miRTarBase - #MIRT112969 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LUZP1   
Synonyms LUZP
Description leucine zipper protein 1
Transcript NM_001142546   
Other Transcripts NM_033631   
Expression
Putative miRNA Targets on LUZP1
3'UTR of LUZP1
(miRNA target sites are highlighted)
>LUZP1|NM_001142546|3'UTR
   1 GCCCGCTGGGTGTCTGTTGTCTGCCCTCTGCTCCTGCTTCTCAGCTCTTCCACCGTCCTGCCCCACGAAGGATCCAAGGC
  81 CAGTTAACCAGGCAAGACACAAGCCTTGGCTGGAAAACTGTGGTAGAGCCGGGCTGTGGCTCAGGTAATTTTTGCCATTT
 161 GGCCAGAGGGAATCAGAGACTACAAGCTGGACAGTCACCCAGGCCCAACCTTCCCCAATGCACGAGTCCTCTCTCTCTCC
 241 TTGTCCCTGTCCACCAAGTAGTTGGACCATTCTGGCCCCCAAACAAGGGAAGATAAAGTCCCCAGCACACAGCAGGAGTC
 321 AAAAATTCTTCTCGGCTCCTTGGTGGGTTGTTTCTGGATCCTAGGGCAGCCTCTGTCTGTGTGGTTAATGTTCTGGTTTC
 401 TCAGTCTCCTCACTATATCCACTTCACTCCTCATTTGCCCAATGGGCTCAAGTACCCCATAAGATTTACCAGCCATCAGC
 481 TCTATCTAGGGGGCTTTCATTTCTTTCCCCTTGGAGTTCTTTTCTTCAGACTTAAAGCAGAAAGGGGTCTGTGCTGCCTC
 561 TAAAGGATTATGAGACTACCCTTTAGGTTGAAGTTTGACCTGGCTCCTGGCTTACCAGTCTCCTGGAAGCAGAGCATGCA
 641 GATACTCATGCGGATACCCATTGGAATGACATCATCCCTCCCCAACCCCAGCTCTCTCTGCTCACCTTCCAAAGGCACCT
 721 GGAGGTGCAAGCCTCATGCATCTCCTTTCCTGAGCACCAGTAATGCTGCTGGCATCGCCTGCTTTCTCTCCAGTGGCTGG
 801 AGACTTCAAGCTGACTTCATTGTTTCCACCTTGGGAAAATCCCTAGGCTAAGCTGGGCCTGACCCAGCATCCTCTGCCTT
 881 CTAGGAAGTGCCCAGCAAGAGGGAAAGCAGACCCCTTTAGTCACTCCACAAGCAATAGCTCCATGAGAGGCATGGACTGT
 961 GAGACTACTCCCTCCTGTTCCTCCTTCTCCATCCCCCATGGAGGAGGCATCGCACTTTACCAAGCTGATGCATTCCTACA
1041 GAAGTGGGCCCCGGATTTCTGCAAGTCGACTATCATGATGACTTCGCTGGAGGAAAGGTGATACGTACATACGCATTGAG
1121 GGCCTCAGCTTTATATAGTTCAAAATGCAGCAAACTTTTCAGAAAGCCACGTAAATAAATTGGTTAGGTTCCTTATACCA
1201 GTCACATGGGGAAGTTGAAAAGAATTGTATATTCTTGGCAGTGCTTTTTCTTTAGCATTCTGTCAATTCAAAGAAGGGAT
1281 CCTCTTTCAAAGGCTACCTTTATGAAGTAGACACTATTGCCCTCAGAATGAGAGAACATTAAACTACCAGTCTGGTAAGC
1361 TGGATTTTTTTCCCCATGGCTTTACTTCCTTGCTGTGTGACCTTGGGTGAGTCATTGTCTTCTTGGAGCCTCAGTTTCCC
1441 TGTCTGTAAAATGAGTTCTTTGAAATGGATGATCTCTAAGGGCACCAAATCTGGTATTCTAAGGTTCTCCTGTTTTCACC
1521 ATCTATAATAGTATGGGATGATTTTTGCTTGTGGAAGGTATCATCCGTGTGGGTTCTTCCCTCCTGCCCTCAATTGTTTT
1601 TCTGGGCCTTGTTTTTTAGTTTCTGTATGTTTTAATCTCATGGGGATGAGCTCAGAGAAGCTCCGTGGGCCTGTTTCCCA
1681 ATCTGCAAAGTGTGAAGGGATTAGATGGGATGGTCTCTGAGGCTCTTTGTGGCATCAGCCTTGCCCAGTGCCACACAGTA
1761 TCTCCTGGCGTTCTAGGAGTCTAGGTATTATGGAAAGTACCCAAGTCTGTGTATCTCCTGTTCCTGTGCATCTCCTATGA
1841 ATTTCCTGGCAAGAGGAAGACTCAAGACTTCCTCCAGAGGAATTTGTCTTCTCTGCCTTCACTCAGCATGGGAACCAGTG
1921 TTCATCCTGACCTTGTCTGTATCAGATTTGGCAGTGAGGAGGCTTGGGGAGCACCTACCTTACTTTCAGGGACAGGAATC
2001 TATTGCTCATACTTCTGCTTCCCAGAGTTTTGCCAATCTAAAGGCATTGTCATGTGGCCTGCCTTTCCTGTCCACATCCC
2081 CACCTCTGATGCTCAAGATGCTATTTCCAAGATCTCTTACTGCTGCTTCTCCTGGCTTACTGGCCAGAAACTAGCTCACT
2161 CAAGGCTGCCATCCTTCACTTGCAGCCTCCCTGCCATTCTCCTTCACTGGTTGGCAACCTTGAGAGTTCAAAGAAAATCA
2241 ACCTCTGTGGTGGTCAACTAAAGGTATTAGGAAACTAAGTCTGTGGCTCTTCTCTGCTGATGGAAACAGAAGGGCGCCAA
2321 GCCATGCCTAAAAAGATCTCGCCAATAATTCTTGTCTTTGAGTGTTGGAGCCCTGGATTCTGGTGCTATAGCTCCTGGTG
2401 CCAAAGTCTGGATCTTTCCACATTTCAGCAGCACCAACATCTGCTGCTACTCAAAATGTCCTGTTGAAGAGGGACAGCTG
2481 TGATGCCCTTTTGCTGGGGCTGCCATCTTGAAATCTGAGTGCAATAGGATTTGCTTGTAACAGTTATTTCAGGATATTTT
2561 GTTTCTTTAATCTGCACACTTTCTAGATAGATTTTATTTTTAAGTGTCCTCAGCATTGCAGAAAATAACATTGTAATAGC
2641 AAGTAAAGGCTGGAGGCTGTTTCTCTGGGCTTCAAATGGCTGGCAAGGCTGGCTCTCAAATCCCAAAGTTGGGAGGCATG
2721 TTTCTGAAAAGCAACTGAGGTGTGACTGTTTGGACCCAGGCCTCATCATCAGGGGTCCTGGAGGAAGCCTCCAAGTAGAG
2801 GGGAGACCTGGTAGTTGAATAGTTGTTTAATCAAGCCAAATAGTCCCACTGCCCCCGGTCAACAAACCCACTTTTATGAC
2881 AGTTTTCTTCCGCAGCTTGGCTCTTAAATTTTACTGGCAGGTGTATGGTTGTTGGAGGGTTCCTAGTGAGTTGGGGGACC
2961 TGGCAATAGAGCTGCTTGGTTGGAGGAAGTGAAGCTGGCTTAGTACCAGCAGCTGATCTCTTCCACGTGCTGCTGCTTTT
3041 TTTGCCACTCTGATACTAAACCAGAGAAAGCTGCAGGTGGATAAAGAAGCTGTGGCTGTTTTTTGCTTTTGGGTGGCAAT
3121 GAGAAAGAGTCACAGTGTGGGTTAAAGGGATCTGCAGTGGGGCCAAGGATGCCACCCCACCCTCAGCTGTAGGCAAGCTT
3201 GCACATAAATAACCCCCGTCAGTGGAGTGTTCGGGATGCAGGGGGCACTATAGTGTTCTTGGACTTGTCGTCCTGGGGCA
3281 GTTTTAGTTCTTTATATTTAGTGGGTCAGTGCCAAGTGCTACCACTTCCCAATAAAGGAATGGGGACCCAGAGGCTGGGT
3361 CCCTGGCTACCTTGTTATGAGGTTTTGTTATTTCTCTGACAAGATTGCTTTGGAAAGAGCTGCTTTTAGGGATTATTTTT
3441 TGAATACCCCGAGTGGGGAGCAGGGTTCTCCTCAAAGCCTCACAACCATAGGATCATAGGAAAGGGGCCCTATTTTCCTG
3521 CTGCTTCCCAGCTCAGAACATATACTGAATGGAATGTATTTTTAAGAGAATAAAGTCTATTTTTTTGTATTTTAAAGATT
3601 GAGAGGGCTAAGAAAGTAGCCCTCAAATAAACTGTTATTGCATTATAGGCCCCTTTGTTGGGGGCAGCCTGTTGGTCCAC
3681 ACCTACTTGCTCAGGCAGGTGCTCTGGTCTCTCTCACCCCTGCCCCTTAGAGTCTAGGTGCAGCAGCTCCAAGCATGGGA
3761 CCAAGGAGGCCAGAACCTGTCGCTGGAAACCAGGGCAAAGCAGTGGCTCAGGGCTCCTTGGGTGCATGTGTATCATTGGA
3841 GCTGCCTGTCTGCATGTATCCTCTGGCGCGAATGCTCTCTGTTGGCTCTGCAGTACAATATGTAACCAATAAAGCTCCCT
3921 CGTTTCCGTATACTCTGTGCGAGTCTGTGATGCCAGTTTTGTCAATGTCATCCCTGTGTATCATCTGTCTTCTATGCGTT
4001 GGCGCAGCTCTAGTATATTTATTTATTTCATTGTGTAATACTTAAAATTGGGTATTTTACCTAACCAATTACTGATACTG
4081 CAAGGACTGGAAACATTAACTGCCCTGATCCTGGTGTGCAGATTCTTTCCATTACTGCCACGAATTCTAAGACTAGGGGG
4161 GGAAAAGCCTTCTCCGTTTTCATCTTCCAGTCAGATCACCAATATATATAATGATGTCCCTTAACTCACAGTAAGAAAGA
4241 ATAAAACCACATTTAAGGGACATTACTTGGATTTGCAGTAACAGTGTTTATCATCTATCTGTCAGTCAGTCAGGAGCCCC
4321 TGGGAAGGAACCAGCATGTAACATGTTTTTATCATCTTATATGGCAAAAGGGACTTTGCAGATAAGGATGCTGGGATGAG
4401 GCAGAACATCCTAGATGATCCAGGTGGGCCTTAAATGTAATCACAGGTAGTATCCTTTTAAGAGAGAGACAAAAGATTTG
4481 ACTACAGGAGAAGGCAATGTGATGATGGAAGCAGAAACTGGAGTTATGTGCTCTGAGGATGGAGGAAGGAGCCACGAGCC
4561 TTCCCACACCTAGAAGCTGAAAAGAGCAAGGAAATGAACTGATCCTCCCTGCTCTGAGAGCCTCTGTAATGAATGCAGCC
4641 CTGTGTACCCATTTTAGACTTTAAGCTTCCAGAACTTTCGAATAGATTTCTGTTTTTTTAAGAGCCACTAAGTTTGTGGC
4721 AATCTGTTAAACCAGCTGTTACCTAAGCCCTTGATCCTATGTAGTGCGCTTCCCAAAATGTACACCACCACCTTTAGTAG
4801 AATTGGGAAGTTTTAGCACATACCCATGGAGGGAATCAGGAATAAAGGCAGACTGGTCTCCCAAAGGCTCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||: ||||  || ||||||| 
Target 5' agCAGCACCAACATCTGCTGCTa 3'
2427 - 2449 164.00 -16.80
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |||| ||  ||||||| 
Target 5' tgagcACCAGTA-ATGCTGCTg 3'
751 - 771 156.00 -14.40
3
miRNA  3' guGUUUGGUAA--UACACGACGAu 5'
            ::| |: ||  | |||||||| 
Target 5' gcTGATCTCTTCCACGTGCTGCTg 3'
3012 - 3035 154.00 -14.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30105043 5 COSMIC
COSN31582022 5 COSMIC
COSN30524889 21 COSMIC
COSN5865270 27 COSMIC
COSN5865545 28 COSMIC
COSN5865224 29 COSMIC
COSN5853777 36 COSMIC
COSN5865512 45 COSMIC
COSN30498034 53 COSMIC
COSN30473122 54 COSMIC
COSN30497913 64 COSMIC
COSN30150314 67 COSMIC
COSN30503422 97 COSMIC
COSN30109888 126 COSMIC
COSN30175900 130 COSMIC
COSN31960193 131 COSMIC
COSN31546253 166 COSMIC
COSN1099949 272 COSMIC
COSN31487477 673 COSMIC
COSN15912930 704 COSMIC
COSN31514719 873 COSMIC
COSN31513190 896 COSMIC
COSN31518324 1105 COSMIC
COSN31602783 1117 COSMIC
COSN6447922 1179 COSMIC
COSN30175661 1191 COSMIC
COSN31541953 1251 COSMIC
COSN28207547 1253 COSMIC
COSN20227745 1579 COSMIC
COSN8337005 1593 COSMIC
COSN16455913 1770 COSMIC
COSN20229928 1874 COSMIC
COSN30022680 2104 COSMIC
COSN1099945 2272 COSMIC
COSN31570365 2335 COSMIC
COSN22752156 2414 COSMIC
COSN26956135 2459 COSMIC
COSN26585458 3461 COSMIC
COSN31482762 3473 COSMIC
COSN30163252 3534 COSMIC
COSN31547955 3568 COSMIC
COSN23175247 3588 COSMIC
COSN31595147 3868 COSMIC
COSN31518325 3869 COSMIC
COSN1436251 3900 COSMIC
COSN16708523 3917 COSMIC
COSN31532959 3997 COSMIC
COSN31522176 4003 COSMIC
COSN20094505 4155 COSMIC
COSN1436248 4461 COSMIC
COSN2491585 4644 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1437587998 3 dbSNP
rs185275170 4 dbSNP
rs757117338 5 dbSNP
rs1166644737 8 dbSNP
rs1488603924 12 dbSNP
rs1290322815 13 dbSNP
rs780497322 15 dbSNP
rs758833907 16 dbSNP
rs1309865512 18 dbSNP
rs1422216483 18 dbSNP
rs199601042 19 dbSNP
rs201465047 20 dbSNP
rs1333729551 21 dbSNP
rs750459214 24 dbSNP
rs200540840 25 dbSNP
rs917776753 26 dbSNP
rs373655445 29 dbSNP
rs747014450 32 dbSNP
rs1382298885 46 dbSNP
rs1159602900 47 dbSNP
rs1470100621 49 dbSNP
rs753978057 50 dbSNP
rs1201477556 51 dbSNP
rs990548780 53 dbSNP
rs959383667 54 dbSNP
rs1289532176 55 dbSNP
rs539270426 56 dbSNP
rs1256192987 59 dbSNP
rs777647695 62 dbSNP
rs202173482 66 dbSNP
rs905238402 87 dbSNP
rs966391517 88 dbSNP
rs1385659157 95 dbSNP
rs1021216193 98 dbSNP
rs1045512751 106 dbSNP
rs946732613 109 dbSNP
rs547327278 114 dbSNP
rs528462646 116 dbSNP
rs112030773 122 dbSNP
rs1389970254 126 dbSNP
rs758285468 130 dbSNP
rs1373209965 131 dbSNP
rs1197993796 133 dbSNP
rs1431381603 136 dbSNP
rs1254594976 137 dbSNP
rs935211959 145 dbSNP
rs922442938 148 dbSNP
rs1194058817 150 dbSNP
rs1457184251 154 dbSNP
rs976575965 169 dbSNP
rs1236558764 174 dbSNP
rs1197839081 182 dbSNP
rs1340149443 200 dbSNP
rs964135601 203 dbSNP
rs1018019462 204 dbSNP
rs984225171 211 dbSNP
rs996916818 218 dbSNP
rs1350712742 222 dbSNP
rs116072608 223 dbSNP
rs1487299885 224 dbSNP
rs530892592 227 dbSNP
rs1222928564 229 dbSNP
rs150563959 230 dbSNP
rs544073299 237 dbSNP
rs1272253581 240 dbSNP
rs1326434898 240 dbSNP
rs1396518300 243 dbSNP
rs898051022 248 dbSNP
rs887147876 255 dbSNP
rs1035154436 256 dbSNP
rs1174238600 270 dbSNP
rs949335272 278 dbSNP
rs368873274 282 dbSNP
rs1184169846 284 dbSNP
rs683893 286 dbSNP
rs1055384408 287 dbSNP
rs1198834578 292 dbSNP
rs1486719452 295 dbSNP
rs1281646910 320 dbSNP
rs141767105 325 dbSNP
rs1305134595 333 dbSNP
rs946730262 333 dbSNP
rs779089175 334 dbSNP
rs753266249 339 dbSNP
rs1370268763 349 dbSNP
rs1376810385 367 dbSNP
rs1296822050 376 dbSNP
rs1463967566 379 dbSNP
rs893829820 383 dbSNP
rs1405448754 393 dbSNP
rs1160113634 406 dbSNP
rs979216714 411 dbSNP
rs945018716 417 dbSNP
rs913568274 423 dbSNP
rs1052406528 427 dbSNP
rs572475000 430 dbSNP
rs187947352 435 dbSNP
rs1028463022 439 dbSNP
rs183623577 442 dbSNP
rs536778314 443 dbSNP
rs1206054585 449 dbSNP
rs41268107 452 dbSNP
rs1283225312 454 dbSNP
rs1231147321 455 dbSNP
rs910987527 459 dbSNP
rs1293388983 475 dbSNP
rs1343400765 484 dbSNP
rs1399273656 484 dbSNP
rs1480898277 486 dbSNP
rs1401056214 494 dbSNP
rs983906538 502 dbSNP
rs1389826615 504 dbSNP
rs1255388221 507 dbSNP
rs557024792 508 dbSNP
rs750933485 532 dbSNP
rs918263353 547 dbSNP
rs1193079818 551 dbSNP
rs1024727930 553 dbSNP
rs1013477576 571 dbSNP
rs1194591389 578 dbSNP
rs1224294236 580 dbSNP
rs1288177083 581 dbSNP
rs1211374144 584 dbSNP
rs896405386 591 dbSNP
rs972333538 596 dbSNP
rs1217453173 609 dbSNP
rs1393543345 625 dbSNP
rs1271851059 627 dbSNP
rs1431392314 636 dbSNP
rs191428961 638 dbSNP
rs187757741 641 dbSNP
rs937826454 649 dbSNP
rs1035271541 651 dbSNP
rs553676564 652 dbSNP
rs763724800 654 dbSNP
rs986885511 654 dbSNP
rs1421823928 677 dbSNP
rs969564300 678 dbSNP
rs1176543572 681 dbSNP
rs1472055454 683 dbSNP
rs933701519 684 dbSNP
rs1024198743 685 dbSNP
rs1011007738 689 dbSNP
rs537440587 691 dbSNP
rs1469224503 703 dbSNP
rs535315334 705 dbSNP
rs1253219221 733 dbSNP
rs893861152 738 dbSNP
rs1305185976 740 dbSNP
rs1361741411 743 dbSNP
rs1215035175 744 dbSNP
rs1183690611 749 dbSNP
rs1301207871 755 dbSNP
rs975675490 760 dbSNP
rs1371532180 772 dbSNP
rs758041493 776 dbSNP
rs549004 777 dbSNP
rs1356295912 781 dbSNP
rs1171253079 783 dbSNP
rs1414363161 789 dbSNP
rs982790020 793 dbSNP
rs1201617168 799 dbSNP
rs1231416090 801 dbSNP
rs1462608257 802 dbSNP
rs1454974882 810 dbSNP
rs951562979 819 dbSNP
rs1176206207 830 dbSNP
rs1479465668 849 dbSNP
rs187732632 851 dbSNP
rs901122346 855 dbSNP
rs774590568 871 dbSNP
rs1485085816 874 dbSNP
rs1278085103 877 dbSNP
rs1236489953 883 dbSNP
rs1034007713 894 dbSNP
rs1241478896 898 dbSNP
rs1336689144 901 dbSNP
rs1375840028 906 dbSNP
rs1299004722 907 dbSNP
rs557681296 909 dbSNP
rs765105833 912 dbSNP
rs759366580 914 dbSNP
rs1319105064 915 dbSNP
rs1435893820 921 dbSNP
rs776715170 925 dbSNP
rs1336775445 932 dbSNP
rs533972417 935 dbSNP
rs1382166417 936 dbSNP
rs1043597945 938 dbSNP
rs1409675893 959 dbSNP
rs945080287 966 dbSNP
rs775415324 967 dbSNP
rs1474592183 972 dbSNP
rs1254779962 979 dbSNP
rs568863060 986 dbSNP
rs918335495 989 dbSNP
rs1259890838 993 dbSNP
rs1050888819 996 dbSNP
rs933648354 998 dbSNP
rs1181587632 999 dbSNP
rs972408743 1011 dbSNP
rs570005274 1012 dbSNP
rs1340415381 1014 dbSNP
rs1287681530 1021 dbSNP
rs367783198 1030 dbSNP
rs1039897802 1041 dbSNP
rs551859040 1045 dbSNP
rs1460608292 1051 dbSNP
rs143628885 1052 dbSNP
rs866786419 1053 dbSNP
rs1475272832 1063 dbSNP
rs1351694409 1065 dbSNP
rs1291492531 1067 dbSNP
rs1244281300 1069 dbSNP
rs746889737 1072 dbSNP
rs183222708 1075 dbSNP
rs1316282466 1076 dbSNP
rs540072866 1079 dbSNP
rs528363161 1083 dbSNP
rs561286203 1085 dbSNP
rs542214902 1086 dbSNP
rs1382422440 1088 dbSNP
rs575205854 1094 dbSNP
rs1325988564 1096 dbSNP
rs1384424460 1104 dbSNP
rs1389651402 1104 dbSNP
rs901193179 1105 dbSNP
rs1161408552 1112 dbSNP
rs1041416539 1113 dbSNP
rs1006816290 1118 dbSNP
rs1372069745 1133 dbSNP
rs992962829 1133 dbSNP
rs889662276 1135 dbSNP
rs1168156370 1138 dbSNP
rs1430254680 1141 dbSNP
rs1426370625 1161 dbSNP
rs1034356030 1170 dbSNP
rs550194244 1171 dbSNP
rs556747369 1174 dbSNP
rs1474389917 1177 dbSNP
rs17278869 1179 dbSNP
rs577841547 1181 dbSNP
rs1195496535 1195 dbSNP
rs148923644 1210 dbSNP
rs1232525063 1211 dbSNP
rs1268503652 1217 dbSNP
rs1327500197 1220 dbSNP
rs1387000578 1233 dbSNP
rs931142905 1234 dbSNP
rs771955491 1237 dbSNP
rs892339136 1241 dbSNP
rs1051278191 1244 dbSNP
rs1292963850 1250 dbSNP
rs1036723524 1254 dbSNP
rs1172995441 1271 dbSNP
rs997952290 1277 dbSNP
rs938408861 1281 dbSNP
rs1194440032 1286 dbSNP
rs1039362411 1290 dbSNP
rs191305246 1292 dbSNP
rs747923507 1296 dbSNP
rs1280229753 1298 dbSNP
rs1232831674 1302 dbSNP
rs910120940 1302 dbSNP
rs980139409 1305 dbSNP
rs755551817 1312 dbSNP
rs778819170 1316 dbSNP
rs77281526 1317 dbSNP
rs1334768887 1320 dbSNP
rs1365894500 1326 dbSNP
rs930131485 1331 dbSNP
rs917433387 1332 dbSNP
rs993284662 1333 dbSNP
rs556027910 1337 dbSNP
rs1432798813 1338 dbSNP
rs762042890 1343 dbSNP
rs1174063439 1348 dbSNP
rs958839408 1349 dbSNP
rs927250151 1371 dbSNP
rs1184324086 1372 dbSNP
rs1419745692 1373 dbSNP
rs989681387 1394 dbSNP
rs958178693 1395 dbSNP
rs1486956027 1403 dbSNP
rs537002213 1407 dbSNP
rs1022219224 1409 dbSNP
rs1031114148 1412 dbSNP
rs1204891495 1412 dbSNP
rs188557122 1413 dbSNP
rs1349052857 1415 dbSNP
rs1258577129 1419 dbSNP
rs1009520250 1422 dbSNP
rs1475752004 1428 dbSNP
rs978185786 1429 dbSNP
rs965809539 1442 dbSNP
rs551553676 1444 dbSNP
rs1357254865 1452 dbSNP
rs533228935 1454 dbSNP
rs1029499721 1455 dbSNP
rs565878591 1470 dbSNP
rs1428716403 1474 dbSNP
rs1382602910 1482 dbSNP
rs754575163 1483 dbSNP
rs753594536 1488 dbSNP
rs1417198619 1490 dbSNP
rs998319634 1496 dbSNP
rs1476254071 1501 dbSNP
rs182943312 1510 dbSNP
rs373979719 1519 dbSNP
rs1286796660 1520 dbSNP
rs1005155575 1521 dbSNP
rs1270030420 1525 dbSNP
rs888151522 1527 dbSNP
rs1329470397 1529 dbSNP
rs1272197966 1531 dbSNP
rs1230901498 1533 dbSNP
rs1336386153 1533 dbSNP
rs1284708159 1535 dbSNP
rs889746072 1542 dbSNP
rs1324415022 1543 dbSNP
rs190738165 1558 dbSNP
rs370585552 1566 dbSNP
rs995325562 1567 dbSNP
rs897010617 1572 dbSNP
rs1322127059 1581 dbSNP
rs1463071038 1588 dbSNP
rs750720927 1590 dbSNP
rs1280843538 1592 dbSNP
rs1047271081 1603 dbSNP
rs1167782071 1611 dbSNP
rs1345803818 1612 dbSNP
rs1244153492 1625 dbSNP
rs1189577318 1627 dbSNP
rs1036794643 1628 dbSNP
rs1468357821 1634 dbSNP
rs1251975854 1637 dbSNP
rs1211511879 1641 dbSNP
rs938450529 1664 dbSNP
rs1278700258 1665 dbSNP
rs1439831255 1676 dbSNP
rs592611 1681 dbSNP
rs1329384924 1706 dbSNP
rs1337408294 1708 dbSNP
rs1271902777 1709 dbSNP
rs111286208 1711 dbSNP
rs547590077 1717 dbSNP
rs1324132365 1720 dbSNP
rs916866524 1720 dbSNP
rs1443458007 1729 dbSNP
rs1350521464 1734 dbSNP
rs560986675 1737 dbSNP
rs1057315826 1749 dbSNP
rs1422210743 1756 dbSNP
rs937535846 1756 dbSNP
rs1169797772 1758 dbSNP
rs768800409 1760 dbSNP
rs532394687 1761 dbSNP
rs936879926 1769 dbSNP
rs924114374 1770 dbSNP
rs988424431 1771 dbSNP
rs755634083 1772 dbSNP
rs11810808 1773 dbSNP
rs1020111870 1779 dbSNP
rs1274950767 1786 dbSNP
rs1205871515 1787 dbSNP
rs1234964923 1791 dbSNP
rs34661815 1794 dbSNP
rs749502188 1794 dbSNP
rs1301043882 1814 dbSNP
rs1236734845 1819 dbSNP
rs954168223 1820 dbSNP
rs1279212452 1830 dbSNP
rs976597278 1832 dbSNP
rs1026921170 1834 dbSNP
rs1309168261 1835 dbSNP
rs1434703834 1836 dbSNP
rs186270324 1837 dbSNP
rs1175959300 1850 dbSNP
rs1425370890 1851 dbSNP
rs775523966 1851 dbSNP
rs1176276331 1856 dbSNP
rs897041811 1863 dbSNP
rs75982213 1873 dbSNP
rs1003114052 1879 dbSNP
rs1485327991 1882 dbSNP
rs906986096 1886 dbSNP
rs888076286 1888 dbSNP
rs1211915270 1890 dbSNP
rs1312570768 1892 dbSNP
rs1283744216 1909 dbSNP
rs1222347916 1923 dbSNP
rs1044524667 1927 dbSNP
rs580878 1930 dbSNP
rs1414670281 1931 dbSNP
rs892824160 1933 dbSNP
rs1451800919 1937 dbSNP
rs1054090723 1939 dbSNP
rs1315379363 1941 dbSNP
rs936911004 1945 dbSNP
rs1466814913 1954 dbSNP
rs924187839 1960 dbSNP
rs1157902644 1961 dbSNP
rs548688229 1962 dbSNP
rs1380547895 1963 dbSNP
rs994800283 1971 dbSNP
rs1474607447 1975 dbSNP
rs896056169 1977 dbSNP
rs1334783607 1979 dbSNP
rs1483451964 1980 dbSNP
rs1241362462 1992 dbSNP
rs139074089 1996 dbSNP
rs1269041231 1997 dbSNP
rs1232695796 1998 dbSNP
rs1359829220 1999 dbSNP
rs912673683 1999 dbSNP
rs1158570074 2001 dbSNP
rs1399205284 2002 dbSNP
rs937522626 2006 dbSNP
rs1361675140 2012 dbSNP
rs1410556451 2017 dbSNP
rs1178186460 2018 dbSNP
rs1433369936 2024 dbSNP
rs906065783 2027 dbSNP
rs553150568 2038 dbSNP
rs1460405929 2046 dbSNP
rs541591782 2049 dbSNP
rs146486844 2060 dbSNP
rs1043127889 2062 dbSNP
rs1166812874 2064 dbSNP
rs33999478 2067 dbSNP
rs1424375519 2068 dbSNP
rs35702179 2082 dbSNP
rs574186188 2089 dbSNP
rs985969669 2093 dbSNP
rs1184514360 2094 dbSNP
rs1184886764 2114 dbSNP
rs1466101810 2119 dbSNP
rs954127616 2121 dbSNP
rs746161317 2124 dbSNP
rs1213381329 2134 dbSNP
rs762344836 2137 dbSNP
rs1267357902 2147 dbSNP
rs142458071 2159 dbSNP
rs947454687 2182 dbSNP
rs1241052741 2185 dbSNP
rs147707200 2186 dbSNP
rs781090260 2187 dbSNP
rs945737186 2188 dbSNP
rs1366384516 2192 dbSNP
rs1320805274 2195 dbSNP
rs1213156493 2199 dbSNP
rs913211343 2206 dbSNP
rs576690105 2223 dbSNP
rs1284660444 2225 dbSNP
rs1294814361 2238 dbSNP
rs751845129 2241 dbSNP
rs1015457459 2242 dbSNP
rs1451023712 2252 dbSNP
rs1357177494 2255 dbSNP
rs531589674 2257 dbSNP
rs1193222167 2260 dbSNP
rs971618499 2260 dbSNP
rs1452855118 2268 dbSNP
rs1453291499 2271 dbSNP
rs1269780802 2276 dbSNP
rs532601637 2279 dbSNP
rs1022772831 2289 dbSNP
rs1250057709 2294 dbSNP
rs1208004176 2300 dbSNP
rs763077463 2315 dbSNP
rs1013089035 2316 dbSNP
rs892852511 2320 dbSNP
rs1328953552 2321 dbSNP
rs1302982501 2323 dbSNP
rs1018068004 2326 dbSNP
rs1054162448 2327 dbSNP
rs998513975 2330 dbSNP
rs902799163 2340 dbSNP
rs1025845053 2341 dbSNP
rs1431608690 2343 dbSNP
rs1159622056 2345 dbSNP
rs1172742959 2347 dbSNP
rs1432654572 2349 dbSNP
rs1379532393 2350 dbSNP
rs1199857529 2353 dbSNP
rs1418572786 2354 dbSNP
rs1456718153 2354 dbSNP
rs1248580178 2355 dbSNP
rs605775 2361 dbSNP
rs539497843 2367 dbSNP
rs769949075 2388 dbSNP
rs1165980467 2406 dbSNP
rs150038194 2409 dbSNP
rs879420982 2412 dbSNP
rs747891315 2413 dbSNP
rs1260408211 2417 dbSNP
rs1049885996 2421 dbSNP
rs1334642070 2427 dbSNP
rs932739014 2434 dbSNP
rs182031165 2437 dbSNP
rs545751419 2438 dbSNP
rs1394003319 2450 dbSNP
rs1404169069 2452 dbSNP
rs1043263768 2454 dbSNP
rs1011637028 2459 dbSNP
rs1362102103 2460 dbSNP
rs1161409572 2469 dbSNP
rs140571746 2486 dbSNP
rs1472970525 2492 dbSNP
rs567476548 2493 dbSNP
rs961346708 2496 dbSNP
rs151325020 2504 dbSNP
rs772114999 2507 dbSNP
rs933333429 2516 dbSNP
rs1200648233 2517 dbSNP
rs1349457039 2524 dbSNP
rs1265882685 2525 dbSNP
rs1306895452 2526 dbSNP
rs1294903068 2535 dbSNP
rs748175893 2536 dbSNP
rs751486938 2537 dbSNP
rs1298964886 2542 dbSNP
rs1342018815 2543 dbSNP
rs778569322 2543 dbSNP
rs1404605365 2570 dbSNP
rs1386664145 2577 dbSNP
rs1322819521 2582 dbSNP
rs1457773622 2584 dbSNP
rs1417322442 2593 dbSNP
rs1364056749 2603 dbSNP
rs530820416 2623 dbSNP
rs911026463 2624 dbSNP
rs190991205 2625 dbSNP
rs1032748963 2632 dbSNP
rs1445652668 2633 dbSNP
rs952570238 2646 dbSNP
rs1210283649 2649 dbSNP
rs1464946188 2657 dbSNP
rs1167690596 2660 dbSNP
rs1272046588 2663 dbSNP
rs1226505648 2698 dbSNP
rs1358327895 2699 dbSNP
rs1455059886 2703 dbSNP
rs998548063 2705 dbSNP
rs902871309 2709 dbSNP
rs972930456 2712 dbSNP
rs1198187918 2714 dbSNP
rs765866883 2715 dbSNP
rs1001761430 2716 dbSNP
rs1008905363 2740 dbSNP
rs1407179811 2744 dbSNP
rs1392013999 2747 dbSNP
rs891336320 2747 dbSNP
rs768501741 2748 dbSNP
rs1011733509 2752 dbSNP
rs1190088251 2760 dbSNP
rs1449740089 2767 dbSNP
rs1480264225 2772 dbSNP
rs1218678372 2774 dbSNP
rs551392081 2777 dbSNP
rs932812404 2780 dbSNP
rs1053200528 2791 dbSNP
rs1206549292 2795 dbSNP
rs1339786086 2797 dbSNP
rs1309295905 2798 dbSNP
rs1299606850 2800 dbSNP
rs1278945956 2807 dbSNP
rs1223114758 2808 dbSNP
rs898613942 2813 dbSNP
rs1228912381 2818 dbSNP
rs796614517 2820 dbSNP
rs1343918779 2823 dbSNP
rs1285580948 2828 dbSNP
rs1273315544 2832 dbSNP
rs142471126 2839 dbSNP
rs560347775 2846 dbSNP
rs1331820931 2848 dbSNP
rs540420719 2849 dbSNP
rs1328754845 2851 dbSNP
rs1428440499 2852 dbSNP
rs1372766785 2854 dbSNP
rs186087923 2856 dbSNP
rs1423958798 2857 dbSNP
rs1189101066 2868 dbSNP
rs981427593 2874 dbSNP
rs1246841402 2875 dbSNP
rs1464005566 2876 dbSNP
rs950049132 2880 dbSNP
rs1276719292 2882 dbSNP
rs1482011342 2882 dbSNP
rs541141040 2890 dbSNP
rs574122054 2891 dbSNP
rs957175848 2892 dbSNP
rs1479233406 2909 dbSNP
rs574733928 2911 dbSNP
rs1345783376 2912 dbSNP
rs918425282 2913 dbSNP
rs1199284246 2914 dbSNP
rs1352814025 2916 dbSNP
rs1054035232 2922 dbSNP
rs977183741 2925 dbSNP
rs1414474544 2926 dbSNP
rs1248150289 2928 dbSNP
rs960076084 2932 dbSNP
rs1178833830 2934 dbSNP
rs562284781 2937 dbSNP
rs936934639 2940 dbSNP
rs1019027924 2950 dbSNP
rs1425216807 2985 dbSNP
rs1008559335 2991 dbSNP
rs181214080 2998 dbSNP
rs377464363 3001 dbSNP
rs1471333035 3002 dbSNP
rs969732838 3006 dbSNP
rs755580760 3008 dbSNP
rs1182898131 3023 dbSNP
rs1021882353 3026 dbSNP
rs749901587 3027 dbSNP
rs956198540 3038 dbSNP
rs1032257753 3044 dbSNP
rs1267765785 3044 dbSNP
rs1331326353 3046 dbSNP
rs1289516320 3047 dbSNP
rs898685701 3051 dbSNP
rs1038471139 3052 dbSNP
rs576672722 3056 dbSNP
rs1449249095 3069 dbSNP
rs940115367 3071 dbSNP
rs1393622271 3072 dbSNP
rs558035750 3081 dbSNP
rs887196860 3085 dbSNP
rs997582837 3087 dbSNP
rs539409672 3088 dbSNP
rs1413608853 3098 dbSNP
rs1158132604 3099 dbSNP
rs138360916 3099 dbSNP
rs1335488602 3101 dbSNP
rs1467826042 3105 dbSNP
rs780728077 3110 dbSNP
rs901911852 3113 dbSNP
rs1017667644 3119 dbSNP
rs950067764 3124 dbSNP
rs1452640599 3127 dbSNP
rs1207133781 3129 dbSNP
rs887816181 3130 dbSNP
rs915838213 3131 dbSNP
rs1268897357 3136 dbSNP
rs757743713 3138 dbSNP
rs1221430741 3148 dbSNP
rs1161074174 3154 dbSNP
rs1320401785 3154 dbSNP
rs752172895 3155 dbSNP
rs112137541 3164 dbSNP
rs1296405117 3167 dbSNP
rs752428622 3168 dbSNP
rs1432513157 3177 dbSNP
rs1390162641 3182 dbSNP
rs896962288 3185 dbSNP
rs925785596 3186 dbSNP
rs1037283806 3189 dbSNP
rs1166835585 3199 dbSNP
rs1424171841 3201 dbSNP
rs1389384969 3202 dbSNP
rs977214753 3213 dbSNP
rs139076782 3217 dbSNP
rs1487550385 3218 dbSNP
rs967569766 3218 dbSNP
rs1201200810 3222 dbSNP
rs1350294109 3224 dbSNP
rs1259297849 3225 dbSNP
rs1241707463 3226 dbSNP
rs561831387 3232 dbSNP
rs911636845 3233 dbSNP
rs764732780 3240 dbSNP
rs1208972436 3246 dbSNP
rs928347622 3248 dbSNP
rs1272986166 3253 dbSNP
rs1451096825 3255 dbSNP
rs1231116788 3256 dbSNP
rs987569413 3257 dbSNP
rs1366857946 3267 dbSNP
rs764312251 3268 dbSNP
rs1417195308 3269 dbSNP
rs1384309059 3270 dbSNP
rs1364959338 3273 dbSNP
rs979887566 3273 dbSNP
rs1295204639 3277 dbSNP
rs1458388006 3285 dbSNP
rs1381278663 3286 dbSNP
rs1028591867 3288 dbSNP
rs1166437634 3296 dbSNP
rs1369678801 3296 dbSNP
rs1431420522 3301 dbSNP
rs146186530 3301 dbSNP
rs997066157 3305 dbSNP
rs1198510627 3309 dbSNP
rs914247333 3314 dbSNP
rs962898897 3330 dbSNP
rs1269626995 3332 dbSNP
rs749139360 3346 dbSNP
rs1017097223 3347 dbSNP
rs1420026051 3348 dbSNP
rs1004331713 3349 dbSNP
rs1161554880 3350 dbSNP
rs887219375 3352 dbSNP
rs1343321719 3355 dbSNP
rs1446396078 3355 dbSNP
rs868134335 3363 dbSNP
rs565547184 3365 dbSNP
rs1309910919 3369 dbSNP
rs758817186 3374 dbSNP
rs1446631595 3377 dbSNP
rs568497437 3378 dbSNP
rs753673144 3381 dbSNP
rs1014733753 3387 dbSNP
rs1306115344 3387 dbSNP
rs1172197024 3390 dbSNP
rs1411429649 3390 dbSNP
rs367589444 3390 dbSNP
rs780760288 3390 dbSNP
rs867223383 3394 dbSNP
rs549153655 3400 dbSNP
rs1176822375 3405 dbSNP
rs766492201 3415 dbSNP
rs1410310351 3417 dbSNP
rs897049372 3417 dbSNP
rs1036972814 3425 dbSNP
rs1483578605 3425 dbSNP
rs1055771492 3426 dbSNP
rs1482046078 3427 dbSNP
rs935907759 3428 dbSNP
rs1044133012 3429 dbSNP
rs925855816 3430 dbSNP
rs1327951051 3442 dbSNP
rs1041605965 3450 dbSNP
rs945885327 3451 dbSNP
rs911652671 3464 dbSNP
rs914216180 3464 dbSNP
rs1324186478 3470 dbSNP
rs536894053 3481 dbSNP
rs1337645559 3487 dbSNP
rs953219183 3489 dbSNP
rs1400259027 3499 dbSNP
rs1364678598 3500 dbSNP
rs1161974830 3501 dbSNP
rs1473228149 3511 dbSNP
rs921610100 3512 dbSNP
rs752824668 3526 dbSNP
rs1368425711 3533 dbSNP
rs569917422 3534 dbSNP
rs1425937439 3543 dbSNP
rs551708928 3552 dbSNP
rs1262318465 3557 dbSNP
rs878982709 3566 dbSNP
rs1203973266 3568 dbSNP
rs765528153 3568 dbSNP
rs976395979 3572 dbSNP
rs1163895461 3577 dbSNP
rs780392787 3579 dbSNP
rs962966194 3579 dbSNP
rs1371408939 3580 dbSNP
rs1196060987 3581 dbSNP
rs986156736 3587 dbSNP
rs1017129724 3596 dbSNP
rs1434706858 3599 dbSNP
rs1004812500 3604 dbSNP
rs952141578 3605 dbSNP
rs951597366 3612 dbSNP
rs1401377973 3616 dbSNP
rs1024867392 3618 dbSNP
rs1161979245 3623 dbSNP
rs1027721543 3626 dbSNP
rs1386305208 3632 dbSNP
rs542068830 3633 dbSNP
rs1183793764 3637 dbSNP
rs993885575 3637 dbSNP
rs1014351905 3638 dbSNP
rs962105551 3639 dbSNP
rs1015918716 3642 dbSNP
rs894513988 3645 dbSNP
rs760658679 3652 dbSNP
rs11553178 3663 dbSNP
rs1195740127 3665 dbSNP
rs1002799442 3666 dbSNP
rs774342890 3667 dbSNP
rs573132556 3675 dbSNP
rs1055845148 3676 dbSNP
rs1363226199 3676 dbSNP
rs1300106783 3688 dbSNP
rs1044267925 3696 dbSNP
rs1000188178 3709 dbSNP
rs904467677 3711 dbSNP
rs1218839060 3713 dbSNP
rs553305415 3716 dbSNP
rs1322124557 3718 dbSNP
rs1041635633 3719 dbSNP
rs945930262 3724 dbSNP
rs143822551 3728 dbSNP
rs371287361 3728 dbSNP
rs1350264384 3733 dbSNP
rs1353342015 3734 dbSNP
rs559377682 3749 dbSNP
rs117560651 3757 dbSNP
rs924311059 3766 dbSNP
rs931752237 3767 dbSNP
rs547441503 3774 dbSNP
rs1428929485 3777 dbSNP
rs986248137 3781 dbSNP
rs116706030 3782 dbSNP
rs528965655 3784 dbSNP
rs1204106496 3794 dbSNP
rs759888136 3799 dbSNP
rs1236602466 3800 dbSNP
rs920671183 3801 dbSNP
rs1215432531 3802 dbSNP
rs1479172710 3810 dbSNP
rs561670418 3812 dbSNP
rs907525276 3813 dbSNP
rs983069359 3814 dbSNP
rs972206755 3817 dbSNP
rs1307969706 3827 dbSNP
rs962320108 3830 dbSNP
rs1003179165 3832 dbSNP
rs558873914 3832 dbSNP
rs570862072 3832 dbSNP
rs1181661113 3836 dbSNP
rs1410220800 3836 dbSNP
rs971316121 3842 dbSNP
rs776839880 3847 dbSNP
rs1436629431 3851 dbSNP
rs1181449242 3855 dbSNP
rs1012752951 3858 dbSNP
rs1301224243 3863 dbSNP
rs951684674 3868 dbSNP
rs893009717 3869 dbSNP
rs1024481174 3870 dbSNP
rs998619872 3873 dbSNP
rs1220599868 3876 dbSNP
rs1367986851 3877 dbSNP
rs1278760367 3880 dbSNP
rs1491320508 3880 dbSNP
rs1439901649 3881 dbSNP
rs1491341921 3881 dbSNP
rs1299057546 3892 dbSNP
rs371165342 3896 dbSNP
rs958810417 3898 dbSNP
rs1358156889 3899 dbSNP
rs1331795845 3900 dbSNP
rs1470666921 3909 dbSNP
rs1406245661 3910 dbSNP
rs1158296744 3911 dbSNP
rs1040054444 3916 dbSNP
rs543951252 3921 dbSNP
rs1034419885 3922 dbSNP
rs1405449986 3926 dbSNP
rs910784222 3927 dbSNP
rs1000217848 3928 dbSNP
rs904541020 3934 dbSNP
rs1050672712 3935 dbSNP
rs1205881832 3936 dbSNP
rs61077571 3940 dbSNP
rs775782717 3941 dbSNP
rs1010161597 3953 dbSNP
rs1319197518 3955 dbSNP
rs564408461 3956 dbSNP
rs769942091 3962 dbSNP
rs554346932 3965 dbSNP
rs1228040392 3967 dbSNP
rs1377521023 3967 dbSNP
rs769266504 3968 dbSNP
rs1282051093 3973 dbSNP
rs774358149 3974 dbSNP
rs931795333 3984 dbSNP
rs1158393458 3985 dbSNP
rs1491484489 3986 dbSNP
rs1491578720 3987 dbSNP
rs1240633095 3991 dbSNP
rs1319244580 3991 dbSNP
rs1179827929 3994 dbSNP
rs55873288 3996 dbSNP
rs1240756467 3997 dbSNP
rs544328595 3998 dbSNP
rs1312456044 3999 dbSNP
rs941756141 4003 dbSNP
rs907556741 4004 dbSNP
rs1221923005 4005 dbSNP
rs983484754 4009 dbSNP
rs1186683467 4012 dbSNP
rs1309810815 4023 dbSNP
rs575099327 4024 dbSNP
rs1221552191 4025 dbSNP
rs1320265818 4026 dbSNP
rs374625808 4029 dbSNP
rs553735033 4029 dbSNP
rs969418006 4029 dbSNP
rs982091301 4029 dbSNP
rs1296424002 4033 dbSNP
rs1432263922 4041 dbSNP
rs930284133 4041 dbSNP
rs917483648 4042 dbSNP
rs541899730 4048 dbSNP
rs1022881498 4052 dbSNP
rs1289863109 4057 dbSNP
rs993038129 4059 dbSNP
rs1435726298 4060 dbSNP
rs1348080814 4063 dbSNP
rs1165183935 4069 dbSNP
rs1245191419 4078 dbSNP
rs1389707116 4078 dbSNP
rs1167020900 4102 dbSNP
rs1430369139 4109 dbSNP
rs1262575111 4114 dbSNP
rs1191090863 4117 dbSNP
rs1487764848 4125 dbSNP
rs1382063778 4126 dbSNP
rs958839376 4129 dbSNP
rs1450431506 4130 dbSNP
rs376122287 4138 dbSNP
rs1318056139 4141 dbSNP
rs1308719148 4142 dbSNP
rs1034492008 4149 dbSNP
rs1295624040 4150 dbSNP
rs574871073 4155 dbSNP
rs998983779 4156 dbSNP
rs1019131208 4157 dbSNP
rs367624757 4157 dbSNP
rs888813701 4158 dbSNP
rs1050601831 4159 dbSNP
rs1020286214 4161 dbSNP
rs930899387 4161 dbSNP
rs1200856211 4162 dbSNP
rs556384846 4163 dbSNP
rs55980984 4163 dbSNP
rs76504312 4163 dbSNP
rs1251540457 4164 dbSNP
rs1382826919 4164 dbSNP
rs899305865 4167 dbSNP
rs1183132682 4168 dbSNP
rs890408452 4170 dbSNP
rs1030645658 4171 dbSNP
rs1224099871 4174 dbSNP
rs376849961 4175 dbSNP
rs1241102676 4176 dbSNP
rs749137723 4183 dbSNP
rs780987820 4195 dbSNP
rs1213225800 4199 dbSNP
rs1397399988 4203 dbSNP
rs200524833 4207 dbSNP
rs769410890 4209 dbSNP
rs1245126129 4211 dbSNP
rs1177748673 4213 dbSNP
rs1472529663 4214 dbSNP
rs928068898 4215 dbSNP
rs941788845 4218 dbSNP
rs1420050064 4219 dbSNP
rs948001952 4227 dbSNP
rs1199579831 4235 dbSNP
rs1310658762 4242 dbSNP
rs1459573874 4242 dbSNP
rs745575229 4242 dbSNP
rs1230154944 4253 dbSNP
rs1258899718 4256 dbSNP
rs1379997554 4260 dbSNP
rs558548800 4266 dbSNP
rs1398419394 4271 dbSNP
rs1312255918 4278 dbSNP
rs1362788194 4282 dbSNP
rs1337417805 4284 dbSNP
rs540542560 4284 dbSNP
rs991383549 4285 dbSNP
rs1383350318 4294 dbSNP
rs878932664 4295 dbSNP
rs1160867187 4297 dbSNP
rs1454615029 4299 dbSNP
rs1186361095 4300 dbSNP
rs1299242237 4300 dbSNP
rs1424546527 4301 dbSNP
rs957325606 4301 dbSNP
rs746285709 4304 dbSNP
rs773007771 4314 dbSNP
rs977266507 4314 dbSNP
rs1167546716 4316 dbSNP
rs143237889 4318 dbSNP
rs1264599112 4321 dbSNP
rs1018639155 4332 dbSNP
rs568419118 4333 dbSNP
rs1361783072 4346 dbSNP
rs1315996612 4347 dbSNP
rs1434453926 4354 dbSNP
rs1324816969 4356 dbSNP
rs1320822486 4359 dbSNP
rs917529703 4360 dbSNP
rs569881081 4377 dbSNP
rs888743373 4377 dbSNP
rs1426952557 4378 dbSNP
rs189664800 4379 dbSNP
rs747428976 4382 dbSNP
rs1263593510 4384 dbSNP
rs1028634209 4394 dbSNP
rs1239905449 4396 dbSNP
rs995468342 4398 dbSNP
rs927452872 4402 dbSNP
rs978884342 4404 dbSNP
rs968829334 4408 dbSNP
rs80026050 4409 dbSNP
rs184393194 4411 dbSNP
rs1228002106 4414 dbSNP
rs1337496027 4416 dbSNP
rs139871782 4417 dbSNP
rs988851390 4441 dbSNP
rs1301910616 4444 dbSNP
rs375989372 4444 dbSNP
rs537040752 4444 dbSNP
rs528886990 4451 dbSNP
rs181621614 4456 dbSNP
rs1186949301 4458 dbSNP
rs1303349656 4460 dbSNP
rs549628975 4465 dbSNP
rs1416978634 4466 dbSNP
rs771479891 4468 dbSNP
rs1169086052 4470 dbSNP
rs1428507720 4470 dbSNP
rs1475456707 4470 dbSNP
rs1365938333 4477 dbSNP
rs1481281111 4478 dbSNP
rs996057825 4480 dbSNP
rs1269381362 4482 dbSNP
rs1053775522 4484 dbSNP
rs936692406 4485 dbSNP
rs1196452727 4493 dbSNP
rs964561233 4497 dbSNP
rs977774903 4504 dbSNP
rs1353392226 4506 dbSNP
rs1225934090 4508 dbSNP
rs1016091206 4510 dbSNP
rs1346734210 4515 dbSNP
rs1167967843 4516 dbSNP
rs1466861510 4518 dbSNP
rs1423970841 4521 dbSNP
rs1440489317 4526 dbSNP
rs531908159 4527 dbSNP
rs569762727 4527 dbSNP
rs1198254260 4528 dbSNP
rs1431166366 4537 dbSNP
rs886221471 4539 dbSNP
rs1481353756 4545 dbSNP
rs1429931014 4546 dbSNP
rs1047914272 4556 dbSNP
rs987157907 4557 dbSNP
rs1013310637 4559 dbSNP
rs143978099 4561 dbSNP
rs1250796728 4565 dbSNP
rs546022836 4567 dbSNP
rs866096287 4570 dbSNP
rs927527457 4574 dbSNP
rs1261295469 4577 dbSNP
rs1205677175 4584 dbSNP
rs527970747 4585 dbSNP
rs947518966 4586 dbSNP
rs1258884311 4594 dbSNP
rs971190375 4596 dbSNP
rs1268060378 4599 dbSNP
rs1222415600 4604 dbSNP
rs963409785 4607 dbSNP
rs753084850 4609 dbSNP
rs749610094 4611 dbSNP
rs1442534405 4614 dbSNP
rs1381625052 4616 dbSNP
rs1334060083 4619 dbSNP
rs1470677562 4634 dbSNP
rs1005548011 4636 dbSNP
rs1158371085 4645 dbSNP
rs506004 4646 dbSNP
rs1409944258 4657 dbSNP
rs1158964129 4659 dbSNP
rs1444188937 4660 dbSNP
rs1303929346 4662 dbSNP
rs1012452768 4663 dbSNP
rs1046616332 4663 dbSNP
rs505938 4667 dbSNP
rs954784217 4675 dbSNP
rs1214335099 4678 dbSNP
rs1348718037 4678 dbSNP
rs1319071630 4679 dbSNP
rs754118108 4679 dbSNP
rs574748617 4680 dbSNP
rs964634788 4683 dbSNP
rs1312470102 4684 dbSNP
rs766508663 4685 dbSNP
rs189270640 4686 dbSNP
rs1454114356 4688 dbSNP
rs1400395375 4689 dbSNP
rs781312763 4692 dbSNP
rs184890417 4693 dbSNP
rs1346918461 4695 dbSNP
rs950624061 4695 dbSNP
rs1159495969 4696 dbSNP
rs192634190 4697 dbSNP
rs1041593490 4700 dbSNP
rs1423774779 4700 dbSNP
rs1379126713 4704 dbSNP
rs1176569807 4708 dbSNP
rs1418424421 4712 dbSNP
rs1236341870 4714 dbSNP
rs1184886263 4716 dbSNP
rs945971800 4723 dbSNP
rs1243211274 4724 dbSNP
rs752152227 4726 dbSNP
rs987251184 4727 dbSNP
rs1289112530 4729 dbSNP
rs1026117856 4735 dbSNP
rs1321983942 4738 dbSNP
rs953235661 4749 dbSNP
rs577442151 4750 dbSNP
rs868449931 4751 dbSNP
rs187790123 4755 dbSNP
rs1404099591 4757 dbSNP
rs1363533927 4765 dbSNP
rs116637066 4767 dbSNP
rs1200073349 4769 dbSNP
rs1354183542 4771 dbSNP
rs1168340303 4783 dbSNP
rs574212284 4786 dbSNP
rs1045403 4787 dbSNP
rs973569676 4788 dbSNP
rs1420843143 4790 dbSNP
rs376444667 4798 dbSNP
rs1271448188 4805 dbSNP
rs1223719884 4807 dbSNP
rs1488571001 4809 dbSNP
rs565975675 4809 dbSNP
rs1234496613 4811 dbSNP
rs1201822018 4813 dbSNP
rs1308812545 4813 dbSNP
rs553793418 4814 dbSNP
rs1278735913 4815 dbSNP
rs1005108441 4816 dbSNP
rs376532485 4821 dbSNP
rs1284905090 4823 dbSNP
rs1387147696 4824 dbSNP
rs1395957042 4827 dbSNP
rs906142727 4831 dbSNP
rs970957097 4839 dbSNP
rs1463578360 4844 dbSNP
rs1043347319 4847 dbSNP
rs1355229318 4850 dbSNP
rs1242987255 4852 dbSNP
rs1175836875 4855 dbSNP
rs1468655669 4856 dbSNP
rs1025256383 4866 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUA-CACGACGAu 5'
                |:||| |  ||||||| 
Target 5' ----ccCUAUUUUCCUGCUGCUu 3'
1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000418342.1 | 3UTR | CCCUAUUUUCCUGCUGCUUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000418342.1 | 3UTR | CCCUAUUUUCCUGCUGCUUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000418342.1 | 3UTR | CCCUAUUUUCCUGCUGCUUCCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000418342.1 | 3UTR | CCCUAUUUUCCUGCUGCUUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.516 1.3e-3 0.489 2.3e-3 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.594 1.4e-3 -0.583 1.8e-3 23 Click to see details
GSE38226 Liver fibrosis -0.525 7.3e-3 -0.498 1.1e-2 21 Click to see details
GSE19536 Breast cancer -0.223 1.3e-2 -0.289 1.8e-3 100 Click to see details
GSE28260 Renal cortex and medulla -0.577 1.9e-2 -0.571 2.1e-2 13 Click to see details
GSE19783 ER- ER- breast cancer -0.177 5.9e-2 -0.222 2.5e-2 79 Click to see details
GSE17306 Multiple myeloma -0.195 9.0e-2 -0.183 1.0e-1 49 Click to see details
GSE21849 B cell lymphoma 0.226 1.2e-1 0.189 1.6e-1 29 Click to see details
GSE27834 Pluripotent stem cells 0.306 1.2e-1 0.371 7.9e-2 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.244 1.5e-1 -0.104 3.3e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.219 1.5e-1 -0.148 2.5e-1 24 Click to see details
GSE21032 Prostate cancer 0.113 1.5e-1 0.040 3.6e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.2 1.7e-1 -0.095 3.3e-1 25 Click to see details
GSE17498 Multiple myeloma -0.124 2.2e-1 -0.096 2.8e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.105 3.3e-1 -0.084 3.6e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.037 3.9e-1 -0.010 4.7e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.086 4.0e-1 -0.420 8.7e-2 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.05 4.1e-1 -0.052 4.0e-1 25 Click to see details
GSE28544 Breast cancer 0.009 4.8e-1 0.283 9.0e-2 24 Click to see details
GSE14794 Lymphoblastoid cells 0.001 5.0e-1 0.047 3.3e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.001 5.0e-1 0.047 3.3e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD 0.362 0.12 0.378 0.11 12 Click to see details
HNSC -0.179 0.13 -0.178 0.13 42 Click to see details
COAD -0.44 0.14 -0.714 0.02 8 Click to see details
STAD 0.197 0.14 0.166 0.18 32 Click to see details
KICH 0.186 0.19 0.089 0.34 25 Click to see details
THCA 0.105 0.21 0.046 0.36 59 Click to see details
LIHC 0.107 0.23 0.043 0.38 49 Click to see details
BLCA 0.182 0.23 0.209 0.2 18 Click to see details
ESCA 0.23 0.25 0.282 0.2 11 Click to see details
CHOL -0.251 0.26 -0.450 0.11 9 Click to see details
KIRP 0.119 0.26 0.039 0.42 32 Click to see details
KIRC -0.069 0.29 -0.036 0.39 68 Click to see details
BRCA -0.061 0.29 -0.005 0.48 84 Click to see details
UCEC 0.13 0.3 0.142 0.28 19 Click to see details
PRAD -0.063 0.33 -0.132 0.18 50 Click to see details
CESC -0.319 0.4 -0.500 0.33 3 Click to see details
LUSC -0.042 0.4 -0.045 0.39 38 Click to see details
PAAD -0.097 0.45 0.200 0.4 4 Click to see details
PCPG 0.104 0.47 -0.500 0.33 3 Click to see details
PCPG 0.104 0.47 -0.500 0.33 3 Click to see details
PCPG 0.104 0.47 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5