miRTarBase - #MIRT132734 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RASSF5   
Synonyms Maxp1, NORE1, NORE1A, NORE1B, RAPL, RASSF3
Description Ras association domain family member 5
Transcript NM_182664   
Other Transcripts NM_182663 , NM_182665   
Expression
Putative miRNA Targets on RASSF5
3'UTR of RASSF5
(miRNA target sites are highlighted)
>RASSF5|NM_182664|3'UTR
   1 ACTTCAGAACTTCCTAACAATCCTGGAAAAAGAGGAGCAGGACAAAATCCAACAAGTGCAAAAGAAGTATGACAAGTTTA
  81 GGCAGAAACTGGAGGAGGCCTTAAGAGAATCCCAGGGCAAACCTGGGTAACCGGTCCTGCTTCCTCTCCTCCTGGTGCAT
 161 TCAGATTTATTTGTATTATTAATTATTATTTTGCAACAGACACTTTTTCTCAGGACATCTCTGGCAGGTGCATTTGTGCC
 241 TGCCCAGCAGTTCCAGCTGTGGCAAAAGTCTCTTCCATGGACAAGTGTTTGCACGAGGGTTCAGCTGTGCCCGCCCCCAG
 321 GCTGTGCCCCACCACAGATTCTGCCAAGGATCAGAACTCATGTGAAACAAACAGCTGACGTCCTCTCTCGATCTGCAAGC
 401 CTTTCACCAACCAAATAGTTGCCTCTCTCGTCACCAAACTGGAACCTCACACCAGCCGGCAAAGGAAGGAAGAAAGGTTT
 481 TAGAGCTGTGTGTTCTTTCTCTGGCATTGATTCCTCTTTGAGTTCTCTTACTTGCCACGTACAGGACCATTATTTATGAG
 561 TGAAAAGTTGTAGCACATTCCTTTTGCAGGTCTGAGCTAAGCCCCTGAAAGCAGGGTAATGCTCATAAAAGGACTGTTCC
 641 CGCGGCCCCAAGGTGCCTGTTGTTCACACTTAAGGGAAGTTTATAAAGCTACTGGCCCCAGATGCTCAGGGTAAGGAGCA
 721 CCAAAGCTGAGGCTGGCTCAGAGATCTCCAGAGAAGCTGCAGCCTGCCCTGGCCCTGGCTCTGGCCCTGGCCCACATTGC
 801 ACATGGAAACCCAAAGGCATATATCTGCGTATGTGTGGTACTTAGTCACATCTTTGTCAACAAACTGTTCGTTTTTAAGT
 881 TACAAATTTGAATTTAATGTTGTCATCATCGTCATGTGTTTCCCCAAAGGGAAGCCAGTCATTGACCATTTAAAAAGTCT
 961 CCTGCTAAGTATGGAAATCAGACAGTAAGAGAAAGCCAAAAAGCAATGCAGAGAAAGGTGTCCAAGCTGTCTTCAGCCTT
1041 CCCCAGCTAAAGAGCAGAGGAGGGCCTGGGCTACTTGGGTTCCCCATCGGCCTCCAGCACTGCCTCCCTCCTCCCACTGC
1121 GACTCTGGGATCTCCAGGTGCTGCCCAAGGAGTTGCCTTGATTACAGAGAGGGGAGCCTCCAATTCGGCCAACTTGGAGT
1201 CCTTTCTGTTTTGAAGCATGGGCCAGACCCGGCACTGCGCTCGGAGAGCCGGTGGGCCTGGCCTCCCCGTCGACCTCAGT
1281 GCCTTTTTGTTTTCAGAGAGAAATAGGAGTAGGGCGAGTTTGCCTGAAGCTCTGCTGCTGGCTTCTCCTGCCAGGAAGTG
1361 AACAATGGCGGCGGTGTGGGAGACAAGGCCAGGAGAGCCCGCGTTCAGTATGGGTTGAGGGTCACAGACCTCCCTCCCAT
1441 CTGGGTGCCTGAGTTTTGACTCCAATCAGTGATACCAGACCACATTGACAGGGAGGATCAAATTCCTGACTTACATTTGC
1521 ACTGGCTTCTTGTTTAGGCTGAATCCTAAAATAAATTAGTCAAAAAATTCCAACAAGTAGCCAGGACTGCAGAGACACTC
1601 CAGTGCAGAGGGAGAAGGACTTGTAATTTTCAAAGCAGGGCTGGTTTTCCAACCCAGCCTCTGAGAAACCATTTCTTTGC
1681 TATCCTCTGCCTTCCCAAGTCCCTCTTGGGTCGGTTCAAGCCCAAGCTTGTTCGTGTAGCTTCAGAAGTTCCCTCTCTGA
1761 CCCAGGCTGAGTCCATACTGCCCCTGATCCCAGAAGGAATGCTGACCCCTCGTCGTATGAACTGTGCATAGTCTCCAGAG
1841 CTTCAAAGGCAACACAAGCTCGCAACTCTAAGATTTTTTTAAACCACAAAAACCCTGGTTAGCCATCTCATGCTCAGCCT
1921 TATCACTTCCCTCCCTTTAGAAACTCTCTCCCTGCTGTATATTAAAGGGAGCAGGTGGAGAGTCATTTTCCTTCGTCCTG
2001 CATGTCTCTAACATTAATAGAAGGCATGGCTCCTGCTGCAACCGCTGTGAATGCTGCTGAGAACCTCCCTCTATGGGGAT
2081 GGCTATTTTATTTTTGAGAAGGAAAAAAAAAGTCATGTATATATACACATAAAGGCATATAGCTATATATAAAGAGATAA
2161 GGGTGTTTATGAAATGAGAAAATTATTGGACAATTCAGACTTTACTAAAGCACAGTTAGACCCAAGGCCTATGCTGAGGT
2241 CTAAACCTCTGAAAAAAGTATAGTATCGAGTACCCGTTCCCTCCCAGAGGTGGGAGTAACTGCTGGTAGTGCCTTCTTTG
2321 GTTGTGTTGCTCAGTGTGTAAGTGTTTGTTTCCAGGATATTTTCTTTTTAAATGTCTTTCTTATATGGGTTTTAAAAAAA
2401 AGTAATAAAAGCCTGTTGCAAAAATGACTCATGTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUAC--ACGACGAu 5'
              ||||: |:||  ||||||| 
Target 5' ctgcAACCGCTGTGAATGCTGCTg 3'
2036 - 2059 164.00 -19.10
2
miRNA  3' guguuugguaauACACGACGAu 5'
                      | ||||||| 
Target 5' tttgcctgaagcTCTGCTGCTg 3'
1319 - 1340 142.00 -10.94
3
miRNA  3' guguuuGGUAAU--ACACGACGAu 5'
                :| ||:  ||||:|||| 
Target 5' gtgcctTCTTTGGTTGTGTTGCTc 3'
2309 - 2332 138.00 -11.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM3400239 5 COSMIC
COSM6358027 26 COSMIC
COSM5379418 35 COSMIC
COSM5379420 36 COSMIC
COSM8771293 39 COSMIC
COSM4576814 42 COSMIC
COSM5645109 42 COSMIC
COSM8582483 48 COSMIC
COSM3803668 65 COSMIC
COSM9259481 65 COSMIC
COSM5958747 73 COSMIC
COSM5758558 74 COSMIC
COSM8604342 76 COSMIC
COSM6497870 77 COSMIC
COSM7465192 82 COSMIC
COSM8051150 82 COSMIC
COSM8381118 94 COSMIC
COSM425150 95 COSMIC
COSM8285031 108 COSMIC
COSM902964 108 COSMIC
COSM7539495 122 COSMIC
COSM8961200 122 COSMIC
COSM7159477 124 COSMIC
COSM6200513 133 COSMIC
COSM7164324 144 COSMIC
COSM1601585 162 COSMIC
COSM4392047 171 COSMIC
COSM3356500 174 COSMIC
COSM8169635 177 COSMIC
COSM1601586 178 COSMIC
COSM8421330 181 COSMIC
COSN30462265 200 COSMIC
COSN17183238 263 COSMIC
COSN15667475 306 COSMIC
COSN29589712 314 COSMIC
COSN15709619 457 COSMIC
COSN26889899 536 COSMIC
COSN31517135 992 COSMIC
COSN20090443 1090 COSMIC
COSN31592670 1187 COSMIC
COSN5736855 1304 COSMIC
COSN31545744 1370 COSMIC
COSN31569192 1373 COSMIC
COSN26585435 1374 COSMIC
COSN31539131 1374 COSMIC
COSN7983797 1518 COSMIC
COSN25138282 1607 COSMIC
COSN23014211 1886 COSMIC
COSN31557037 1949 COSMIC
COSN31660831 1965 COSMIC
COSN31588770 1996 COSMIC
COSN31539856 2045 COSMIC
COSN31514035 2104 COSMIC
COSN30163540 2177 COSMIC
COSN31603227 2188 COSMIC
COSN16130489 2413 COSMIC
COSN31539844 2414 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782097670 9 dbSNP
rs368719396 10 dbSNP
rs1396094779 15 dbSNP
rs781868748 20 dbSNP
rs782502649 36 dbSNP
rs764844474 42 dbSNP
rs1029613389 53 dbSNP
rs782457424 59 dbSNP
rs954068163 65 dbSNP
rs112969377 82 dbSNP
rs782580377 84 dbSNP
rs782230383 86 dbSNP
rs1448051673 93 dbSNP
rs782489549 94 dbSNP
rs372832789 97 dbSNP
rs1247757106 113 dbSNP
rs782253930 117 dbSNP
rs1469978454 124 dbSNP
rs782401148 133 dbSNP
rs782708472 134 dbSNP
rs782174160 150 dbSNP
rs1251818801 158 dbSNP
rs371045571 159 dbSNP
rs557794799 166 dbSNP
rs782703905 174 dbSNP
rs781953270 175 dbSNP
rs370392114 176 dbSNP
rs1441229346 177 dbSNP
rs782374479 187 dbSNP
rs1321080064 191 dbSNP
rs1404259448 194 dbSNP
rs782028367 195 dbSNP
rs782152765 202 dbSNP
rs939076151 217 dbSNP
rs181223559 218 dbSNP
rs1056266621 222 dbSNP
rs1428330308 223 dbSNP
rs781790921 224 dbSNP
rs782102674 226 dbSNP
rs947732834 262 dbSNP
rs1455789082 286 dbSNP
rs386638798 294 dbSNP
rs7541244 295 dbSNP
rs888683286 296 dbSNP
rs7525135 297 dbSNP
rs570505466 304 dbSNP
rs1207267290 308 dbSNP
rs781858707 313 dbSNP
rs897351867 314 dbSNP
rs75182455 315 dbSNP
rs756222354 320 dbSNP
rs1346791746 324 dbSNP
rs1272723323 327 dbSNP
rs782160590 333 dbSNP
rs1029730969 334 dbSNP
rs954140281 338 dbSNP
rs1006822193 340 dbSNP
rs1313956009 351 dbSNP
rs1022721572 361 dbSNP
rs967957600 370 dbSNP
rs370708445 373 dbSNP
rs1470621467 375 dbSNP
rs542490371 379 dbSNP
rs538147248 380 dbSNP
rs113214764 381 dbSNP
rs916306640 383 dbSNP
rs782667984 384 dbSNP
rs1211427429 390 dbSNP
rs1443960439 391 dbSNP
rs984436620 397 dbSNP
rs575552298 398 dbSNP
rs1289756030 401 dbSNP
rs1226050316 406 dbSNP
rs1349259744 413 dbSNP
rs186098407 414 dbSNP
rs1294472192 416 dbSNP
rs1450748875 417 dbSNP
rs112026396 419 dbSNP
rs908902782 430 dbSNP
rs941617420 431 dbSNP
rs1037710923 440 dbSNP
rs564574736 443 dbSNP
rs782297706 453 dbSNP
rs533175549 454 dbSNP
rs1401571368 456 dbSNP
rs190909036 457 dbSNP
rs779954865 458 dbSNP
rs934131395 459 dbSNP
rs1051223324 463 dbSNP
rs1473725807 470 dbSNP
rs889828151 470 dbSNP
rs1007394158 476 dbSNP
rs1022287082 477 dbSNP
rs149601183 489 dbSNP
rs1269628074 496 dbSNP
rs1206388771 497 dbSNP
rs1327887200 500 dbSNP
rs1293342233 504 dbSNP
rs7541445 507 dbSNP
rs7541507 515 dbSNP
rs782222395 519 dbSNP
rs1431950309 521 dbSNP
rs535366520 523 dbSNP
rs1318823922 537 dbSNP
rs1456868635 539 dbSNP
rs1031366522 540 dbSNP
rs1166967642 544 dbSNP
rs1407082805 549 dbSNP
rs1411521535 567 dbSNP
rs78403400 569 dbSNP
rs568769774 572 dbSNP
rs1249609276 578 dbSNP
rs1186332188 580 dbSNP
rs1464135977 586 dbSNP
rs991971394 587 dbSNP
rs1223109708 589 dbSNP
rs1319342004 591 dbSNP
rs1023478370 603 dbSNP
rs1344785125 604 dbSNP
rs781995089 613 dbSNP
rs782145662 615 dbSNP
rs782413040 634 dbSNP
rs142859265 636 dbSNP
rs1295425966 642 dbSNP
rs537802857 643 dbSNP
rs147270086 644 dbSNP
rs1391822772 645 dbSNP
rs1166476827 648 dbSNP
rs1448559660 658 dbSNP
rs1267626839 659 dbSNP
rs1192502131 660 dbSNP
rs555634435 676 dbSNP
rs1487237703 694 dbSNP
rs1245575606 710 dbSNP
rs1206566319 711 dbSNP
rs575592447 713 dbSNP
rs940377979 715 dbSNP
rs1228113060 719 dbSNP
rs570977879 730 dbSNP
rs1303712281 769 dbSNP
rs1217636115 774 dbSNP
rs1367053341 779 dbSNP
rs1298785541 780 dbSNP
rs1410427605 781 dbSNP
rs782727449 782 dbSNP
rs1372313619 784 dbSNP
rs1306045775 792 dbSNP
rs533629148 798 dbSNP
rs971768515 804 dbSNP
rs1177821750 814 dbSNP
rs1431075609 816 dbSNP
rs918815148 817 dbSNP
rs934247471 818 dbSNP
rs1484357809 822 dbSNP
rs1250271066 827 dbSNP
rs781844252 830 dbSNP
rs868931824 850 dbSNP
rs774712355 862 dbSNP
rs1483794001 868 dbSNP
rs1258109094 871 dbSNP
rs11119099 872 dbSNP
rs538220743 884 dbSNP
rs1289126869 899 dbSNP
rs1230316159 906 dbSNP
rs1348638804 908 dbSNP
rs1044223306 911 dbSNP
rs903841509 912 dbSNP
rs144620857 914 dbSNP
rs535780308 916 dbSNP
rs1358207781 920 dbSNP
rs1159371453 924 dbSNP
rs1473292052 940 dbSNP
rs1409060353 942 dbSNP
rs1182148991 943 dbSNP
rs1424871211 950 dbSNP
rs1258777591 956 dbSNP
rs1199078839 961 dbSNP
rs1483095087 966 dbSNP
rs371799414 968 dbSNP
rs1210779587 973 dbSNP
rs1327192877 975 dbSNP
rs782795782 984 dbSNP
rs1267561188 987 dbSNP
rs183369135 994 dbSNP
rs1340991477 999 dbSNP
rs1314682748 1000 dbSNP
rs1394087466 1010 dbSNP
rs1378095381 1013 dbSNP
rs1320831416 1025 dbSNP
rs1458463896 1033 dbSNP
rs1385873033 1041 dbSNP
rs1157759232 1044 dbSNP
rs1458927694 1050 dbSNP
rs1370709715 1056 dbSNP
rs575569795 1068 dbSNP
rs1423619637 1075 dbSNP
rs1248992235 1076 dbSNP
rs1190794657 1081 dbSNP
rs1463693872 1089 dbSNP
rs557994824 1090 dbSNP
rs1210502690 1091 dbSNP
rs1127715 1101 dbSNP
rs1358474907 1114 dbSNP
rs1005954902 1118 dbSNP
rs1016397921 1121 dbSNP
rs1358521057 1122 dbSNP
rs1298036744 1125 dbSNP
rs961838658 1141 dbSNP
rs1436908680 1148 dbSNP
rs748582154 1156 dbSNP
rs922948098 1157 dbSNP
rs955614619 1160 dbSNP
rs1317118861 1168 dbSNP
rs987053220 1173 dbSNP
rs911373520 1175 dbSNP
rs1392199522 1183 dbSNP
rs1162011452 1185 dbSNP
rs544558456 1187 dbSNP
rs147449918 1188 dbSNP
rs1043915305 1190 dbSNP
rs925337927 1194 dbSNP
rs935435239 1231 dbSNP
rs1447960754 1232 dbSNP
rs1247645031 1239 dbSNP
rs578062990 1240 dbSNP
rs782553781 1243 dbSNP
rs896525891 1244 dbSNP
rs1208046485 1248 dbSNP
rs1490163278 1249 dbSNP
rs1275176668 1250 dbSNP
rs578162687 1251 dbSNP
rs116704756 1252 dbSNP
rs1269253898 1253 dbSNP
rs1233470179 1263 dbSNP
rs560429416 1267 dbSNP
rs1320988501 1269 dbSNP
rs773777282 1270 dbSNP
rs529044713 1272 dbSNP
rs549010704 1273 dbSNP
rs1016101052 1279 dbSNP
rs1173404011 1280 dbSNP
rs1479118833 1295 dbSNP
rs1376055195 1297 dbSNP
rs1198247083 1302 dbSNP
rs148589514 1305 dbSNP
rs1252470562 1313 dbSNP
rs531226103 1314 dbSNP
rs1481968730 1315 dbSNP
rs782790688 1317 dbSNP
rs1200724073 1345 dbSNP
rs556274119 1348 dbSNP
rs782486384 1350 dbSNP
rs142966656 1351 dbSNP
rs1222377336 1352 dbSNP
rs987000916 1357 dbSNP
rs1350504587 1367 dbSNP
rs1290774472 1368 dbSNP
rs1408493617 1370 dbSNP
rs911447532 1371 dbSNP
rs782622186 1374 dbSNP
rs979971369 1377 dbSNP
rs1416449654 1384 dbSNP
rs1400346776 1389 dbSNP
rs1175902537 1394 dbSNP
rs782254682 1401 dbSNP
rs151096829 1402 dbSNP
rs533690360 1403 dbSNP
rs79190761 1404 dbSNP
rs1187993246 1408 dbSNP
rs1443860467 1410 dbSNP
rs1052542489 1415 dbSNP
rs1276079740 1417 dbSNP
rs1202584889 1421 dbSNP
rs1329270993 1431 dbSNP
rs1269440310 1434 dbSNP
rs1227159381 1435 dbSNP
rs1373246834 1436 dbSNP
rs377349508 1447 dbSNP
rs782684901 1453 dbSNP
rs1285235828 1463 dbSNP
rs1450653019 1466 dbSNP
rs1339027338 1467 dbSNP
rs1336359421 1471 dbSNP
rs1457937911 1472 dbSNP
rs1390986369 1473 dbSNP
rs566724796 1476 dbSNP
rs1398947562 1485 dbSNP
rs1407166867 1493 dbSNP
rs1163709316 1494 dbSNP
rs782175839 1508 dbSNP
rs1240992661 1515 dbSNP
rs1182637147 1529 dbSNP
rs1465048164 1531 dbSNP
rs1045107947 1537 dbSNP
rs1249425897 1549 dbSNP
rs187558068 1560 dbSNP
rs577781027 1562 dbSNP
rs1006144717 1573 dbSNP
rs1315752263 1575 dbSNP
rs1037930758 1584 dbSNP
rs367553876 1585 dbSNP
rs1230489018 1586 dbSNP
rs897697365 1592 dbSNP
rs141041350 1593 dbSNP
rs1030068804 1600 dbSNP
rs890217230 1611 dbSNP
rs112324123 1613 dbSNP
rs1367614060 1619 dbSNP
rs1436166950 1619 dbSNP
rs1017275103 1624 dbSNP
rs964613013 1627 dbSNP
rs1430118985 1638 dbSNP
rs1324158444 1642 dbSNP
rs979744200 1649 dbSNP
rs1032903468 1664 dbSNP
rs956885391 1676 dbSNP
rs1162695159 1678 dbSNP
rs1449781757 1679 dbSNP
rs1391649330 1680 dbSNP
rs1485278512 1683 dbSNP
rs1246754131 1685 dbSNP
rs1224492768 1701 dbSNP
rs1450382203 1709 dbSNP
rs988320210 1713 dbSNP
rs917982467 1723 dbSNP
rs949449104 1726 dbSNP
rs980733668 1734 dbSNP
rs765938897 1738 dbSNP
rs149702887 1745 dbSNP
rs11589 1759 dbSNP
rs1438593019 1760 dbSNP
rs1363647109 1772 dbSNP
rs1302412351 1773 dbSNP
rs115316682 1776 dbSNP
rs1372136979 1782 dbSNP
rs1167932138 1784 dbSNP
rs1427536139 1785 dbSNP
rs1425332816 1800 dbSNP
rs1192425841 1802 dbSNP
rs1479131424 1806 dbSNP
rs1268815464 1809 dbSNP
rs1484258273 1810 dbSNP
rs540740544 1812 dbSNP
rs1204146123 1813 dbSNP
rs782235453 1815 dbSNP
rs1303599284 1827 dbSNP
rs1217564206 1828 dbSNP
rs1344912426 1830 dbSNP
rs1282599357 1838 dbSNP
rs897640674 1851 dbSNP
rs369279969 1856 dbSNP
rs77899994 1862 dbSNP
rs782382576 1863 dbSNP
rs1359384650 1869 dbSNP
rs1461231142 1869 dbSNP
rs1177712973 1870 dbSNP
rs1467792901 1877 dbSNP
rs1427938801 1881 dbSNP
rs1183582602 1888 dbSNP
rs1473843822 1893 dbSNP
rs1248927954 1894 dbSNP
rs1176978969 1898 dbSNP
rs1483752288 1912 dbSNP
rs542774838 1913 dbSNP
rs1258012599 1922 dbSNP
rs1201968903 1927 dbSNP
rs1051567105 1930 dbSNP
rs1322974807 1939 dbSNP
rs1268830207 1960 dbSNP
rs890166446 1964 dbSNP
rs1228993642 1969 dbSNP
rs781905748 1973 dbSNP
rs1007273825 1974 dbSNP
rs1017683502 1976 dbSNP
rs1304700745 1977 dbSNP
rs904209637 1977 dbSNP
rs562530047 1982 dbSNP
rs1379562388 1986 dbSNP
rs1304258442 1995 dbSNP
rs574236428 1996 dbSNP
rs1159239947 1998 dbSNP
rs956959487 1999 dbSNP
rs1158959548 2003 dbSNP
rs1424792840 2004 dbSNP
rs1258670340 2007 dbSNP
rs1182033202 2009 dbSNP
rs1461029600 2013 dbSNP
rs190845827 2016 dbSNP
rs1210677086 2018 dbSNP
rs1348556587 2020 dbSNP
rs1258913978 2043 dbSNP
rs1025155225 2044 dbSNP
rs1322146288 2045 dbSNP
rs1243384610 2066 dbSNP
rs1381576104 2069 dbSNP
rs1320728202 2076 dbSNP
rs183041409 2077 dbSNP
rs1382095357 2078 dbSNP
rs1288842579 2081 dbSNP
rs1458849970 2081 dbSNP
rs543389600 2092 dbSNP
rs1162052898 2096 dbSNP
rs1444322064 2099 dbSNP
rs77534575 2101 dbSNP
rs1142795 2102 dbSNP
rs11539427 2103 dbSNP
rs1261089762 2103 dbSNP
rs1445380418 2103 dbSNP
rs1204534511 2105 dbSNP
rs942071474 2118 dbSNP
rs782437185 2122 dbSNP
rs1243502118 2123 dbSNP
rs1358406938 2129 dbSNP
rs782804293 2136 dbSNP
rs973825517 2137 dbSNP
rs1297924682 2141 dbSNP
rs919159458 2143 dbSNP
rs545447203 2146 dbSNP
rs1294217598 2151 dbSNP
rs1387928196 2161 dbSNP
rs1368010302 2163 dbSNP
rs563181716 2164 dbSNP
rs1051515255 2165 dbSNP
rs188566971 2176 dbSNP
rs943122191 2178 dbSNP
rs1038808933 2179 dbSNP
rs1371513135 2187 dbSNP
rs1170759998 2194 dbSNP
rs1474536432 2201 dbSNP
rs1372632597 2204 dbSNP
rs904282214 2216 dbSNP
rs367583228 2219 dbSNP
rs1434912036 2220 dbSNP
rs569347839 2235 dbSNP
rs192770805 2239 dbSNP
rs553958087 2241 dbSNP
rs1053199580 2262 dbSNP
rs1220112315 2265 dbSNP
rs11539428 2276 dbSNP
rs1275063474 2277 dbSNP
rs1009855874 2286 dbSNP
rs1337037439 2290 dbSNP
rs1250345585 2292 dbSNP
rs1233360643 2302 dbSNP
rs1025144012 2306 dbSNP
rs1346795658 2312 dbSNP
rs970908135 2317 dbSNP
rs1281962906 2319 dbSNP
rs1002686763 2323 dbSNP
rs1404843661 2326 dbSNP
rs1351539467 2331 dbSNP
rs1331274601 2332 dbSNP
rs1033740957 2335 dbSNP
rs1396040845 2338 dbSNP
rs1408495138 2338 dbSNP
rs1173318254 2339 dbSNP
rs1427256261 2341 dbSNP
rs1197255596 2342 dbSNP
rs1480063731 2343 dbSNP
rs1252356065 2352 dbSNP
rs1183728611 2370 dbSNP
rs1435808629 2372 dbSNP
rs1271881348 2375 dbSNP
rs1200636812 2377 dbSNP
rs1325119621 2384 dbSNP
rs184742000 2386 dbSNP
rs1223502059 2394 dbSNP
rs1330418774 2394 dbSNP
rs571671993 2395 dbSNP
rs782084488 2414 dbSNP
rs187667048 2429 dbSNP
rs1335153839 2433 dbSNP
rs919269878 2436 dbSNP
rs950631286 2443 dbSNP
rs1404080117 2452 dbSNP
rs530452467 2456 dbSNP
rs1175797579 2466 dbSNP
rs554324155 2468 dbSNP
rs574114990 2469 dbSNP
rs1160179889 2478 dbSNP
rs77214751 2481 dbSNP
rs556372314 2482 dbSNP
rs1187874280 2486 dbSNP
rs146697160 2488 dbSNP
rs1039295697 2494 dbSNP
rs115802123 2496 dbSNP
rs11119102 2505 dbSNP
rs1286979739 2515 dbSNP
rs1222523239 2534 dbSNP
rs527302640 2552 dbSNP
rs1285145496 2558 dbSNP
rs191240143 2564 dbSNP
rs560699097 2565 dbSNP
rs1435938357 2574 dbSNP
rs1320251828 2580 dbSNP
rs1009804485 2581 dbSNP
rs1398855252 2587 dbSNP
rs1407053345 2599 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.716 6.1e-5 0.706 8.4e-5 23 Click to see details
GSE38226 Liver fibrosis -0.519 8.0e-3 -0.371 4.9e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.333 5.6e-2 -0.309 7.1e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.296 7.5e-2 -0.138 2.6e-1 25 Click to see details
GSE19783 ER- ER- breast cancer 0.118 1.5e-1 0.101 1.9e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.214 1.5e-1 0.377 3.2e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.24 1.5e-1 0.232 1.6e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.159 1.9e-1 -0.023 4.5e-1 32 Click to see details
GSE28544 Breast cancer 0.159 2.3e-1 0.060 3.9e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.231 2.4e-1 -0.028 4.7e-1 12 Click to see details
GSE19536 Breast cancer 0.065 2.6e-1 0.083 2.1e-1 100 Click to see details
GSE14794 Lymphoblastoid cells -0.068 2.6e-1 -0.128 1.1e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.135 2.9e-1 -0.409 3.7e-2 20 Click to see details
GSE21849 B cell lymphoma 0.108 2.9e-1 0.073 3.5e-1 29 Click to see details
GSE21032 Prostate cancer 0.059 3.0e-1 -0.020 4.3e-1 83 Click to see details
GSE21687 Ependynoma primary tumors 0.048 3.5e-1 -0.025 4.2e-1 64 Click to see details
GSE28260 Renal cortex and medulla 0.104 3.7e-1 0.055 4.3e-1 13 Click to see details
GSE17306 Multiple myeloma 0.035 4.1e-1 0.021 4.4e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.014 4.8e-1 -0.071 4.0e-1 16 Click to see details
GSE27834 Pluripotent stem cells 0.014 4.8e-1 -0.071 4.0e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.507 0 0.487 0 68 Click to see details
KICH 0.531 0 0.454 0.01 25 Click to see details
THCA 0.349 0 0.353 0 59 Click to see details
STAD 0.457 0 0.440 0.01 32 Click to see details
BLCA 0.521 0.01 0.412 0.04 18 Click to see details
PAAD 0.928 0.04 1.000 0.5 4 Click to see details
KIRP 0.305 0.04 0.215 0.12 32 Click to see details
CESC -0.99 0.05 -1.000 0.5 3 Click to see details
LUSC 0.266 0.05 0.303 0.03 38 Click to see details
BRCA -0.154 0.08 -0.139 0.1 84 Click to see details
HNSC 0.163 0.15 0.150 0.17 42 Click to see details
CHOL -0.371 0.16 -0.200 0.3 9 Click to see details
LIHC 0.142 0.17 0.173 0.12 49 Click to see details
ESCA 0.24 0.24 0.345 0.15 11 Click to see details
PRAD 0.096 0.25 0.056 0.35 50 Click to see details
PCPG 0.691 0.26 0.500 0.33 3 Click to see details
LUAD -0.123 0.35 -0.042 0.45 12 Click to see details
COAD 0.097 0.41 -0.190 0.33 8 Click to see details
UCEC -0.005 0.49 0.130 0.3 19 Click to see details
UCEC -0.005 0.49 0.130 0.3 19 Click to see details
UCEC -0.005 0.49 0.130 0.3 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*