miRTarBase - #MIRT120680 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PAK2   
Synonyms PAK65, PAKgamma
Description p21 (RAC1) activated kinase 2
Transcript NM_002577   
Expression
Putative miRNA Targets on PAK2
3'UTR of PAK2
(miRNA target sites are highlighted)
>PAK2|NM_002577|3'UTR
   1 CATCACTGCTGTGGCCTCATACTCTTTTTTCCATTTTCTACAAGAAGCCTTTTAGTATATGAAAATTATTACTCTTTTTG
  81 GGGTTTAAAGAAATGGTCTGCATAACCTGAATGAAAGAAGCAAATGACTATTCTCTGAAGACAACCAAGAGAAAATTGCA
 161 AAAAGACAAGTATGACTTTTATATGAACCCCTTCTTTAGGGTCCAGAAGGAATTGTGGACTGAATCACTAGCCTTAGGTC
 241 TTTCAGCAAACAGCCTATCAGGGCCATTTATCATGTGTGAGATTTGCATTTTACTTTGCTGACTTTGTTGTAATAGATCC
 321 CATTCATTGTCCCCTTTGGGGTATTTCCAATACTTGAATGGCAGATTGGAGTTTTTCAGAGTATGTGTTTCATCTGCTAG
 401 TCTTTCTCTCCTTCATAGCTTTTCTTTTCCTGGACTTGCTCCTTTTGAGTTGCTTTTGCGTTTCTCATGCCTAGGCAAGT
 481 GTAATAGAAATTATGTAGCTCCTTATGTTGGCAAAGGAGCTCTATATAGTTTCACTTTGTATAAAAGTTAGGACCAGCTG
 561 TTGTTACATGTAATATTTTAGTTCAGAACTTGACCTGAAGGAAGGGAAGAAAAGTATGTGATTTTTACCTTTTTTAACAA
 641 ATGTGAAAAAGTCAGTTTTAGAAATTTCGTGGTAGTAAGTTCGGCATTTGTTACATGTATAGAGAGAAGACTAATAATCT
 721 CTATTTATAACTAAATCATTGAGATAGAAAAAGATTCCCATTGACTGTAGACTTCTTCCCATTTTGTCTTCCCTTCTGCC
 801 TGTTTCCCCTTCAGGCTTGGCTCTAGGAACCAAAGTGATTTGTTGTTGTTCCAACCTGGGCTTTGTGACTTTGGTTAGTG
 881 CCACTACCTTCTTCCCTCCTTTCCCCCTTCAATTTGGAAATAAATTTCTGTATATGTTGCAATTTTAGGTTTAGGTTTGT
 961 TCTTTTTCTTTTTCATTAATCCTCTCTCACCTCACAGATACCCCCTCCCATGGCAAATAATATAATAACCAGTGAATTTT
1041 CAGGAATTTAAAAATTAGCTTTTTTCCACTTAAAGGAGAAAAATATTTGGGACTAGCAGCAGAGGCAGTAAGAGATGTGA
1121 ACCTTGGTGAGCTCTGATACAGTGAGAAGAGATTATACTCATGAAAGAGAATGTTAGTGTTACAGAGAAGCAGCCGATAG
1201 CAAATCGACTGTAGAGACTTGGCGGCGGTGGCATTGCCCCAGGTCGTCAGCAGTGTGGTATTATCTATGAGAACTTGAGC
1281 GACAGAGTATTTCTTGATGAATTTATAGATCATTTGAGATGTTGAGTTACTTTAGTTTAGTTTTGTTTTGTTTTTTCAAA
1361 TAAGTAGAGACTATTGTAAAAAACGAGAAAGGAAAATGAAATGTGCGTGTTGATAGCAATAATTTGTTTCTTTTAAAGAT
1441 TCTAAAAGGTCTGAGACCTGTAGCATTAATTATTTGAGTGCCCTCCCTTCTCCCCTCCCCTCCCTTTTCTCTTCTCTTTT
1521 TTCCTCTCCTCTTCTTCTCCTTTATTCATTGTTTTGCTTTTGGAGTGGGTGTTGTTCAAGTATCTGTGGTTTGGTTCTGG
1601 CATTTTGTTCCCACCATCCCCTTCCCCCATTAACTTCCCCCCTGCTTGCCATCCTGCAGTAGTATAAATCATGAATAAAA
1681 AATAATTTTGCTGTTGTAGTATACATTGGAGAAACTGGCAGGTTTTATTTCCATTATTTTATTTCCACTATATCTATGAT
1761 AAGATGCAATTATAAGGAGAGAAGTGACTGTTTTTTATTGATAAGGCAAGATTTTCAGAAAAATGAGTAAAATAATTAAT
1841 GAAACATATTTAGAGCACTTAATGGTCTCTGTTTTCAATATAATTCTTGATTTCATTTTTCTCTGGAATATATTGGCCTT
1921 CTACAGCTATTACTGAATTATAGAAACTGGTTTATTTCTGGCAGAAAGCTGCAGTGCCACCTGAGTTCCAAATTTTACCA
2001 TTCTTTGTAAACAGTTGGATGGATTATGATAAAGAAGATGCTACCAATGAAATAGAAAACCAACGAGATGAGAAGACTGT
2081 GATCCTCATGTACTCAGAGGCACTTCCCTCCTAAGTCAAAGACCATCCTCACTGACTATGTGCCAACGCCTCGTTTCAGG
2161 CTTGTGACTCAACAAAGGGCTTTTCCATTGATAGAAGCAGTTTGGGATTTGTAGTTGCGACTTCTTCGATAGTTACCTGC
2241 ACGTCCATTGCTGGCAACTGACTTGTCATTAAAACCTGGCTCTTTGGTTAAGGGAGCTACGCTGTGGTTTATTCTTAAGT
2321 TACGTGGATAAACTAACCTCTAACAGAAATATACTTTGGTTAATTTTGAAATGTGTCATTTTTAAACAATCTTAAAAGTA
2401 ATACAGAATTGTGATTTATTAATTTTAAAACATTCAGAACTTGTTGAAAGAAAAATTATATCTGAATCAAGATTCATGTT
2481 TTTTATTTTTATTTTTTTTGATACAGAGTCTCACTCTGTCACTCAGGCTGGAGTGCAGTGACATGATCTCAGCTCACTGC
2561 AACCTCCGCTTCCTGGGTTCAAGCAATTCTCATGCCTCAGCCTCCTGAGTAGCTGAGACCACAGGCACCCGCCACCACAC
2641 CCAGCTATTTTTTTGTATTTTTAGTAGAGACAGAGTCTCACCACATTGCCCAGGCTGGTCTCCAACTCCTGAGCTCAGGC
2721 AGTCTGCCCACCTTGGCCTCCCAAAGTGCTGCAGTTACAGGCGTGAGCCACTGCACCTGGCCTCATGTTTTTTAAATAAT
2801 TGCCTTTTATATTTACCCTTTTTGTCATCACTTTAGAATGAAAATTCCCATTTAAATCTGAAAGTTACCTTAATAGTCCT
2881 CTTGTGTTATTAGGACAGTATTATTATAGTACTTATTTATTTTATTTTAGATTTAAAGTTATCTTCTCTTTTTCTTTTTT
2961 CTTCTGCTGCTTTTAGGGACAATTAAAACTGGGAAACTATGAAACATGGAACATTTTATCCTACCTGAAAGTAAACGAGT
3041 AATTGTGAAGCATAAGACACTGAGGCTAATACAACTCTGTCTTCATGTGTTGACTGCCTGGCACATAGTATTCATTCTCT
3121 TCCCTTTAACATAGAAGTGTCCAGCTGCGTACAGTCTAGTAACCAGCAACTGTAAACGAACCTGTGCCTCTAACAAGCGA
3201 TTCTAAACCACCTATGAGTATTTCTTTTAGGGCTCACTTAAATACATGTTTGTATATACTGTATTCTAGCCAGAATAATT
3281 TTAGATCTGATCAGGTAGTAGCTAAAATTAGAAAAAAACAAAATAGATGCTTAAAGAATTTGCATCCATTTTTGAGTCTA
3361 AATCTTTTAAAATATACTGAGATCCACATCTAGTGAAATGTCAGTGTCAAAATATTATAGATTATAGCTAAAATCCAGAT
3441 TAATACTCATTTGGGGTTTTTTATAGTGGAACTTCATAGTAATACAAAAAGCAGATTGTCTTCCTGTCTCCGCTGCTCCC
3521 ACAGTAGGTATTGAAACTGGTAAAATCAGTTTTTTGATAGTGTGTGTATATAAGAAAAAATAGATACACACATTCTTTTT
3601 TCTCAGTCAACACATTGATTGAACACTCTGGCAAAGATGCTGTGGTGGATGAGGTTGGAGTTCGAAAGAAGAAGCAAGCG
3681 CTGGCCTGGCCTTGAAAGAACCGAAGTCTTTCCCATTCACTTCTCTAGAAAGCTGCCAAGACAGAGGCAGAAAGAAATGG
3761 ATGATAGTTCTGTCAAGCACACTTCTGTTCTCTTAGAACTTAGAAGTGTTTCTAAGAGAACAGAAGTAATAAGAGAAACA
3841 GTTACGTGTGGAATTCAACATCTTTGGTTGGAACGCATTGGCTTTTTTTTTCTTGTTTTGATAGAAATGGAATTAAGCAA
3921 AAGTAGTTTTTGTCTTTTCTGTTGTCTTCAAATTTTATGCCTTTTATTTTTAATTTAATCCCGTTCAATTATTTAATTGT
4001 TATACATTGACATTAACTGCTGTATTTTGACTTTGTTCAATAATTTTGTTCTTTCAGGGCTAGAAATAAACTTTTTAAAA
4081 AAAGTGTGCATTTTTCCCTTTCCTAAACTTTTATTCTTTCTTTTGATCAGCGTAAAAGAATATTTTAATGTCTTTTGATA
4161 GCATAAAAGAATATTTAAATGTCTTAATAGGTTTTCAAAGAACATTTAGTATTTTTAGTGATAAATGTTTTAAACCTTTT
4241 AA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaauACACGACGAu 5'
                      | ||||||| 
Target 5' tttcttttttctTCTGCTGCTt 3'
2951 - 2972 142.00 -9.50
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||: ||| | |||||:| 
Target 5' aaaAAATAATT-T-TGCTGTTg 3'
1677 - 1696 141.00 -8.50
3
miRNA  3' guguuuGGUAAUACACGACGau 5'
                |||  | |||||||  
Target 5' ggcctcCCA--AAGTGCTGCag 3'
2735 - 2754 132.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30505474 5 COSMIC
COSN30172954 15 COSMIC
COSN26567728 23 COSMIC
COSN31558939 31 COSMIC
COSN31534401 32 COSMIC
COSN30165752 39 COSMIC
COSN16219647 41 COSMIC
COSN30193816 56 COSMIC
COSN26354532 69 COSMIC
COSN20086523 131 COSMIC
COSN31542184 180 COSMIC
COSN23881671 425 COSMIC
COSN26560648 683 COSMIC
COSN26580326 716 COSMIC
COSN31546602 720 COSMIC
COSN31549451 726 COSMIC
COSN30169875 742 COSMIC
COSN30176912 764 COSMIC
COSN26568044 846 COSMIC
COSN32057653 866 COSMIC
COSN26635327 868 COSMIC
COSN31549042 929 COSMIC
COSN20090987 969 COSMIC
COSN28637467 977 COSMIC
COSN27165667 1010 COSMIC
COSN1940288 1473 COSMIC
COSN29794769 1724 COSMIC
COSN9543541 1845 COSMIC
COSN21722304 1851 COSMIC
COSN24514714 1855 COSMIC
COSN4913564 1942 COSMIC
COSN20589200 1983 COSMIC
COSN6761039 2019 COSMIC
COSN31813295 2491 COSMIC
COSN31813296 2497 COSMIC
COSN9718285 3027 COSMIC
COSN6426457 3132 COSMIC
COSN9543542 3260 COSMIC
COSN32057211 3309 COSMIC
COSN1940289 3349 COSMIC
COSN1274552 3931 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs372020069 5 dbSNP
rs779045904 7 dbSNP
rs200028313 21 dbSNP
rs1232255395 22 dbSNP
rs1440192095 23 dbSNP
rs758620792 25 dbSNP
rs879778486 25 dbSNP
rs1383090020 32 dbSNP
rs780176350 35 dbSNP
rs1244152868 39 dbSNP
rs369652191 49 dbSNP
rs1449341263 50 dbSNP
rs776574470 50 dbSNP
rs1328215923 61 dbSNP
rs542062127 61 dbSNP
rs560137101 62 dbSNP
rs1448925386 67 dbSNP
rs1046718 68 dbSNP
rs1392724736 70 dbSNP
rs1046719 71 dbSNP
rs527472591 72 dbSNP
rs773009579 73 dbSNP
rs146000049 75 dbSNP
rs1046720 77 dbSNP
rs1306372903 80 dbSNP
rs1380749499 88 dbSNP
rs1160063052 89 dbSNP
rs1372068049 97 dbSNP
rs1437478580 98 dbSNP
rs912370575 99 dbSNP
rs762228451 103 dbSNP
rs944830687 105 dbSNP
rs1046722 122 dbSNP
rs6804618 123 dbSNP
rs900540310 143 dbSNP
rs1287234344 147 dbSNP
rs3659 147 dbSNP
rs1348743777 159 dbSNP
rs1046725 160 dbSNP
rs1213405698 161 dbSNP
rs1301208251 163 dbSNP
rs1404314028 165 dbSNP
rs3662 168 dbSNP
rs1417659184 171 dbSNP
rs1406716995 172 dbSNP
rs1172868183 179 dbSNP
rs1478716086 181 dbSNP
rs1375476803 184 dbSNP
rs1005475822 189 dbSNP
rs1046727 194 dbSNP
rs1024507274 195 dbSNP
rs7614370 207 dbSNP
rs1232357168 214 dbSNP
rs1445638199 223 dbSNP
rs185080719 229 dbSNP
rs1220095243 234 dbSNP
rs1473192747 236 dbSNP
rs1001331218 239 dbSNP
rs1223017485 241 dbSNP
rs548057843 244 dbSNP
rs1341001078 245 dbSNP
rs1046728 248 dbSNP
rs1280034561 250 dbSNP
rs1428378307 251 dbSNP
rs1034479411 252 dbSNP
rs957037316 253 dbSNP
rs1318353408 259 dbSNP
rs566174088 276 dbSNP
rs1020170221 285 dbSNP
rs1175018548 287 dbSNP
rs1046735 292 dbSNP
rs967295089 293 dbSNP
rs1424880070 298 dbSNP
rs987101230 299 dbSNP
rs1046736 300 dbSNP
rs1474625294 308 dbSNP
rs1241950638 311 dbSNP
rs912435142 318 dbSNP
rs1424082204 319 dbSNP
rs1046737 325 dbSNP
rs1261523763 327 dbSNP
rs1467118209 334 dbSNP
rs1318702997 350 dbSNP
rs942522796 351 dbSNP
rs540013981 353 dbSNP
rs1212784604 377 dbSNP
rs974865807 386 dbSNP
rs1353391265 392 dbSNP
rs1284529496 395 dbSNP
rs1449976508 403 dbSNP
rs1448174488 408 dbSNP
rs558355683 416 dbSNP
rs1335675970 420 dbSNP
rs112895397 424 dbSNP
rs115360023 425 dbSNP
rs1049062942 430 dbSNP
rs759780366 435 dbSNP
rs1279226255 440 dbSNP
rs756005091 459 dbSNP
rs1260271342 460 dbSNP
rs1320514834 461 dbSNP
rs1458250483 465 dbSNP
rs537501383 467 dbSNP
rs1046402144 469 dbSNP
rs555478640 477 dbSNP
rs146911796 481 dbSNP
rs541799645 487 dbSNP
rs1229749501 496 dbSNP
rs1235822823 503 dbSNP
rs1313912634 507 dbSNP
rs1485431132 514 dbSNP
rs148346857 515 dbSNP
rs1440868271 523 dbSNP
rs190802764 525 dbSNP
rs1354404800 529 dbSNP
rs545618992 540 dbSNP
rs1263615789 550 dbSNP
rs1478708916 551 dbSNP
rs1011266391 554 dbSNP
rs1163136639 558 dbSNP
rs1166057650 559 dbSNP
rs1418642558 569 dbSNP
rs1252955106 596 dbSNP
rs1414984603 602 dbSNP
rs749194279 607 dbSNP
rs1177518825 627 dbSNP
rs1247207863 630 dbSNP
rs1223749046 640 dbSNP
rs1489790423 655 dbSNP
rs1290817949 657 dbSNP
rs1373160631 660 dbSNP
rs967443650 668 dbSNP
rs529256039 669 dbSNP
rs1019918270 670 dbSNP
rs1342731073 672 dbSNP
rs4638940 683 dbSNP
rs1407341000 684 dbSNP
rs745991094 695 dbSNP
rs1302873367 698 dbSNP
rs922026991 699 dbSNP
rs1346262069 700 dbSNP
rs1365683624 712 dbSNP
rs1157278051 722 dbSNP
rs1418562073 724 dbSNP
rs543068873 728 dbSNP
rs1201465358 729 dbSNP
rs1276587792 730 dbSNP
rs1268128146 732 dbSNP
rs1216996735 743 dbSNP
rs1489151674 756 dbSNP
rs1258581110 760 dbSNP
rs952137661 763 dbSNP
rs561568371 764 dbSNP
rs907916108 767 dbSNP
rs940680723 770 dbSNP
rs1400983634 771 dbSNP
rs1387664450 773 dbSNP
rs1045983387 774 dbSNP
rs138220843 777 dbSNP
rs1178621093 782 dbSNP
rs879219177 782 dbSNP
rs116698093 786 dbSNP
rs893285425 787 dbSNP
rs1430071027 803 dbSNP
rs1259445462 805 dbSNP
rs1185746526 807 dbSNP
rs1483344446 810 dbSNP
rs566381737 814 dbSNP
rs4638939 817 dbSNP
rs1322299666 821 dbSNP
rs902857897 822 dbSNP
rs1293833743 824 dbSNP
rs1380088090 825 dbSNP
rs1382033551 825 dbSNP
rs1338956174 830 dbSNP
rs1008271715 833 dbSNP
rs551993734 834 dbSNP
rs114305365 846 dbSNP
rs114265067 849 dbSNP
rs1158753847 853 dbSNP
rs1192125840 855 dbSNP
rs1424176086 862 dbSNP
rs1046745 866 dbSNP
rs1181430031 883 dbSNP
rs1026844328 889 dbSNP
rs3204142 892 dbSNP
rs1238295719 903 dbSNP
rs1197071690 911 dbSNP
rs1317998076 914 dbSNP
rs1250143216 924 dbSNP
rs1227065846 925 dbSNP
rs1332110184 928 dbSNP
rs952521912 933 dbSNP
rs984908386 950 dbSNP
rs555822633 957 dbSNP
rs1301946720 960 dbSNP
rs1370299746 965 dbSNP
rs907911118 968 dbSNP
rs546730158 969 dbSNP
rs1332064422 975 dbSNP
rs149774321 982 dbSNP
rs77592848 982 dbSNP
rs1394159455 994 dbSNP
rs1167331527 999 dbSNP
rs1351694815 1001 dbSNP
rs1204842439 1009 dbSNP
rs1386913817 1011 dbSNP
rs1161247311 1018 dbSNP
rs1443592074 1020 dbSNP
rs928639475 1030 dbSNP
rs937611245 1033 dbSNP
rs115183495 1038 dbSNP
rs1249033843 1042 dbSNP
rs765874256 1045 dbSNP
rs568026290 1050 dbSNP
rs78440408 1051 dbSNP
rs1244261945 1069 dbSNP
rs1453744192 1074 dbSNP
rs1280360033 1082 dbSNP
rs1241264109 1089 dbSNP
rs1334117628 1095 dbSNP
rs572027180 1098 dbSNP
rs77016548 1106 dbSNP
rs1007909737 1112 dbSNP
rs557535120 1117 dbSNP
rs1423785153 1123 dbSNP
rs1360694801 1127 dbSNP
rs575821319 1132 dbSNP
rs1468148211 1141 dbSNP
rs1157698332 1145 dbSNP
rs1481020596 1146 dbSNP
rs1391881602 1152 dbSNP
rs1407479600 1163 dbSNP
rs1285201192 1166 dbSNP
rs752328450 1169 dbSNP
rs543184522 1170 dbSNP
rs1041139550 1176 dbSNP
rs1348588606 1178 dbSNP
rs1278991411 1179 dbSNP
rs1324337557 1181 dbSNP
rs760260748 1182 dbSNP
rs1390502389 1191 dbSNP
rs1347259794 1196 dbSNP
rs201071992 1197 dbSNP
rs557271685 1202 dbSNP
rs1026896960 1206 dbSNP
rs1311549059 1207 dbSNP
rs9222 1208 dbSNP
rs1004024637 1218 dbSNP
rs1470670926 1221 dbSNP
rs753610100 1224 dbSNP
rs368715352 1225 dbSNP
rs1358775925 1226 dbSNP
rs1015021167 1227 dbSNP
rs1195819670 1227 dbSNP
rs1271055480 1228 dbSNP
rs962466759 1230 dbSNP
rs981530572 1233 dbSNP
rs1325836495 1236 dbSNP
rs1199274833 1239 dbSNP
rs1222884050 1240 dbSNP
rs1362364830 1241 dbSNP
rs1271676571 1243 dbSNP
rs1036136984 1246 dbSNP
rs1046766 1247 dbSNP
rs1046767 1251 dbSNP
rs1403328615 1259 dbSNP
rs1174862315 1260 dbSNP
rs17091614 1261 dbSNP
rs533668597 1263 dbSNP
rs947577221 1264 dbSNP
rs1169952333 1265 dbSNP
rs977532681 1268 dbSNP
rs577646430 1281 dbSNP
rs754666942 1282 dbSNP
rs1203150316 1284 dbSNP
rs539245654 1284 dbSNP
rs1307958300 1285 dbSNP
rs570304082 1286 dbSNP
rs1275028592 1297 dbSNP
rs1040796043 1298 dbSNP
rs1338567110 1313 dbSNP
rs1315278958 1315 dbSNP
rs1454282863 1322 dbSNP
rs1380163664 1323 dbSNP
rs1335431057 1327 dbSNP
rs1442315783 1330 dbSNP
rs564631531 1331 dbSNP
rs1408560246 1340 dbSNP
rs778875415 1340 dbSNP
rs77971940 1345 dbSNP
rs1383643617 1357 dbSNP
rs1048359847 1360 dbSNP
rs1481037411 1361 dbSNP
rs1046777 1364 dbSNP
rs1234515945 1374 dbSNP
rs16658 1375 dbSNP
rs1202409427 1378 dbSNP
rs888334902 1381 dbSNP
rs1292180844 1385 dbSNP
rs1046779 1386 dbSNP
rs1356750575 1393 dbSNP
rs1313931559 1395 dbSNP
rs1231695184 1404 dbSNP
rs1291209662 1406 dbSNP
rs1374955283 1407 dbSNP
rs1015865811 1408 dbSNP
rs1219149423 1413 dbSNP
rs1046781 1415 dbSNP
rs1003401441 1423 dbSNP
rs779999587 1427 dbSNP
rs534776477 1429 dbSNP
rs14784 1431 dbSNP
rs1363935781 1434 dbSNP
rs1164415132 1435 dbSNP
rs747193585 1436 dbSNP
rs1419720647 1441 dbSNP
rs1256261519 1443 dbSNP
rs1410303484 1444 dbSNP
rs1486445292 1444 dbSNP
rs1046782 1445 dbSNP
rs369126764 1450 dbSNP
rs9843578 1456 dbSNP
rs1478375950 1457 dbSNP
rs1224350826 1479 dbSNP
rs1489818285 1480 dbSNP
rs1290567080 1481 dbSNP
rs1281115239 1482 dbSNP
rs1318166563 1488 dbSNP
rs1304187856 1490 dbSNP
rs991427249 1496 dbSNP
rs572954775 1497 dbSNP
rs1284493307 1498 dbSNP
rs867383138 1500 dbSNP
rs796957894 1505 dbSNP
rs1344071379 1507 dbSNP
rs539397739 1513 dbSNP
rs1293124558 1517 dbSNP
rs796746230 1520 dbSNP
rs796159838 1525 dbSNP
rs557612504 1529 dbSNP
rs968973173 1529 dbSNP
rs977685847 1530 dbSNP
rs560353239 1532 dbSNP
rs1129168 1534 dbSNP
rs569306484 1535 dbSNP
rs944212522 1537 dbSNP
rs1297489153 1539 dbSNP
rs1266459476 1540 dbSNP
rs1324557907 1541 dbSNP
rs537270360 1545 dbSNP
rs976916705 1548 dbSNP
rs369108797 1558 dbSNP
rs1258600393 1560 dbSNP
rs9109 1568 dbSNP
rs932317929 1570 dbSNP
rs1322067100 1579 dbSNP
rs1383140041 1581 dbSNP
rs770402092 1581 dbSNP
rs1048117899 1586 dbSNP
rs1287405010 1603 dbSNP
rs1208238237 1609 dbSNP
rs1434448454 1609 dbSNP
rs1178462402 1613 dbSNP
rs1468131740 1619 dbSNP
rs1377027146 1623 dbSNP
rs1170816835 1637 dbSNP
rs34266682 1637 dbSNP
rs573688541 1642 dbSNP
rs1488423733 1643 dbSNP
rs1461349462 1669 dbSNP
rs1036941638 1672 dbSNP
rs182166405 1675 dbSNP
rs143690612 1677 dbSNP
rs879713304 1677 dbSNP
rs1260088657 1692 dbSNP
rs1428440176 1698 dbSNP
rs767185267 1698 dbSNP
rs906365654 1701 dbSNP
rs1228607858 1702 dbSNP
rs1309692662 1703 dbSNP
rs559436312 1704 dbSNP
rs186292121 1707 dbSNP
rs1383842611 1711 dbSNP
rs1338730434 1716 dbSNP
rs1450563666 1718 dbSNP
rs1401333568 1719 dbSNP
rs1173128150 1721 dbSNP
rs894536404 1731 dbSNP
rs1361357103 1747 dbSNP
rs1167759759 1749 dbSNP
rs773923309 1751 dbSNP
rs1290347109 1762 dbSNP
rs1386721581 1767 dbSNP
rs1181139866 1768 dbSNP
rs1021606270 1776 dbSNP
rs879832212 1783 dbSNP
rs968688360 1785 dbSNP
rs781045160 1789 dbSNP
rs999546749 1789 dbSNP
rs1272883856 1792 dbSNP
rs1373138319 1797 dbSNP
rs1031890516 1799 dbSNP
rs769533112 1800 dbSNP
rs763559413 1808 dbSNP
rs771554397 1809 dbSNP
rs1317436994 1818 dbSNP
rs145178969 1824 dbSNP
rs921418787 1826 dbSNP
rs774887398 1828 dbSNP
rs1307116521 1831 dbSNP
rs983868988 1831 dbSNP
rs1425068513 1833 dbSNP
rs1353889523 1837 dbSNP
rs1161343757 1841 dbSNP
rs1472166078 1845 dbSNP
rs1183399471 1846 dbSNP
rs1363918738 1846 dbSNP
rs563949923 1847 dbSNP
rs1259322940 1848 dbSNP
rs1485776193 1851 dbSNP
rs531203785 1853 dbSNP
rs549572665 1854 dbSNP
rs75759102 1855 dbSNP
rs1453141518 1857 dbSNP
rs1193025910 1858 dbSNP
rs1381009168 1863 dbSNP
rs1421091004 1870 dbSNP
rs939666525 1879 dbSNP
rs1294206684 1887 dbSNP
rs1037357040 1890 dbSNP
rs1355946044 1901 dbSNP
rs1261333689 1902 dbSNP
rs1241286772 1909 dbSNP
rs1348479141 1911 dbSNP
rs561287865 1913 dbSNP
rs760337426 1919 dbSNP
rs1347221210 1922 dbSNP
rs939196604 1922 dbSNP
rs1404352620 1924 dbSNP
rs1385253511 1925 dbSNP
rs1054997503 1927 dbSNP
rs894966512 1939 dbSNP
rs879151938 1942 dbSNP
rs1012996763 1947 dbSNP
rs1043114966 1969 dbSNP
rs1197223506 1972 dbSNP
rs1451191596 1973 dbSNP
rs1438626322 1977 dbSNP
rs1206967673 1982 dbSNP
rs1327233857 1992 dbSNP
rs1267401688 1998 dbSNP
rs116730258 1999 dbSNP
rs542892738 2003 dbSNP
rs753648808 2008 dbSNP
rs1272810644 2013 dbSNP
rs571339431 2018 dbSNP
rs965685083 2025 dbSNP
rs1319955833 2028 dbSNP
rs1316004293 2032 dbSNP
rs998825127 2038 dbSNP
rs145877084 2049 dbSNP
rs550530355 2054 dbSNP
rs1432097195 2065 dbSNP
rs954186256 2066 dbSNP
rs1467476453 2072 dbSNP
rs909590813 2073 dbSNP
rs3839084 2078 dbSNP
rs397792246 2078 dbSNP
rs1481681133 2081 dbSNP
rs368788142 2089 dbSNP
rs939308415 2090 dbSNP
rs1276424113 2116 dbSNP
rs1218427177 2118 dbSNP
rs1407467877 2120 dbSNP
rs1271553467 2122 dbSNP
rs745625545 2131 dbSNP
rs1225779586 2133 dbSNP
rs1364033012 2134 dbSNP
rs1054965428 2138 dbSNP
rs916449252 2139 dbSNP
rs1165287617 2140 dbSNP
rs1419843416 2148 dbSNP
rs1332834610 2149 dbSNP
rs1459799228 2152 dbSNP
rs1414238999 2153 dbSNP
rs536907573 2154 dbSNP
rs1325200783 2156 dbSNP
rs555540453 2166 dbSNP
rs1447834707 2168 dbSNP
rs1389799821 2173 dbSNP
rs1443696867 2174 dbSNP
rs189937859 2175 dbSNP
rs35185640 2181 dbSNP
rs372947043 2181 dbSNP
rs141297484 2189 dbSNP
rs904584433 2193 dbSNP
rs1209399038 2198 dbSNP
rs1438159436 2208 dbSNP
rs553089498 2219 dbSNP
rs1295497904 2220 dbSNP
rs1340935781 2222 dbSNP
rs11555145 2224 dbSNP
rs1315385869 2228 dbSNP
rs577743559 2229 dbSNP
rs1247514149 2230 dbSNP
rs1376401008 2231 dbSNP
rs1333207712 2233 dbSNP
rs1447894040 2237 dbSNP
rs1355648804 2242 dbSNP
rs1233175825 2243 dbSNP
rs1259222340 2244 dbSNP
rs35556393 2245 dbSNP
rs1428229398 2248 dbSNP
rs1370182220 2256 dbSNP
rs1164514936 2258 dbSNP
rs200646253 2265 dbSNP
rs1407135379 2266 dbSNP
rs1411775069 2269 dbSNP
rs1181392166 2282 dbSNP
rs758342416 2286 dbSNP
rs545043978 2290 dbSNP
rs1179740154 2294 dbSNP
rs901167141 2298 dbSNP
rs1202450087 2301 dbSNP
rs998480874 2302 dbSNP
rs150153979 2305 dbSNP
rs1190402317 2312 dbSNP
rs889959094 2324 dbSNP
rs1290826219 2325 dbSNP
rs1005698950 2327 dbSNP
rs1259330291 2333 dbSNP
rs1474128421 2335 dbSNP
rs1016704527 2338 dbSNP
rs1350309795 2338 dbSNP
rs1420087081 2351 dbSNP
rs1303955745 2355 dbSNP
rs961183895 2358 dbSNP
rs1167622041 2360 dbSNP
rs180748535 2364 dbSNP
rs1434935982 2371 dbSNP
rs1034733221 2396 dbSNP
rs1401423632 2397 dbSNP
rs114565695 2398 dbSNP
rs990705559 2400 dbSNP
rs561577582 2401 dbSNP
rs528671675 2403 dbSNP
rs1201346120 2409 dbSNP
rs979206634 2411 dbSNP
rs1245775620 2416 dbSNP
rs1215880000 2427 dbSNP
rs1227138908 2431 dbSNP
rs75602200 2431 dbSNP
rs1329116225 2433 dbSNP
rs1053604263 2437 dbSNP
rs147170548 2440 dbSNP
rs1272357452 2446 dbSNP
rs1293214658 2458 dbSNP
rs1431541307 2471 dbSNP
rs1390973850 2474 dbSNP
rs1318654339 2486 dbSNP
rs1456594602 2490 dbSNP
rs1312900539 2491 dbSNP
rs111516701 2492 dbSNP
rs1424016431 2492 dbSNP
rs867902897 2494 dbSNP
rs1186796386 2495 dbSNP
rs1465838182 2501 dbSNP
rs1207585766 2505 dbSNP
rs1245629420 2505 dbSNP
rs1213252201 2507 dbSNP
rs1278414622 2509 dbSNP
rs781317134 2516 dbSNP
rs1264375011 2526 dbSNP
rs1485482755 2539 dbSNP
rs1310859909 2542 dbSNP
rs933937428 2543 dbSNP
rs1215343002 2550 dbSNP
rs1367648297 2553 dbSNP
rs1318557594 2559 dbSNP
rs1434471726 2560 dbSNP
rs544225192 2562 dbSNP
rs532433173 2568 dbSNP
rs140268545 2569 dbSNP
rs1017127564 2576 dbSNP
rs897314308 2581 dbSNP
rs1476350041 2582 dbSNP
rs770217934 2585 dbSNP
rs1444774186 2587 dbSNP
rs1257446476 2593 dbSNP
rs35457022 2598 dbSNP
rs960406816 2611 dbSNP
rs1255730670 2619 dbSNP
rs1434754589 2620 dbSNP
rs1295751358 2623 dbSNP
rs1227756163 2626 dbSNP
rs1383669290 2628 dbSNP
rs1174997213 2629 dbSNP
rs530881024 2631 dbSNP
rs1373180752 2632 dbSNP
rs1378386569 2644 dbSNP
rs1431465393 2648 dbSNP
rs990424435 2648 dbSNP
rs1368315583 2651 dbSNP
rs1433715790 2655 dbSNP
rs373188639 2665 dbSNP
rs548996427 2666 dbSNP
rs1023522756 2674 dbSNP
rs1319381852 2680 dbSNP
rs1184821729 2685 dbSNP
rs967959680 2697 dbSNP
rs1256086331 2705 dbSNP
rs1183334476 2710 dbSNP
rs1484278910 2717 dbSNP
rs1272714107 2720 dbSNP
rs1204763020 2725 dbSNP
rs1357344560 2738 dbSNP
rs1267255623 2757 dbSNP
rs796294461 2759 dbSNP
rs1339740319 2763 dbSNP
rs771375810 2764 dbSNP
rs935126029 2766 dbSNP
rs988912016 2769 dbSNP
rs922653162 2771 dbSNP
rs1405137980 2774 dbSNP
rs1301362884 2777 dbSNP
rs151315802 2782 dbSNP
rs1217713421 2788 dbSNP
rs1457022686 2789 dbSNP
rs1368394836 2791 dbSNP
rs1284681344 2794 dbSNP
rs185840735 2795 dbSNP
rs1448571854 2803 dbSNP
rs1181943623 2806 dbSNP
rs1213419586 2808 dbSNP
rs1049784133 2810 dbSNP
rs911209097 2812 dbSNP
rs34733757 2819 dbSNP
rs1208135406 2824 dbSNP
rs1355785433 2827 dbSNP
rs1230103487 2835 dbSNP
rs1241396260 2837 dbSNP
rs941634905 2838 dbSNP
rs1039020822 2842 dbSNP
rs1233724186 2847 dbSNP
rs1332450925 2851 dbSNP
rs1454663468 2865 dbSNP
rs775038096 2866 dbSNP
rs796673301 2870 dbSNP
rs150074324 2879 dbSNP
rs1321996625 2880 dbSNP
rs1194880710 2881 dbSNP
rs571381257 2887 dbSNP
rs1392793050 2889 dbSNP
rs1056235686 2892 dbSNP
rs1158810740 2895 dbSNP
rs1478592200 2897 dbSNP
rs2342070 2905 dbSNP
rs1011939870 2907 dbSNP
rs1451278134 2913 dbSNP
rs1248683320 2916 dbSNP
rs1210678298 2917 dbSNP
rs1410577767 2923 dbSNP
rs1023295655 2931 dbSNP
rs1399281987 2932 dbSNP
rs1200817397 2936 dbSNP
rs1346911157 2943 dbSNP
rs1272692257 2949 dbSNP
rs557001826 2955 dbSNP
rs1395783823 2962 dbSNP
rs1443762143 2965 dbSNP
rs1323973295 2967 dbSNP
rs1370422977 2968 dbSNP
rs1240004725 2970 dbSNP
rs1281448360 2971 dbSNP
rs376276643 2977 dbSNP
rs967678613 2981 dbSNP
rs1432276169 2983 dbSNP
rs1387068790 2991 dbSNP
rs1320525747 3000 dbSNP
rs1415384453 3006 dbSNP
rs1404744491 3010 dbSNP
rs1283295364 3019 dbSNP
rs1171225148 3021 dbSNP
rs79962700 3038 dbSNP
rs2029003 3040 dbSNP
rs1250571541 3041 dbSNP
rs1467669376 3044 dbSNP
rs956582362 3046 dbSNP
rs1210788760 3050 dbSNP
rs1052100 3053 dbSNP
rs1276192235 3057 dbSNP
rs1199664089 3059 dbSNP
rs3192504 3062 dbSNP
rs1342358416 3073 dbSNP
rs183838020 3075 dbSNP
rs1468294059 3078 dbSNP
rs1225532463 3080 dbSNP
rs1363896551 3090 dbSNP
rs145038146 3091 dbSNP
rs1052102 3092 dbSNP
rs955463367 3093 dbSNP
rs1158286792 3096 dbSNP
rs1342790257 3108 dbSNP
rs762187838 3110 dbSNP
rs985540929 3128 dbSNP
rs1434553407 3131 dbSNP
rs36098029 3135 dbSNP
rs1371397554 3142 dbSNP
rs768105618 3142 dbSNP
rs1170762631 3149 dbSNP
rs1389579599 3150 dbSNP
rs767983361 3150 dbSNP
rs545383482 3152 dbSNP
rs1473697213 3163 dbSNP
rs34255271 3163 dbSNP
rs1235675082 3171 dbSNP
rs941311325 3178 dbSNP
rs1038618911 3179 dbSNP
rs1202535794 3183 dbSNP
rs565093097 3187 dbSNP
rs1289892637 3190 dbSNP
rs1229552806 3193 dbSNP
rs1359064365 3195 dbSNP
rs146815533 3213 dbSNP
rs1414518563 3216 dbSNP
rs6802607 3225 dbSNP
rs1408187533 3236 dbSNP
rs562940468 3237 dbSNP
rs1354162932 3246 dbSNP
rs200015581 3246 dbSNP
rs1407207614 3247 dbSNP
rs1411521631 3249 dbSNP
rs1164172129 3253 dbSNP
rs1472892229 3257 dbSNP
rs1330989974 3260 dbSNP
rs1334133187 3269 dbSNP
rs188333623 3272 dbSNP
rs1179756679 3279 dbSNP
rs191655273 3283 dbSNP
rs1441834548 3288 dbSNP
rs1482492924 3290 dbSNP
rs1436859794 3295 dbSNP
rs1011984278 3299 dbSNP
rs1335291046 3312 dbSNP
rs1235026248 3316 dbSNP
rs1288324544 3319 dbSNP
rs750835525 3325 dbSNP
rs1044758349 3327 dbSNP
rs1271150181 3328 dbSNP
rs1355587316 3336 dbSNP
rs1195813489 3343 dbSNP
rs1226954461 3347 dbSNP
rs1372855501 3350 dbSNP
rs1294403185 3368 dbSNP
rs1438660557 3369 dbSNP
rs903531126 3374 dbSNP
rs1325347208 3385 dbSNP
rs1435717823 3388 dbSNP
rs549288611 3391 dbSNP
rs1156670395 3398 dbSNP
rs1418355770 3411 dbSNP
rs567472999 3412 dbSNP
rs1258632034 3413 dbSNP
rs1192618132 3415 dbSNP
rs1030929112 3420 dbSNP
rs1245582459 3421 dbSNP
rs1208812221 3425 dbSNP
rs1465698026 3426 dbSNP
rs555209858 3430 dbSNP
rs1186279374 3439 dbSNP
rs1316734606 3449 dbSNP
rs1302215102 3454 dbSNP
rs1221119490 3456 dbSNP
rs1365766757 3464 dbSNP
rs1302692819 3470 dbSNP
rs1435986565 3479 dbSNP
rs1390741867 3482 dbSNP
rs1318507566 3488 dbSNP
rs1452757551 3503 dbSNP
rs1178004062 3512 dbSNP
rs997422647 3512 dbSNP
rs528353627 3513 dbSNP
rs766265954 3517 dbSNP
rs546827544 3521 dbSNP
rs1188625002 3522 dbSNP
rs1450863601 3533 dbSNP
rs371520480 3542 dbSNP
rs1462945594 3545 dbSNP
rs1169716400 3548 dbSNP
rs1394495850 3550 dbSNP
rs1409582794 3554 dbSNP
rs571422344 3555 dbSNP
rs1357635117 3558 dbSNP
rs759753181 3559 dbSNP
rs6769337 3562 dbSNP
rs557085444 3563 dbSNP
rs911272863 3571 dbSNP
rs1381536605 3573 dbSNP
rs764936201 3582 dbSNP
rs1464406336 3585 dbSNP
rs546691139 3586 dbSNP
rs1252544040 3590 dbSNP
rs1431077371 3592 dbSNP
rs568871287 3593 dbSNP
rs879663309 3595 dbSNP
rs1203965953 3596 dbSNP
rs1169143522 3603 dbSNP
rs535889608 3610 dbSNP
rs148098967 3613 dbSNP
rs541242403 3614 dbSNP
rs1209086765 3626 dbSNP
rs1255977556 3630 dbSNP
rs1206080659 3631 dbSNP
rs1429611952 3643 dbSNP
rs115489804 3648 dbSNP
rs918584536 3652 dbSNP
rs1371375889 3657 dbSNP
rs1322240911 3661 dbSNP
rs930246011 3663 dbSNP
rs540475188 3664 dbSNP
rs114996266 3665 dbSNP
rs1174361944 3666 dbSNP
rs1411208543 3666 dbSNP
rs1052130 3667 dbSNP
rs377104878 3673 dbSNP
rs15614 3674 dbSNP
rs544332199 3681 dbSNP
rs1474526844 3688 dbSNP
rs1310842386 3691 dbSNP
rs1417544654 3694 dbSNP
rs1401309667 3700 dbSNP
rs903583403 3702 dbSNP
rs562820479 3703 dbSNP
rs936420647 3704 dbSNP
rs1052554051 3709 dbSNP
rs1488869596 3715 dbSNP
rs892126521 3717 dbSNP
rs997877839 3721 dbSNP
rs1324652478 3724 dbSNP
rs752910075 3730 dbSNP
rs756428301 3745 dbSNP
rs1230068028 3749 dbSNP
rs530183679 3753 dbSNP
rs1348240740 3761 dbSNP
rs1327819965 3767 dbSNP
rs1219421783 3768 dbSNP
rs888954370 3781 dbSNP
rs143651154 3782 dbSNP
rs1018387147 3789 dbSNP
rs1208349485 3791 dbSNP
rs1394412376 3792 dbSNP
rs778245267 3793 dbSNP
rs1160347093 3794 dbSNP
rs749712782 3799 dbSNP
rs757763522 3806 dbSNP
rs1473814537 3813 dbSNP
rs1362244734 3816 dbSNP
rs963150467 3820 dbSNP
rs1434001392 3824 dbSNP
rs974169563 3839 dbSNP
rs528881407 3846 dbSNP
rs560456702 3847 dbSNP
rs1207291432 3852 dbSNP
rs114072668 3859 dbSNP
rs1464852879 3860 dbSNP
rs746528696 3866 dbSNP
rs1194269049 3867 dbSNP
rs1036486748 3868 dbSNP
rs546915737 3875 dbSNP
rs918142619 3876 dbSNP
rs1439594842 3883 dbSNP
rs948236371 3883 dbSNP
rs980934841 3888 dbSNP
rs28463065 3890 dbSNP
rs1173305145 3893 dbSNP
rs936456020 3896 dbSNP
rs1383190073 3909 dbSNP
rs1454086650 3913 dbSNP
rs1290438945 3922 dbSNP
rs565117577 3933 dbSNP
rs1382606446 3940 dbSNP
rs1191826392 3942 dbSNP
rs9837782 3952 dbSNP
rs1325975132 3959 dbSNP
rs1190381110 3960 dbSNP
rs11555147 3967 dbSNP
rs765531265 3974 dbSNP
rs892135237 3974 dbSNP
rs1283216358 3976 dbSNP
rs1200838403 3980 dbSNP
rs932962356 3983 dbSNP
rs374193465 3984 dbSNP
rs1231585746 3988 dbSNP
rs1365356842 3989 dbSNP
rs767980811 3997 dbSNP
rs1300115691 4004 dbSNP
rs1317164344 4007 dbSNP
rs550721011 4012 dbSNP
rs1172064915 4013 dbSNP
rs1434362762 4023 dbSNP
rs1259340579 4040 dbSNP
rs1170572895 4051 dbSNP
rs1007471378 4071 dbSNP
rs751543679 4075 dbSNP
rs1016130910 4077 dbSNP
rs569052648 4077 dbSNP
rs183877413 4078 dbSNP
rs1248120893 4079 dbSNP
rs1209643407 4080 dbSNP
rs1342467000 4081 dbSNP
rs1214923768 4082 dbSNP
rs1276066548 4083 dbSNP
rs1254946365 4084 dbSNP
rs536301982 4087 dbSNP
rs1270172451 4096 dbSNP
rs1245963017 4100 dbSNP
rs1357708849 4103 dbSNP
rs1311476532 4104 dbSNP
rs1414327219 4110 dbSNP
rs1330964138 4114 dbSNP
rs1467232225 4114 dbSNP
rs1408345832 4117 dbSNP
rs1418663934 4117 dbSNP
rs1190720002 4118 dbSNP
rs1473749374 4124 dbSNP
rs1415336289 4131 dbSNP
rs1025686221 4132 dbSNP
rs547877658 4133 dbSNP
rs951476513 4135 dbSNP
rs992088885 4137 dbSNP
rs1024918823 4140 dbSNP
rs1290002938 4153 dbSNP
rs149253912 4153 dbSNP
rs969635561 4153 dbSNP
rs1337591523 4156 dbSNP
rs1291758589 4160 dbSNP
rs115619392 4164 dbSNP
rs1351332505 4170 dbSNP
rs925475620 4189 dbSNP
rs1440084411 4199 dbSNP
rs1353962045 4201 dbSNP
rs1456616596 4204 dbSNP
rs1298963607 4206 dbSNP
rs1462885783 4207 dbSNP
rs1392215388 4235 dbSNP
rs534260575 4240 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauACACGACGAu 5'
                      | ||||||| 
Target 5' uuucuuuuuucuUCUGCUGCUu 3'
13 - 34
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000327134.3 | 3UTR | UUAUCUUCUCUUUUUCUUUUUUCUUCUGCUGCUUUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000327134.3 | 3UTR | UUAUCUUCUCUUUUUCUUUUUUCUUCUGCUGCUUUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.463 3.8e-3 0.426 7.5e-3 32 Click to see details
GSE28260 Renal cortex and medulla -0.606 1.4e-2 -0.599 1.5e-2 13 Click to see details
GSE38226 Liver fibrosis 0.452 2.0e-2 0.504 9.9e-3 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.397 4.2e-2 0.480 1.6e-2 20 Click to see details
GSE21849 B cell lymphoma 0.313 4.9e-2 0.233 1.1e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.347 9.4e-2 -0.326 1.1e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.251 1.2e-1 0.254 1.2e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.245 1.5e-1 0.244 1.5e-1 20 Click to see details
GSE19536 Breast cancer 0.102 1.6e-1 0.083 2.1e-1 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.214 1.6e-1 -0.042 4.2e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.175 2.0e-1 -0.091 3.3e-1 25 Click to see details
GSE28544 Breast cancer -0.172 2.1e-1 -0.356 4.4e-2 24 Click to see details
GSE17306 Multiple myeloma -0.092 2.6e-1 -0.117 2.1e-1 49 Click to see details
GSE17498 Multiple myeloma -0.059 3.6e-1 -0.161 1.6e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.066 3.8e-1 -0.082 3.5e-1 25 Click to see details
GSE21032 Prostate cancer 0.034 3.8e-1 0.029 4.0e-1 83 Click to see details
GSE19350 CNS germ cell tumors -0.096 3.8e-1 0.077 4.1e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.011 4.7e-1 -0.042 3.7e-1 64 Click to see details
GSE14794 Lymphoblastoid cells -0.005 4.8e-1 0.052 3.1e-1 90 Click to see details
GSE19783 ER- ER- breast cancer 0.004 4.9e-1 -0.042 3.6e-1 79 Click to see details
GSE19783 ER- ER- breast cancer 0.004 4.9e-1 -0.042 3.6e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.978 0.01 0.800 0.1 4 Click to see details
CESC 0.998 0.02 1.000 0.5 3 Click to see details
BRCA 0.212 0.03 0.222 0.02 84 Click to see details
LUAD 0.517 0.04 0.476 0.06 12 Click to see details
THCA 0.196 0.07 0.129 0.17 59 Click to see details
HNSC 0.22 0.08 0.289 0.03 42 Click to see details
CHOL -0.438 0.12 -0.450 0.11 9 Click to see details
KIRP -0.206 0.13 -0.249 0.08 32 Click to see details
STAD 0.174 0.17 0.190 0.15 32 Click to see details
BLCA 0.197 0.22 0.337 0.09 18 Click to see details
UCEC 0.184 0.23 0.025 0.46 19 Click to see details
KICH 0.13 0.27 0.103 0.31 25 Click to see details
KIRC 0.054 0.33 0.087 0.24 68 Click to see details
PCPG -0.505 0.33 -0.500 0.33 3 Click to see details
LUSC -0.05 0.38 -0.045 0.39 38 Click to see details
ESCA -0.051 0.44 -0.127 0.35 11 Click to see details
COAD 0.061 0.44 -0.310 0.23 8 Click to see details
LIHC 0.003 0.49 0.014 0.46 49 Click to see details
PRAD -0.001 0.5 0.021 0.44 50 Click to see details
PRAD -0.001 0.5 0.021 0.44 50 Click to see details
PRAD -0.001 0.5 0.021 0.44 50 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
<
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1