 dbSNP
rs1396260281 1172 dbSNP
rs1372097343 1175 dbSNP
rs550670477 1176 dbSNP
rs1463300855 1181 dbSNP
rs1303781626 1182 dbSNP
rs929264686 1184 dbSNP
rs569316048 1189 dbSNP
rs1422599974 1190 dbSNP
rs1049109323 1197 dbSNP
rs1223385877 1198 dbSNP
rs887829715 1201 dbSNP
rs943458470 1203 dbSNP
rs964155318 1204 dbSNP
rs1248653748 1205 dbSNP
rs1418756618 1205 dbSNP
rs530351761 1209 dbSNP
rs1179371149 1212 dbSNP
rs779831321 1213 dbSNP
rs996504861 1217 dbSNP
rs140634673 1218 dbSNP
rs1331889542 1221 dbSNP
rs1027092466 1225 dbSNP
rs567216778 1231 dbSNP
rs1304385369 1239 dbSNP
rs982734994 1239 dbSNP
rs998042467 1242 dbSNP
rs1350890440 1243 dbSNP
rs1485337547 1252 dbSNP
rs746793140 1253 dbSNP
rs1270702422 1262 dbSNP
rs113567702 1263 dbSNP
rs970513722 1266 dbSNP
rs998434637 1271 dbSNP
rs1362341771 1293 dbSNP
rs1161543866 1295 dbSNP
rs1473000913 1296 dbSNP
rs1268640608 1297 dbSNP
rs1427087716 1306 dbSNP
rs981953961 1307 dbSNP
rs776618352 1308 dbSNP
rs1033097611 1309 dbSNP
rs193182710 1312 dbSNP
rs748664352 1315 dbSNP
rs1209965800 1319 dbSNP
rs937452383 1324 dbSNP
rs1344695220 1336 dbSNP
rs1055791520 1337 dbSNP
rs570846912 1345 dbSNP
rs1240761865 1347 dbSNP
rs796342852 1351 dbSNP
rs1329362899 1355 dbSNP
rs537918421 1356 dbSNP
rs1366538335 1368 dbSNP
rs1347376399 1369 dbSNP
rs1324117893 1378 dbSNP
rs145445036 1381 dbSNP
rs947413997 1386 dbSNP
rs1290644095 1390 dbSNP
rs755178406 1391 dbSNP
rs1476988311 1392 dbSNP
rs903460577 1396 dbSNP
rs1481609561 1405 dbSNP
rs781420515 1405 dbSNP
rs1378775890 1412 dbSNP
rs971586033 1416 dbSNP
rs575326198 1419 dbSNP
rs1445720711 1423 dbSNP
rs536091458 1426 dbSNP
rs919486679 1435 dbSNP
rs1224892188 1439 dbSNP
rs1307004887 1440 dbSNP
rs1315825446 1441 dbSNP
rs1201600926 1447 dbSNP
rs1236371168 1449 dbSNP
rs1293454507 1451 dbSNP
rs899565324 1456 dbSNP
rs1221444152 1459 dbSNP
rs1226616583 1463 dbSNP
rs1324562665 1464 dbSNP
rs929548143 1466 dbSNP
rs1435863202 1468 dbSNP
rs1405689769 1469 dbSNP
rs984777110 1470 dbSNP
rs1471198604 1475 dbSNP
rs1266594040 1476 dbSNP
rs1167652712 1478 dbSNP
rs1474732457 1482 dbSNP
rs1026646542 1483 dbSNP
rs997032008 1483 dbSNP
rs1449533829 1487 dbSNP
rs554435551 1488 dbSNP
rs1177729914 1492 dbSNP
rs1443724254 1496 dbSNP
rs572758903 1497 dbSNP
rs1417440615 1498 dbSNP
rs770483825 1498 dbSNP
rs1039554586 1502 dbSNP
rs1229301802 1503 dbSNP
rs1003888833 1504 dbSNP
rs1312930551 1507 dbSNP
rs1454803679 1508 dbSNP
rs923392359 1516 dbSNP
rs1386068112 1520 dbSNP
rs1328653318 1521 dbSNP
rs1015489959 1525 dbSNP
rs540137631 1533 dbSNP
rs970651009 1541 dbSNP
rs933800751 1555 dbSNP
rs780642812 1556 dbSNP
rs564695754 1559 dbSNP
rs981922879 1560 dbSNP
rs1033965389 1562 dbSNP
rs1356645054 1566 dbSNP
rs576785161 1568 dbSNP
rs1253973746 1572 dbSNP
rs1205789054 1573 dbSNP
rs1358582700 1574 dbSNP
rs769840226 1575 dbSNP
rs1230073329 1576 dbSNP
rs1357386109 1577 dbSNP
rs1443488665 1578 dbSNP
rs1298125754 1579 dbSNP
rs1279177840 1583 dbSNP
rs1371932538 1588 dbSNP
rs1440551198 1604 dbSNP
rs1389153954 1608 dbSNP
rs1337909326 1610 dbSNP
rs1364205071 1620 dbSNP
rs185110158 1620 dbSNP
rs914671307 1624 dbSNP
rs749794022 1626 dbSNP
rs1414141924 1627 dbSNP
rs558552064 1628 dbSNP
rs771349535 1631 dbSNP
rs1289256813 1641 dbSNP
rs924850084 1644 dbSNP
rs998761822 1645 dbSNP
rs1054125109 1651 dbSNP
rs111947274 1656 dbSNP
rs557895405 1656 dbSNP
rs576914083 1656 dbSNP
rs753342582 1656 dbSNP
rs892815339 1656 dbSNP
rs1205089652 1658 dbSNP
rs1012654974 1659 dbSNP
rs1222298277 1661 dbSNP
rs1232199653 1662 dbSNP
rs562630718 1662 dbSNP
rs146475124 1663 dbSNP
rs971155476 1667 dbSNP
rs1305474695 1671 dbSNP
rs1438069480 1673 dbSNP
rs573188154 1673 dbSNP
rs1015291884 1679 dbSNP
rs1243891316 1685 dbSNP
rs1398627236 1686 dbSNP
rs759841484 1688 dbSNP
rs1026492467 1692 dbSNP
rs1003501274 1695 dbSNP
rs1422031945 1697 dbSNP
rs1192858614 1701 dbSNP
rs1478284181 1703 dbSNP
rs1241622828 1705 dbSNP
rs1213675270 1709 dbSNP
rs1466449743 1710 dbSNP
rs1410908293 1715 dbSNP
rs1203493833 1716 dbSNP
rs1321847212 1719 dbSNP
rs1303773013 1722 dbSNP
rs866851272 1723 dbSNP
rs1361812344 1728 dbSNP
rs1269119980 1729 dbSNP
rs1432236933 1729 dbSNP
rs556267933 1730 dbSNP
rs959434336 1731 dbSNP
rs766687557 1732 dbSNP
rs1468906755 1733 dbSNP
rs909198728 1735 dbSNP
rs1353258936 1740 dbSNP
rs1177912110 1743 dbSNP
rs1415006527 1744 dbSNP
rs1022105901 1750 dbSNP
rs965103885 1752 dbSNP
rs1184904353 1755 dbSNP
rs1451392035 1755 dbSNP
rs1248950217 1758 dbSNP
rs1471281694 1759 dbSNP
rs1460103497 1761 dbSNP
rs968799683 1768 dbSNP
rs924646783 1769 dbSNP
rs977382055 1769 dbSNP
rs944288727 1771 dbSNP
rs1225633876 1773 dbSNP
rs1366748407 1774 dbSNP
rs754259896 1775 dbSNP
rs1297623965 1776 dbSNP
rs1451494984 1787 dbSNP
rs1382908634 1789 dbSNP
rs1304410018 1795 dbSNP
rs776392661 1799 dbSNP
rs1166635142 1800 dbSNP
rs1431477385 1801 dbSNP
rs1390880297 1803 dbSNP
rs112979258 1805 dbSNP
rs1282103821 1810 dbSNP
rs1443044590 1813 dbSNP
rs1363691504 1819 dbSNP
rs932782370 1820 dbSNP
rs1048573298 1822 dbSNP
rs796654189 1826 dbSNP
rs1305686597 1831 dbSNP
rs939780342 1831 dbSNP
rs1343442469 1833 dbSNP
rs1274779033 1838 dbSNP
rs1036697121 1839 dbSNP
rs1244567050 1839 dbSNP
rs1263769594 1841 dbSNP
rs1314414203 1851 dbSNP
rs906160635 1852 dbSNP
rs1460944982 1854 dbSNP
rs1372348520 1859 dbSNP
rs755248810 1867 dbSNP
rs879158499 1870 dbSNP
rs1003219326 1876 dbSNP
rs560672191 1877 dbSNP
rs1244029041 1881 dbSNP
rs1302684160 1883 dbSNP
rs1475898686 1885 dbSNP
rs1165757585 1887 dbSNP
rs1418667488 1888 dbSNP
rs1406273174 1889 dbSNP
rs1055424304 1891 dbSNP
rs1483693806 1893 dbSNP
rs1186289903 1896 dbSNP
rs895083141 1897 dbSNP
rs923317857 1898 dbSNP
rs77561123 1904 dbSNP
rs1011139697 1909 dbSNP
rs1487218333 1911 dbSNP
rs575739589 1912 dbSNP
rs1266628000 1923 dbSNP
rs527963094 1923 dbSNP
rs1022159552 1925 dbSNP
rs933412525 1927 dbSNP
rs1177820421 1931 dbSNP
rs144857284 1932 dbSNP
rs998933269 1937 dbSNP
rs1331681147 1938 dbSNP
rs761607977 1939 dbSNP
rs1384937833 1941 dbSNP
rs934576745 1944 dbSNP
rs1392983794 1947 dbSNP
rs1294136039 1949 dbSNP
rs570741606 1953 dbSNP
rs1346579751 1954 dbSNP
rs1453354772 1954 dbSNP
rs1386682831 1955 dbSNP
rs1054809274 1958 dbSNP
rs893067342 1959 dbSNP
rs1429291536 1960 dbSNP
rs1197380578 1972 dbSNP
rs538268480 1977 dbSNP
rs1431092056 1980 dbSNP
rs543239860 1982 dbSNP
rs1044070397 1984 dbSNP
rs1209873994 1984 dbSNP
rs1485363757 1988 dbSNP
rs748287245 1988 dbSNP
rs1210429382 1990 dbSNP
rs1282332265 1991 dbSNP
rs906917941 1991 dbSNP
rs1231002040 1998 dbSNP
rs1338159744 1999 dbSNP
rs1225213147 2001 dbSNP
rs1302116180 2002 dbSNP
rs1363367562 2006 dbSNP
rs965317320 2006 dbSNP
rs1322806447 2007 dbSNP
rs1283884570 2008 dbSNP
rs201039148 2008 dbSNP
rs1405829045 2010 dbSNP
rs1002660898 2011 dbSNP
rs1468058992 2012 dbSNP
rs1378687992 2015 dbSNP
rs1199015361 2017 dbSNP
rs1245593895 2017 dbSNP
rs1448344494 2017 dbSNP
rs1322785575 2021 dbSNP
rs550007416 2028 dbSNP
rs1301962167 2029 dbSNP
rs1190124731 2040 dbSNP
rs775160784 2042 dbSNP
rs1201840142 2043 dbSNP
rs1465028335 2043 dbSNP
rs1026484270 2045 dbSNP
rs1262308177 2048 dbSNP
rs950886085 2054 dbSNP
rs749955992 2056 dbSNP
rs976793532 2059 dbSNP
rs1347094957 2063 dbSNP
rs1256498975 2069 dbSNP
rs1447732872 2070 dbSNP
rs1215350166 2072 dbSNP
rs1363125849 2076 dbSNP
rs1299846967 2078 dbSNP
rs1436121150 2079 dbSNP
rs1332655621 2080 dbSNP
rs760295336 2082 dbSNP
rs1016902642 2087 dbSNP
rs1387805029 2088 dbSNP
rs1481642940 2094 dbSNP
rs1169891745 2100 dbSNP
rs138655151 2102 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000306177.5 | 3UTR | AACAUCUCAAAUGCUGCUUAAUUACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.444 2.5e-2 -0.609 2.2e-3 20 Click to see details
GSE28260 Renal cortex and medulla -0.535 3.0e-2 -0.588 1.7e-2 13 Click to see details
GSE21032 Prostate cancer -0.179 5.3e-2 -0.093 2.0e-1 83 Click to see details
GSE21687 Ependynoma primary tumors -0.195 6.1e-2 -0.125 1.6e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.306 7.3e-2 0.342 5.1e-2 24 Click to see details
GSE38226 Liver fibrosis -0.288 1.0e-1 -0.283 1.1e-1 21 Click to see details
GSE28544 Breast cancer -0.263 1.1e-1 -0.710 5.1e-5 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.211 1.9e-1 -0.248 1.5e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.183 2.0e-1 -0.115 3.0e-1 23 Click to see details
GSE19350 CNS germ cell tumors 0.253 2.1e-1 -0.126 3.5e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.128 2.4e-1 0.265 7.1e-2 32 Click to see details
GSE14794 Lymphoblastoid cells -0.069 2.6e-1 -0.031 3.9e-1 90 Click to see details
GSE19536 Breast cancer 0.063 2.7e-1 0.110 1.4e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.115 2.9e-1 -0.061 3.9e-1 25 Click to see details
GSE17306 Multiple myeloma -0.075 3.0e-1 -0.019 4.5e-1 49 Click to see details
GSE19783 ER- ER- breast cancer 0.052 3.2e-1 0.164 7.4e-2 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.084 3.4e-1 0.084 3.4e-1 25 Click to see details
GSE21849 B cell lymphoma 0.036 4.3e-1 0.320 4.5e-2 29 Click to see details
GSE21849 B cell lymphoma 0.036 4.3e-1 0.320 4.5e-2 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.416 0 0.425 0 42 Click to see details
THCA -0.317 0.01 -0.249 0.03 59 Click to see details
BRCA -0.216 0.02 -0.254 0.01 84 Click to see details
PCPG -0.98 0.06 -1.000 0.5 3 Click to see details
LUAD 0.412 0.09 0.462 0.07 12 Click to see details
KIRP -0.24 0.09 -0.287 0.06 32 Click to see details
PRAD 0.168 0.12 0.230 0.05 50 Click to see details
KICH -0.179 0.2 -0.143 0.25 25 Click to see details
ESCA 0.259 0.22 0.227 0.25 11 Click to see details
COAD 0.318 0.22 -0.095 0.41 8 Click to see details
PAAD 0.412 0.29 0.200 0.4 4 Click to see details
BLCA 0.117 0.32 0.042 0.43 18 Click to see details
CHOL -0.167 0.33 0.333 0.19 9 Click to see details
STAD -0.036 0.42 0.018 0.46 32 Click to see details
LIHC 0.026 0.43 0.043 0.38 49 Click to see details
KIRC -0.021 0.43 -0.023 0.43 68 Click to see details
UCEC -0.039 0.44 -0.119 0.31 19 Click to see details
CESC 0.127 0.46 0.500 0.33 3 Click to see details
LUSC -0.014 0.47 -0.017 0.46 38 Click to see details
LUSC -0.014 0.47 -0.017 0.46 38 Click to see details
LUSC -0.014 0.47 -0.017 0.46 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*